. . "The Evidence & Conclusion Ontology (ECO) describes types of scientific evidence within the biological research domain that arise from laboratory experiments, computational methods, literature curation, or other means."^^ . "Evidence & Conclusion Ontology (ECO)"^^ . . "20:10:2021 16:01"^^ . "eco"^^ . "ECO (https://github.com/evidenceontology/evidenceontology) is released into the public domain under CC0 1.0 Universal (CC0 1.0). Anyone is free to copy, modify, or distribute the work, even for commercial purposes, without asking permission. Please see the Public Domain Dedication (https://creativecommons.org/publicdomain/zero/1.0/) for an easy-to-read description of CC0 1.0 or the full legal code (https://creativecommons.org/publicdomain/zero/1.0/legalcode) for more detailed information. To get a sense of why ECO is CC0 as opposed to licensed under CC-BY, please read this thoughtful discussion (https://github.com/OBOFoundry/OBOFoundry.github.io/issues/285) on the OBO Foundry GitHub site."^^ . . "has GO evidence code" . . "A phrase describing how a term should be used and/or a citation to a work which uses it. May also include other kinds of examples that facilitate immediate understanding, such as widely know prototypes or instances of a class, or cases where a relation is said to hold."^^ . . "example of usage"^^ . . "The official definition, explaining the meaning of a class or property. Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions."^^ . . "definition"^^ . . "Name of editor entering the term in the file. The term editor is a point of contact for information regarding the term. The term editor may be, but is not always, the author of the definition, which may have been worked upon by several people"^^ . . "term editor"^^ . . "formal citation, e.g. identifier in external database to indicate / attribute source(s) for the definition. Free text indicate / attribute source(s) for the definition. EXAMPLE: Author Name, URI, MeSH Term C04, PUBMED ID, Wiki uri on 31.01.2007"^^ . . "definition source"^^ . . "The 'term requester' can credit the person, organization or project who request the ontology term.,The name of the person, project, or organization that motivated inclusion of an ontology term by requesting its addition."^^ . "IAO"^^ . "ontology term requester"^^ . . "Grouping classes used by GO"^^ . "go_groupings"^^ . . . "GO biological process terms should be used in the GO with/from field"^^ . "valid_with_biological_process"^^ . . . "GO cellular component terms should be used in the GO with/from field"^^ . "valid_with_cellular_component"^^ . . . "Chemical entity IDs should be used in the GO with/from field"^^ . "valid_with_chemical_entity"^^ . . . "Gene IDs should be used in the GO with/from field"^^ . "valid_with_gene"^^ . . . "GO molecular function terms should be used in the GO with/from field"^^ . "valid_with_molecular_function"^^ . . . "Protein IDs should be used in the GO with/from field"^^ . "valid_with_protein"^^ . . . "Protein complex IDs should be used in the GO with/from field"^^ . "valid_with_protein_complex"^^ . . . "Transcript IDs should be used in the GO with/from field"^^ . "valid_with_transcript"^^ . . . "description"^^ . . "title"^^ . . "license"^^ . . "subset_property"^^ . . "auto-generated-by"^^ . . "created_by"^^ . . "creation_date"^^ . . "date"^^ . . "default-namespace"^^ . . "has_alternative_id"^^ . . "has_broad_synonym"^^ . . "database_cross_reference"^^ . . "has_exact_synonym"^^ . . "has_narrow_synonym"^^ . . "has_obo_format_version"^^ . . "has_obo_namespace"^^ . . "has_related_synonym"^^ . . "id"^^ . . "in_subset"^^ . . "is_inferred"^^ . . "saved-by"^^ . . "shorthand"^^ . . . . . . . _:genid1 . _:genid1 . . . "a core relation that holds between a part and its whole"@en . "part_of"^^ . "part of"@en . "part of"^^ . . _:genid2 . _:genid2 . . "a core relation that holds between a whole and its part"@en . "has_part"^^ . "has part"@en . "has part"^^ . . _:genid3 . _:genid3 . . . . "realized in"@en . . _:genid4 . _:genid4 . . . "realizes"@en . . . . . . "preceded by"@en . . . . . . "precedes"@en . . . . . "A relation connecting a piece of evidence to an assertion method, where that assertion method is supported by the evidence."^^ . "mchibucos"^^ . "2010-12-09T05:00:20Z"^^ . "ECO:9000000"^^ . "eco"^^ . "used_in"^^ . "used_in"^^ . "In the future we may use a more generic relation with weaker domain and range constraints taken from IAO, RO or OBI."^^ . "used_in"^^ . _:genid5 . _:genid5 . _:genid5 . _:genid5 "A relation connecting a piece of evidence to an assertion method, where that assertion method is supported by the evidence."^^ . _:genid5 "GOC:cjm"^^ . . "ECO:9000001"^^ . "eco"^^ . "uses"^^ . "uses"^^ . "uses"^^ . . . . . "has measurement unit label"@en . . . "is_about is a (currently) primitive relation that relates an information artifact to an entity."@en . "is about"@en . . _:genid6 . _:genid6 . . . . . "m is a quality measurement of q at t when\nq is a quality \nthere is a measurement process p that has specified output m, a measurement datum, that is about q"@en . "is quality measurement of"@en . . . . . "relates a process to a time-measurement-datum that represents the duration of the process"@en . "is duration of"@en . . _:genid7 . _:genid7 . "inverse of the relation of is quality measurement of"@en . "is quality measured as"@en . . _:genid8 . _:genid8 . . . . "A relation between a planned process and a continuant participating in that process that is not created during the process. The presence of the continuant during the process is explicitly specified in the plan specification which the process realizes the concretization of."@en . "has_specified_input"@en . . _:genid9 . _:genid9 . . . "A relation between a planned process and a continuant participating in that process that is not created during the process. The presence of the continuant during the process is explicitly specified in the plan specification which the process realizes the concretization of."@en . "is_specified_input_of"@en . . _:genid10 . _:genid10 . . . . "A relation between a planned process and a continuant participating in that process. The presence of the continuant at the end of the process is explicitly specified in the objective specification which the process realizes the concretization of."@en . "has_specified_output"@en . . . _:genid11 . _:genid12 . _:genid13 . _:genid12 _:genid13 . _:genid13 . _:genid11 _:genid12 . _:genid11 . "c is_manufactured_by o means that there was a process p in which c was built in which a person, or set of people or machines did the work(bore the \"Manufacturer Role\", and those people/and or machines were members or of directed by the organization to do this."@en . "is_manufactured_by"@en . . _:genid14 . _:genid14 . . . "A relation between a planned process and a continuant participating in that process. The presence of the continuant at the end of the process is explicitly specified in the objective specification which the process realizes the concretization of."@en . "is_specified_output_of"@en . . . . . "This relation obtains between a planned process and a objective specification when the criteria specified in the objective specification are met at the end of the planned process."^^ . "achieves_planned_objective"^^ . . . "the relation of the cells in the finger of the skin to the finger, in which an indeterminate number of grains are parts of the whole by virtue of being grains in a collective that is part of the whole, and in which removing one granular part does not nec- essarily damage or diminish the whole. Ontological Whether there is a fixed, or nearly fixed number of parts - e.g. fingers of the hand, chambers of the heart, or wheels of a car - such that there can be a notion of a single one being missing, or whether, by contrast, the number of parts is indeterminate - e.g., cells in the skin of the hand, red cells in blood, or rubber molecules in the tread of the tire of the wheel of the car."^^ . "has grain"^^ . . . "A relation between an organisation or person and a material entity who owned or has license to the material entity and there was a legal transfer of ownership or licensing of the material entity to the current owner."^^ . "supplies"^^ . . . _:genid15 . _:genid16 . _:genid17 . _:genid16 _:genid17 . _:genid17 . _:genid15 _:genid16 . _:genid15 . "A relation between a material entity and an organisation or person who owned or has license to the material entity and there was a legal transfer of ownership or licensing of the material entity to the current owner."^^ . "has_supplier"^^ . . . . "This relation obtains between an objective specification and a planned process when the criteria specified in the objective specification are met at the end of the planned process."^^ . "objective_achieved_by"^^ . . . . . "A relation between an information content entity and a value specification that specifies its value." . "has value specification" . . . . "A relationship between two material entities that form a complex based on a selective, non-covalent interaction." . "bound_to"^^ . . _:genid18 . _:genid18 . . "a relation between a specifically dependent continuant (the dependent) and an independent continuant (the bearer), in which the dependent specifically depends on the bearer for its existence"@en . "inheres in"@en . . _:genid19 . _:genid19 . . "a relation between an independent continuant (the bearer) and a specifically dependent continuant (the dependent), in which the dependent specifically depends on the bearer for its existence"@en . "bearer of"@en . . _:genid20 . _:genid20 . . . . "a relation between a continuant and a process, in which the continuant is somehow involved in the process"@en . "participates in"@en . . _:genid21 . _:genid21 . . . "a relation between a process and a continuant, in which the continuant is somehow involved in the process"@en . "has participant"@en . . _:genid22 . _:genid22 . . . . "A relationship between a generically dependent continuant and a specifically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. A generically dependent continuant may be concretized as multiple specifically dependent continuants."@en . "is concretized as"@en . . _:genid23 . _:genid23 . . . "A relationship between a specifically dependent continuant and a generically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. Multiple specifically dependent continuants can concretize the same generically dependent continuant."@en . "concretizes"@en . . _:genid24 . _:genid24 . . . . "a relation between a function and an independent continuant (the bearer), in which the function specifically depends on the bearer for its existence"@en . "function of"@en . . _:genid25 . _:genid25 . . . "a relation between a quality and an independent continuant (the bearer), in which the quality specifically depends on the bearer for its existence"@en . "quality of"@en . . _:genid26 . _:genid26 . . . "a relation between a role and an independent continuant (the bearer), in which the role specifically depends on the bearer for its existence"@en . "role of"@en . . _:genid27 . _:genid27 . . . . "a relation between an independent continuant (the bearer) and a function, in which the function specifically depends on the bearer for its existence"@en . "has function"@en . . _:genid28 . _:genid28 . . . "a relation between an independent continuant (the bearer) and a quality, in which the quality specifically depends on the bearer for its existence"@en . "has quality"@en . . _:genid29 . _:genid29 . . . . "a relation between an independent continuant (the bearer) and a role, in which the role specifically depends on the bearer for its existence"@en . "has role"@en . . "A relation between an independent continuant (the bearer) and a disposition, in which the disposition specifically depends on the bearer for its existence" . . "has disposition" . . _:genid30 . _:genid30 . . . . . "a relation between two distinct material entities, the new entity and the old entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity"@en . "derives from"@en . . _:genid31 . _:genid31 . "a relation between two distinct material entities, the old entity and the new entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity"@en . "derives into"@en . . _:genid32 . _:genid32 . . . "a relation between two independent continuants, the location and the target, in which the target is entirely within the location"@en . "location of"@en . . _:genid33 . _:genid33 . . "a relation between two independent continuants, the target and the location, in which the target is entirely within the location"@en . "located in"@en . . . . "immediately preceded by"@en . . . "immediately precedes"@en . . . "regulates"^^ . "regulates"^^ . . . "negatively_regulates"^^ . "negatively regulates"^^ . . . _:genid34 . _:genid35 . _:genid34 _:genid35 . _:genid35 . _:genid34 . "positively_regulates"^^ . "positively regulates"^^ . . . "temporal relation"@en . . _:genid36 . _:genid36 . . . "is member of is a mereological relation between a item and a collection." . "member of"@en . . _:genid37 . _:genid37 . . . "has member is a mereological relation between a collection and an item." . "has member"@en . . . . . . "has measurement value"@en . . . . . "A relation between a value specification and a number that quantifies it." . "has specified numeric value" . . . "A relation between a value specification and a literal." . "has specified value"@en . . "entity"@en . . . . "An entity that exists in full at any time in which it exists at all, persists through time while maintaining its identity and has no temporal parts."@en . "continuant"@en . . . "An entity that has temporal parts and that happens, unfolds or develops through time."@en . "occurrent"@en . . . . . "A continuant that is a bearer of quality and realizable entity entities, in which other entities inhere and which itself cannot inhere in anything."@en . "independent continuant"@en . . . "An occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t."@en . "process"@en . . . . "disposition"@en . . . . "A specifically dependent continuant that inheres in continuant entities and are not exhibited in full at every time in which it inheres in an entity or group of entities. The exhibition or actualization of a realizable entity is a particular manifestation, functioning or process that occurs under certain circumstances."@en . "realizable entity"@en . . . "quality"@en . . . . "A continuant that inheres in or is borne by other entities. Every instance of A requires some specific instance of B which must always be the same."@en . "specifically dependent continuant"@en . . . "A realizable entity the manifestation of which brings about some result or end that is not essential to a continuant in virtue of the kind of thing that it is but that can be served or participated in by that kind of continuant in some kinds of natural, social or institutional contexts."@en . "role"@en . . . "site"@en . . . "A continuant that is dependent on one or other independent continuant bearers. For every instance of A requires some instance of (an independent continuant type) B but which instance of B serves can change from time to time."@en . "generically dependent continuant"@en . . . "function"@en . . . . "An independent continuant that is spatially extended whose identity is independent of that of other entities and can be maintained through time."@en . "material entity"@en . . . "immaterial entity"@en . . . "An adenosine 5'-phosphate in which the 5'-phosphate is a triphosphate group. It is involved in the transportation of chemical energy during metabolic pathways."^^ . "ATP"^^ . . . "Amide derived from two or more amino carboxylic acid molecules (the same or different) by formation of a covalent bond from the carbonyl carbon of one to the nitrogen atom of another with formal loss of water. The term is usually applied to structures formed from alpha-amino acids, but it includes those derived from any amino carboxylic acid. X = OH, OR, NH2, NHR, etc."^^ . "peptide"^^ . . . "High molecular weight, linear polymers, composed of nucleotides containing deoxyribose and linked by phosphodiester bonds; DNA contain the genetic information of organisms."^^ . "deoxyribonucleic acid"^^ . . . "Any constitutionally or isotopically distinct atom, molecule, ion, ion pair, radical, radical ion, complex, conformer etc., identifiable as a separately distinguishable entity."^^ . "molecular entity"^^ . . . "cytochalasin"^^ . . . "A member of the class of acrylamides that results from the formal condensation of acrylic acid with ammonia."^^ . "acrylamide"^^ . . . "A chemical entity constituting the smallest component of an element having the chemical properties of the element."^^ . "atom"^^ . . . "A macromolecule made up of nucleotide units and hydrolysable into certain pyrimidine or purine bases (usually adenine, cytosine, guanine, thymine, uracil), D-ribose or 2-deoxy-D-ribose and phosphoric acid."^^ . "nucleic acid"^^ . . . "High molecular weight, linear polymers, composed of nucleotides containing ribose and linked by phosphodiester bonds; RNA is central to the synthesis of proteins."^^ . "ribonucleic acid"^^ . . . "A macromolecule is a molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass."^^ . "macromolecule"^^ . . . "double-stranded DNA"^^ . . . "A pyrimidine 2'-deoxyribonucleoside compound having 5-bromouracil as the nucleobase."^^ . "5-bromo-2'-deoxyuridine"^^ . . . "A synthetic radioactive isotope of chromium having a half-life of 27.7 days and decaying by electron capture with emission of gamma rays (0.32 MeV); it is used to label red blood cells for measurement of mass or volume, survival time, and sequestration studies, for the diagnosis of gastrointestinal bleeding, and to label platelets to study their survival."^^ . "chromium-51"^^ . . . "Thymidine linked to the radioisotope tritium. Used to label DNA in the study of cellular and viral DNA synthesis."^^ . "tritiated thymidine"^^ . . . "Any type of microscopy where the specimen can be made to fluoresce (emit energy as visible light) by illuminating it with light of specific wavelengths. These specimens are called fluorophores."^^ . "fluorescence microscopy"^^ . . . "Microscopy where the specimen is illuminated with visible light and a system of lenses is used to produce an image."^^ . "light microscopy"^^ . . . "A material entity of anatomical origin (part of or deriving from an organism) that has as its parts a maximally connected cell compartment surrounded by a plasma membrane."^^ . "cell"@en . "cell"^^ . . . _:genid38 . _:genid40 _:genid39 . _:genid39 . _:genid39 . _:genid39 . _:genid42 _:genid41 . _:genid40 _:genid42 . _:genid41 . _:genid41 . _:genid43 . _:genid43 . _:genid43 . _:genid41 _:genid43 . _:genid42 . _:genid38 _:genid40 . _:genid38 . "A cell in vitro that is or has been maintained or propagated as part of a cell culture."^^ . "cultured cell"^^ . . . "A lymphocyte of B lineage with the phenotype CD19-positive, CD20-positive, and capable of B cell mediated immunity."^^ . "B cell"^^ . . . "A lymphocyte is a leukocyte commonly found in the blood and lymph that has the characteristics of a large nucleus, a neutral staining cytoplasm, and prominent heterochromatin."^^ . "lymphocyte"^^ . . . . _:genid44 . _:genid44 . _:genid44 . _:genid44 . "A cell in vitro that has undergone physical changes as a consequence of a deliberate and specific experimental procedure."^^ . "experimentally modified cell in vitro"^^ . . . "A leukocyte with a single non-segmented nucleus in the mature form."^^ . "mononuclear cell"^^ . . . "A type of information that is used to support an assertion."^^ . "eco"^^ . "evidence code"^^ . "evidence_code"^^ . "ECO:0000000"^^ . "evidence"^^ . _:genid45 . _:genid45 . _:genid45 . _:genid45 "A type of information that is used to support an assertion."^^ . _:genid45 "ECO:MCC"^^ . . . "A type of curator inference where conclusions are drawn based on the background scientific knowledge of the curator."^^ . "eco"^^ . "ECO:0000001"^^ . "inference from background scientific knowledge"^^ . _:genid46 . _:genid46 . _:genid46 . _:genid46 "A type of curator inference where conclusions are drawn based on the background scientific knowledge of the curator."^^ . _:genid46 "ECO:SN"^^ . . . _:genid47 . _:genid47 . _:genid47 . _:genid47 . "A type of experimental evidence resulting from the direct measurement of some aspect of a biological feature."^^ . "ECO:0005006"^^ . "eco"^^ . "ECO:0000002"^^ . "direct assay evidence"^^ . _:genid48 . _:genid48 . _:genid48 . _:genid48 "A type of experimental evidence resulting from the direct measurement of some aspect of a biological feature."^^ . _:genid48 "ECO:SN"^^ . . . "A type of direct assay evidence based on reconstructing a biological sample from its disassociated state to its original state."^^ . "eco"^^ . "ECO:0000003"^^ . "reconstitution assay evidence"^^ . _:genid49 . _:genid49 . _:genid49 . _:genid49 "A type of direct assay evidence based on reconstructing a biological sample from its disassociated state to its original state."^^ . _:genid49 "ECO:KAV"^^ . _:genid49 "PMID:26029343"^^ . . . "A type of fractionation evidence where sub-cellular components are separated based on their physical properties such as density in a sucrose density gradient."^^ . "eco"^^ . "cell fractionation"^^ . "ECO:0000004"^^ . "If using this term for Gene Ontology annotation, it would be used most typically for annotations to the cellular component ontology."^^ . "cell fractionation evidence"^^ . _:genid50 . _:genid50 . _:genid50 . _:genid50 "A type of fractionation evidence where sub-cellular components are separated based on their physical properties such as density in a sucrose density gradient."^^ . _:genid50 "ECO:KIM"^^ . _:genid50 "TAIR:TED"^^ . . . _:genid51 . _:genid51 . _:genid51 . _:genid51 . _:genid52 . _:genid52 . _:genid53 . _:genid54 . _:genid56 _:genid55 . _:genid54 _:genid56 . _:genid55 . _:genid55 . _:genid57 . _:genid57 . _:genid57 . _:genid55 _:genid57 . _:genid56 . _:genid53 _:genid54 . _:genid52 _:genid53 . _:genid52 . _:genid58 . _:genid58 . _:genid59 . _:genid60 . _:genid62 _:genid61 . _:genid60 _:genid62 . _:genid61 . _:genid61 . _:genid61 . _:genid62 . _:genid59 _:genid60 . _:genid58 _:genid59 . _:genid58 . "A type of protein assay evidence where the catalytic activity of an enzyme is determined."^^ . "ECO:0005001"^^ . "MI:0415"^^ . "enzyme assay evidence"^^ . "eco"^^ . "enzyme assays"^^ . "ECO:0000005"^^ . "enzymatic activity assay evidence"^^ . _:genid63 . _:genid63 . _:genid63 . _:genid63 "A type of protein assay evidence where the catalytic activity of an enzyme is determined."^^ . _:genid63 "url:http://www.sciencedirect.com/science/article/pii/S2213020914000068"^^ . _:genid64 . _:genid64 . _:genid64 . _:genid64 "MI:0415"^^ . _:genid64 "enzymatic study"^^ . . . . _:genid65 . _:genid65 . _:genid65 . _:genid65 . _:genid66 . _:genid66 . _:genid67 . _:genid68 . _:genid70 _:genid69 . _:genid68 _:genid70 . _:genid69 . _:genid69 . _:genid71 . _:genid71 . _:genid71 . _:genid69 _:genid71 . _:genid70 . _:genid67 _:genid68 . _:genid66 _:genid67 . _:genid66 . "A type of evidence resulting from manipulation of variables in order to discover cause and effect."^^ . "ECO:0005023"^^ . "eco"^^ . "ECO:0000006"^^ . . "experimental evidence"^^ . _:genid72 . _:genid72 . _:genid72 . _:genid72 "A type of evidence resulting from manipulation of variables in order to discover cause and effect."^^ . _:genid72 "url:http://holah.co.uk/page/experimental/"^^ . _:genid73 . _:genid73 . _:genid73 . _:genid73 . _:genid73 "true"^^ . . . "A type of protein detection assay evidence where a fluorescently labeled antibody is used to detect the presence or localization of a biomolecule within a cell."^^ . "eco"^^ . "immunofluorescence"^^ . "ECO:0000007"^^ . "immunofluorescence evidence"^^ . _:genid74 . _:genid74 . _:genid74 . _:genid74 "A type of protein detection assay evidence where a fluorescently labeled antibody is used to detect the presence or localization of a biomolecule within a cell."^^ . _:genid74 "ECO:MCC"^^ . _:genid74 "TAIR:TED"^^ . . . "The 10 previously identified GlnR-regulated genes were all confirmed to be under GlnR control during nitrogen stress (i.e. differential expression in the wild type compared to the DeltaglnR mutant), but in addition a total of 392 genes were significantly up-regulated and 291 significantly down regulated (Additional file 1: Table S1). This indicates that GlnR mediates (directly or indirectly) the expression of over 680 genes."^^ . "A type of experimental evidence that is based on characterization of gene expression."^^ . "eco"^^ . "ECO:0000008"^^ . "Use this evidence type when the annotation is inferred from the timing or location of expression of a gene. It may be difficult to determine whether the expression pattern truly indicates that a gene plays a role in a given process."^^ . "expression pattern evidence"^^ . _:genid75 . _:genid75 . _:genid75 . _:genid75 "The 10 previously identified GlnR-regulated genes were all confirmed to be under GlnR control during nitrogen stress (i.e. differential expression in the wild type compared to the DeltaglnR mutant), but in addition a total of 392 genes were significantly up-regulated and 291 significantly down regulated (Additional file 1: Table S1). This indicates that GlnR mediates (directly or indirectly) the expression of over 680 genes."^^ . _:genid75 "PMID:23642041"^^ . _:genid76 . _:genid76 . _:genid76 . _:genid76 "A type of experimental evidence that is based on characterization of gene expression."^^ . _:genid76 "ECO:MCC"^^ . _:genid76 "GO:IEP"^^ . . . _:genid77 . _:genid77 . _:genid77 . _:genid77 . _:genid78 . _:genid78 . _:genid78 . _:genid78 . _:genid79 . _:genid79 . _:genid80 . _:genid81 . _:genid83 _:genid82 . _:genid81 _:genid83 . _:genid82 . _:genid82 . _:genid84 . _:genid84 . _:genid84 . _:genid82 _:genid84 . _:genid83 . _:genid80 _:genid81 . _:genid79 _:genid80 . _:genid79 . "A type of expression pattern evidence where abundance of a transcript is analyzed."^^ . "ECO:0000048"^^ . "transcript expression level evidence"^^ . "transcriptomics evidence"^^ . "eco"^^ . "ECO:0000009"^^ . "transcript expression evidence"^^ . _:genid85 . _:genid85 . _:genid85 . _:genid85 "A type of expression pattern evidence where abundance of a transcript is analyzed."^^ . _:genid85 "ECO:RCT"^^ . . . "In the BL21(DE3)(pJS429) cells, the levels of ClpP2s and VapC10 remained unchanged over a 2-hour period of translation arrest, but the VapB10 level showed to be decreased with a half-life (Figure 7C) similar to that observed in the strain BL21(DE3)(pJS883) (Figure 7B). These indicate that ClpXP2s could degrade VapB10 regardless of the presence or absence of VapC10."^^ . "A type of expression pattern evidence resulting from protein abundance quantification techniques."^^ . "ECO:0000046"^^ . "protein expression level evidence"^^ . "eco"^^ . "ECO:0000010"^^ . "protein expression evidence"^^ . _:genid86 . _:genid86 . _:genid86 . _:genid86 "In the BL21(DE3)(pJS429) cells, the levels of ClpP2s and VapC10 remained unchanged over a 2-hour period of translation arrest, but the VapB10 level showed to be decreased with a half-life (Figure 7C) similar to that observed in the strain BL21(DE3)(pJS883) (Figure 7B). These indicate that ClpXP2s could degrade VapB10 regardless of the presence or absence of VapC10."^^ . _:genid86 "PMID:24260461"^^ . _:genid87 . _:genid87 . _:genid87 . _:genid87 "A type of expression pattern evidence resulting from protein abundance quantification techniques."^^ . _:genid87 "NBK:22011"^^ . _:genid87 "PMC:4029002"^^ . _:genid87 "url:http://www.informatics.jax.org/glossary/gain-of-function"^^ . _:genid87 "url:https://www.thermofisher.com/us/en/home/life-science/protein-biology/protein-biology-learning-center/protein-biology-resource-library/pierce-protein-methods/overview-protein-expression-systems.html"^^ . . . "A type of experimental phenotypic evidence resulting from the effect that a given gene has on another gene or genes, and the products."^^ . "TAIR:TED"^^ . "eco"^^ . "ECO:0000011"^^ . "genetic interaction evidence"^^ . _:genid88 . _:genid88 . _:genid88 . _:genid88 "A type of experimental phenotypic evidence resulting from the effect that a given gene has on another gene or genes, and the products."^^ . _:genid88 "ECO:RCT"^^ . _:genid88 "PMID:11822023"^^ . . . "In addition, complementation of the ompR mutation in strain AR6 with plasmid pBR3 resulted in an increase in beta-galactosidase activity (1303 +- 80 Miller units), indicating that the His-tagged OmpR protein, expressed from the gene introduced in trans, was able to positively regulate flhDC expression."^^ . "Trans-complementation of fimR on pDL276 (pHR6) in strain DeltafimR harboring pfim(445 b)-cat restored wild-type pfim expression (Figure S1). Taken together, pfim is negatively regulated by FimR."^^ . "A type of genetic interaction evidence where a wild-type copy of the gene in question is inserted into a mutant cell to see if it restores the wild-type phenotype in the mutant background."^^ . "eco"^^ . "functional complementation"^^ . "ECO:0000012"^^ . "functional complementation evidence"^^ . _:genid89 . _:genid89 . _:genid89 . _:genid89 "In addition, complementation of the ompR mutation in strain AR6 with plasmid pBR3 resulted in an increase in beta-galactosidase activity (1303 +- 80 Miller units), indicating that the His-tagged OmpR protein, expressed from the gene introduced in trans, was able to positively regulate flhDC expression."^^ . _:genid89 "PMID:20830609"^^ . _:genid90 . _:genid90 . _:genid90 . _:genid90 "Trans-complementation of fimR on pDL276 (pHR6) in strain DeltafimR harboring pfim(445 b)-cat restored wild-type pfim expression (Figure S1). Taken together, pfim is negatively regulated by FimR."^^ . _:genid90 "PMID:23823757"^^ . _:genid91 . _:genid91 . _:genid91 . _:genid91 "A type of genetic interaction evidence where a wild-type copy of the gene in question is inserted into a mutant cell to see if it restores the wild-type phenotype in the mutant background."^^ . _:genid91 "PMID:27403640"^^ . . . "A type of functional complementation evidence resulting from the introduction of a transgene to prevent, or \"rescue\" an organism from a condition."^^ . "eco"^^ . "ECO:0000013"^^ . "transgenic rescue experiment evidence"^^ . _:genid92 . _:genid92 . _:genid92 . _:genid92 "A type of functional complementation evidence resulting from the introduction of a transgene to prevent, or \"rescue\" an organism from a condition."^^ . _:genid92 "url:http://www.mdpi.com/1420-3049/19/9/13932/pdf"^^ . _:genid92 "url:http://www.nature.com/gt/journal/v11/n15/full/3302282a.html"^^ . . . "Indeed, the GroEL protein appears to be more abundant in the LM3 wild type strain compared to the LM3-2 mutant strain, suggesting the involvement of the CcpA protein in the positive regulation of its expression."^^ . "A type of experimental phenotypic evidence in which an observable phenotypic difference results from a change or mutation in DNA."^^ . "eco"^^ . "ECO:0000015"^^ . "Note that mutations need not be negative. Changes to DNA sequence (mutations) may be detrimental, have no impact, or be beneficial."^^ . "The allele that encodes the phenotype most common in a particular natural population is referred to as the wild type allele, while any other form of that allele is known as the mutant form."^^ . "mutant phenotype evidence"^^ . _:genid93 . _:genid93 . _:genid93 . _:genid93 "Indeed, the GroEL protein appears to be more abundant in the LM3 wild type strain compared to the LM3-2 mutant strain, suggesting the involvement of the CcpA protein in the positive regulation of its expression."^^ . _:genid93 "PMID:17129387"^^ . _:genid94 . _:genid94 . _:genid94 . _:genid94 "A type of experimental phenotypic evidence in which an observable phenotypic difference results from a change or mutation in DNA."^^ . _:genid94 "GO:IMP"^^ . . . "A type of mutant phenotype evidence where a phenotype is associated with altered gene product which lacks the molecular function of the wild-type gene."^^ . "eco"^^ . "ECO:0000016"^^ . "loss-of-function mutant phenotype evidence"^^ . _:genid95 . _:genid95 . _:genid95 . _:genid95 "A type of mutant phenotype evidence where a phenotype is associated with altered gene product which lacks the molecular function of the wild-type gene."^^ . _:genid95 "SO:0002054"^^ . . . _:genid96 . _:genid96 . _:genid97 . _:genid98 . _:genid100 _:genid99 . _:genid98 _:genid100 . _:genid99 . _:genid99 . _:genid99 . _:genid100 . _:genid97 _:genid98 . _:genid96 _:genid97 . _:genid96 . "A type of experimental phenotypic evidence where a transgenic strain carrying the construct of a promoter cDNA fusion in which a gene of interest is driven by a defined promoter or enhancer is ectopically expressed in the defined pattern to characterize potential cellular properties and functions of a protein of interest."^^ . "eco"^^ . "analysis of overexpression/ectopic expression phenotype"^^ . "ECO:0000017"^^ . "ectopic expression evidence"^^ . _:genid101 . _:genid101 . _:genid101 . _:genid101 "A type of experimental phenotypic evidence where a transgenic strain carrying the construct of a promoter cDNA fusion in which a gene of interest is driven by a defined promoter or enhancer is ectopically expressed in the defined pattern to characterize potential cellular properties and functions of a protein of interest."^^ . _:genid101 "PMID:10948520"^^ . _:genid101 "PMID:19301619"^^ . . . _:genid102 . _:genid102 . _:genid102 . _:genid102 . _:genid103 . _:genid103 . _:genid103 . _:genid103 . _:genid104 . _:genid104 . _:genid105 . _:genid106 . _:genid108 _:genid107 . _:genid106 _:genid108 . _:genid107 . _:genid107 . _:genid109 . _:genid109 . _:genid109 . _:genid107 _:genid109 . _:genid108 . _:genid105 _:genid106 . _:genid104 _:genid105 . _:genid104 . "A type of mutant phenotype evidence where a phenotype is observed while expressing an anti-sense version of a gene product in a wild-type (for that gene product) background."^^ . "eco"^^ . "anti-sense experiments"^^ . "ECO:0000018"^^ . "anti-sense experiment evidence"^^ . _:genid110 . _:genid110 . _:genid110 . _:genid110 "A type of mutant phenotype evidence where a phenotype is observed while expressing an anti-sense version of a gene product in a wild-type (for that gene product) background."^^ . _:genid110 "ECO:SN"^^ . . . _:genid111 . _:genid111 . _:genid111 . _:genid111 . _:genid112 . _:genid112 . _:genid112 . _:genid112 . _:genid113 . _:genid113 . _:genid114 . _:genid115 . _:genid117 _:genid116 . _:genid115 _:genid117 . _:genid116 . _:genid116 . _:genid118 . _:genid118 . _:genid118 . _:genid116 _:genid118 . _:genid117 . _:genid114 _:genid115 . _:genid113 _:genid114 . _:genid113 . "A type of mutant phenotype evidence where an RNA construct is introduced into a cell and the expression of the gene bearing its complementary sequence is suppressed."^^ . "eco"^^ . "RNAi experiment"^^ . "ECO:0000019"^^ . "RNAi evidence"^^ . _:genid119 . _:genid119 . _:genid119 . _:genid119 "A type of mutant phenotype evidence where an RNA construct is introduced into a cell and the expression of the gene bearing its complementary sequence is suppressed."^^ . _:genid119 "ECO:MCC"^^ . . . _:genid120 . _:genid120 . _:genid120 . _:genid120 . _:genid121 . _:genid121 . _:genid122 . _:genid123 . _:genid125 _:genid124 . _:genid123 _:genid125 . _:genid124 . _:genid124 . _:genid126 . _:genid126 . _:genid126 . _:genid124 _:genid126 . _:genid125 . _:genid122 _:genid123 . _:genid121 _:genid122 . _:genid121 . "A type of direct assay evidence based on the inhibition of the molecular function of a protein."^^ . "specific protein inhibition evidence"^^ . "eco"^^ . "ECO:0000020"^^ . "protein inhibition evidence"^^ . _:genid127 . _:genid127 . _:genid127 . _:genid127 "A type of direct assay evidence based on the inhibition of the molecular function of a protein."^^ . _:genid127 "ECO:MCC"^^ . . . _:genid128 . _:genid128 . _:genid128 . _:genid128 . _:genid129 . _:genid129 . _:genid129 . _:genid129 . _:genid130 . _:genid130 . _:genid131 . _:genid132 . _:genid134 _:genid133 . _:genid132 _:genid134 . _:genid133 . _:genid133 . _:genid135 . _:genid135 . _:genid135 . _:genid133 _:genid135 . _:genid134 . _:genid131 _:genid132 . _:genid130 _:genid131 . _:genid130 . "A type of experimental evidence that is based on characterization of an interaction between a gene product and another molecule."^^ . "ECO:0005025"^^ . "MI:0045"^^ . "eco"^^ . "ECO:0000021"^^ . "Molecules interacted with might include protein, nucleic acid, ion, or complex."^^ . "physical interaction evidence"^^ . _:genid136 . _:genid136 . _:genid136 . _:genid136 "A type of experimental evidence that is based on characterization of an interaction between a gene product and another molecule."^^ . _:genid136 "ECO:SN"^^ . _:genid137 . _:genid137 . _:genid137 . _:genid137 "MI:0045"^^ . _:genid137 "experimental interaction detection"^^ . . . _:genid138 . _:genid138 . _:genid139 . _:genid140 . _:genid142 _:genid141 . _:genid140 _:genid142 . _:genid141 . _:genid141 . _:genid141 . _:genid142 . _:genid139 _:genid140 . _:genid138 _:genid139 . _:genid138 . "A type of physical interaction evidence where a cellular component subunit is isolated as part of purification of its larger complex."^^ . "MI:0025"^^ . "eco"^^ . "co-purification"^^ . "ECO:0000022"^^ . "co-purification evidence"^^ . _:genid143 . _:genid143 . _:genid143 . _:genid143 "A type of physical interaction evidence where a cellular component subunit is isolated as part of purification of its larger complex."^^ . _:genid143 "TAIR:TED"^^ . _:genid144 . _:genid144 . _:genid144 . _:genid144 "MI:0025"^^ . _:genid144 "copurification"^^ . . . "A type of physical interaction evidence that depends on the strength of the interaction between two entities."^^ . "MI:0400"^^ . "ligand binding evidence"^^ . "eco"^^ . "ECO:0000023"^^ . "affinity evidence"^^ . _:genid145 . _:genid145 . _:genid145 . _:genid145 "A type of physical interaction evidence that depends on the strength of the interaction between two entities."^^ . _:genid145 "ECO:MCC"^^ . _:genid145 "PSI-MI:MI:0400"^^ . _:genid146 . _:genid146 . _:genid146 . _:genid146 "MI:0400"^^ . _:genid146 "affinity technology"^^ . . . "A type of affinity evidence resulting from the binding of a molecule to a protein or protein complex."^^ . "eco"^^ . "ECO:0000024"^^ . "protein binding evidence"^^ . _:genid147 . _:genid147 . _:genid147 . _:genid147 "A type of affinity evidence resulting from the binding of a molecule to a protein or protein complex."^^ . _:genid147 "GO:0005515"^^ . _:genid147 "url:https://en.wikipedia.org/wiki/Mutation"^^ . . . "A type of protein binding evidence where proteins of interest (bait and prey) are covalently linked to incomplete fragments of a third protein (reporter) and expressed in vivo, at which time interaction between bait and prey proteins brings reporter fragments in close enough proximity to allow them to reform and become a functional reporter protein."^^ . "DisProt:FedericaQuaglia"^^ . "MI:0090"^^ . "bait-prey protein pull-down evidence"^^ . "eco"^^ . "ECO:0000025"^^ . "Typically enzymes which confer resistance to antibiotics, such as Dihydrofolate reductase or Beta-lactamase, or proteins that give colorimetric or fluorescent signals are used. The Bait protein is generally the protein under study and the methods are readily adaptable to highthroughput mode."^^ . "bait-prey hybrid interaction evidence"^^ . _:genid148 . _:genid148 . _:genid148 . _:genid148 "A type of protein binding evidence where proteins of interest (bait and prey) are covalently linked to incomplete fragments of a third protein (reporter) and expressed in vivo, at which time interaction between bait and prey proteins brings reporter fragments in close enough proximity to allow them to reform and become a functional reporter protein."^^ . _:genid148 "ECO:MCC"^^ . _:genid148 "PSI-MI:MI:0090"^^ . _:genid149 . _:genid149 . _:genid149 . _:genid149 "MI:0090"^^ . _:genid149 "protein complementation assay"^^ . . "A type of experimental genomic evidence resulting from a process in which single stranded nucleic acids are allowed to interact so that complexes, or hybrids, are formed by molecules with sufficiently similar, complementary sequences."^^ . "eco"^^ . "ECO:0000026"^^ . "This term has been made obsolete with the clean up of experimental genomic evidence branch."^^ . "nucleic acid hybridization evidence"^^ . "true"^^ . _:genid150 . _:genid150 . _:genid150 . _:genid150 "A type of experimental genomic evidence resulting from a process in which single stranded nucleic acids are allowed to interact so that complexes, or hybrids, are formed by molecules with sufficiently similar, complementary sequences."^^ . _:genid150 "OBI:0302903"^^ . . . "The secondary structure of VapC10 (Figure S2), predicted with the 3DJIGSAW prediction tool [36] and the DALI server [37], exhibited homology with several well studied VapC toxins, such as the first PIN domain structure for the protein PAE2754 from the archae bacterium Pyrobaculum aerophilum (30)."^^ . "A type of similarity evidence based on structural similarity of an annotated gene or gene product to another gene or group of genes."^^ . "eco"^^ . "ECO:0000027"^^ . "For GO annotation, in the case of a single gene, an accession for the related gene's sequence is entered in the evidence_with field."^^ . "structural similarity evidence"^^ . _:genid151 . _:genid151 . _:genid151 . _:genid151 "The secondary structure of VapC10 (Figure S2), predicted with the 3DJIGSAW prediction tool [36] and the DALI server [37], exhibited homology with several well studied VapC toxins, such as the first PIN domain structure for the protein PAE2754 from the archae bacterium Pyrobaculum aerophilum (30)."^^ . _:genid151 "PMID:24260461"^^ . _:genid152 . _:genid152 . _:genid152 . _:genid152 "A type of similarity evidence based on structural similarity of an annotated gene or gene product to another gene or group of genes."^^ . _:genid152 "ECO:MCC"^^ . _:genid152 "TAIR:TED"^^ . . . "A CRP box-like sequence was found in the promoter-proximate region of sycO-ypkA-yopJ [4], indicating the direct association of CRP with the sycO-ypkA-yopJ promoter region."^^ . "To identify further CopR target genes, the binding motif TGAAGATTTnnTGAAGATTT was used to search for similar sequences in the whole C. glutamicum genome using the ERGO (TM) bioinformatics suite (Integrated Genomics, Illinois, USA) allowing four mutations, no deletions and no insertions. 46 hits were found, but only in six cases the putative CopR binding site was located in intergenic regions up to 200 bp upstream of the start codon of the neighbouring gene (cg1336, cg2976, cg3187, cg3337, cg3357 and cg0414)."^^ . "A type of match to sequence model evidence that is based on the presence of a recognized domain or motif in a gene product's (usually protein) primary sequence."^^ . "eco"^^ . "recognized domains"^^ . "ECO:0000028"^^ . "motif similarity evidence"^^ . _:genid153 . _:genid153 . _:genid153 . _:genid153 "A CRP box-like sequence was found in the promoter-proximate region of sycO-ypkA-yopJ [4], indicating the direct association of CRP with the sycO-ypkA-yopJ promoter region."^^ . _:genid153 "PMID:19703315"^^ . _:genid154 . _:genid154 . _:genid154 . _:genid154 "To identify further CopR target genes, the binding motif TGAAGATTTnnTGAAGATTT was used to search for similar sequences in the whole C. glutamicum genome using the ERGO (TM) bioinformatics suite (Integrated Genomics, Illinois, USA) allowing four mutations, no deletions and no insertions. 46 hits were found, but only in six cases the putative CopR binding site was located in intergenic regions up to 200 bp upstream of the start codon of the neighbouring gene (cg1336, cg2976, cg3187, cg3337, cg3357 and cg0414)."^^ . _:genid154 "PMID:21799779"^^ . _:genid155 . _:genid155 . _:genid155 . _:genid155 "A type of match to sequence model evidence that is based on the presence of a recognized domain or motif in a gene product's (usually protein) primary sequence."^^ . _:genid155 "ECO:SN"^^ . . . "A type of match to sequence model evidence resulting from a positive match of a protein, or set of proteins to a predictive model (signature) in the InterPro database."^^ . "eco"^^ . "ECO:0000029"^^ . "match to InterPro member signature evidence"^^ . _:genid156 . _:genid156 . _:genid156 . _:genid156 "A type of match to sequence model evidence resulting from a positive match of a protein, or set of proteins to a predictive model (signature) in the InterPro database."^^ . _:genid156 "PMC:2686546"^^ . _:genid156 "url:http://www.ncbi.nlm.nih.gov/mesh?term=Nucleic+Acid+Hybridization"^^ . . _:genid157 . _:genid158 . _:genid160 _:genid159 . _:genid158 _:genid160 . _:genid159 . _:genid159 . _:genid159 . _:genid160 . _:genid157 _:genid158 . _:genid157 . . . "ISA"^^ . "A type of BLAST evidence that is used in a manual assertion."^^ . "eco"^^ . "curated BLAST analysis"^^ . "ECO:0000030"^^ . "BLAST evidence used in manual assertion"^^ . _:genid161 . _:genid161 . _:genid161 . _:genid161 . _:genid161 "true"^^ . _:genid162 . _:genid162 . _:genid162 . _:genid162 "A type of BLAST evidence that is used in a manual assertion."^^ . _:genid162 "ECO:MCC"^^ . . _:genid163 . _:genid164 . _:genid166 _:genid165 . _:genid164 _:genid166 . _:genid165 . _:genid165 . _:genid165 . _:genid166 . _:genid163 _:genid164 . _:genid163 . . . "ISA"^^ . "A type of protein BLAST evidence that is used in a manual assertion."^^ . "GO_REF:0000012"^^ . "GO_REF:0000027"^^ . "eco"^^ . "curated protein BLAST analysis"^^ . "ECO:0000031"^^ . "protein BLAST evidence used in manual assertion"^^ . _:genid167 . _:genid167 . _:genid167 . _:genid167 . _:genid167 "true"^^ . _:genid168 . _:genid168 . _:genid168 . _:genid168 "A type of protein BLAST evidence that is used in a manual assertion."^^ . _:genid168 "ECO:SN"^^ . _:genid169 . _:genid169 . _:genid169 . _:genid169 "GO_REF:0000012"^^ . _:genid169 "Pairwise alignment (TIGR)"^^ . _:genid170 . _:genid170 . _:genid170 . _:genid170 "GO_REF:0000027"^^ . _:genid170 "BLAST search criteria for ISS assignment in PAMGO_GAT"^^ . . _:genid171 . _:genid172 . _:genid174 _:genid173 . _:genid172 _:genid174 . _:genid173 . _:genid173 . _:genid173 . _:genid174 . _:genid171 _:genid172 . _:genid171 . . . "ISA"^^ . "A type of nucleotide BLAST evidence that is used in a manual assertion."^^ . "eco"^^ . "curated nucleic acid BLAST analysis"^^ . "ECO:0000032"^^ . "nucleotide BLAST evidence used in manual assertion"^^ . _:genid175 . _:genid175 . _:genid175 . _:genid175 . _:genid175 "true"^^ . _:genid176 . _:genid176 . _:genid176 . _:genid176 "A type of nucleotide BLAST evidence that is used in a manual assertion."^^ . _:genid176 "ECO:SN"^^ . . . . "A type of author statement in which the author makes a statement that is not supported by information in that particular publication, but rather can be traced to a reference cited by that publication."^^ . "eco"^^ . "traceable author statement"^^ . "ECO:0000033"^^ . "author statement supported by traceable reference"^^ . _:genid177 . _:genid177 . _:genid177 . _:genid177 "A type of author statement in which the author makes a statement that is not supported by information in that particular publication, but rather can be traced to a reference cited by that publication."^^ . _:genid177 "ECO:RCT"^^ . _:genid177 "GO:TAS"^^ . . . "A type of author statement that is not associated with results presented or a cited reference."^^ . "eco"^^ . "non-traceable author statement"^^ . "ECO:0000034"^^ . "author statement without traceable support"^^ . _:genid178 . _:genid178 . _:genid178 . _:genid178 "A type of author statement that is not associated with results presented or a cited reference."^^ . _:genid178 "ECO:SN"^^ . . . "A type of curator inference that results when research finds no evidence information in the scientific literature, at reference databases, or from other resources."^^ . "eco"^^ . "ECO:0000035"^^ . "An assertion of \"no evidence data found\" carries the assumption that a more-or-less exhaustive search has been conducted."^^ . "no evidence data found"^^ . _:genid179 . _:genid179 . _:genid179 . _:genid179 "A type of curator inference that results when research finds no evidence information in the scientific literature, at reference databases, or from other resources."^^ . _:genid179 "ECO:SN"^^ . . "eco"^^ . "ECO:0000037"^^ . "The evidence not_recorded appears in some legacy annotations; it should not be used for new annotations."^^ . "not_recorded"^^ . "true"^^ . . . "A type of functional complementation evidence resulting from the introduction of nucleic acids, which are not permanently incorporated into the genome, to temporarily prevent, or \"rescue\" an organism from a condition."^^ . "eco"^^ . "ECO:0000038"^^ . "transient rescue experiment evidence"^^ . . "A type of direct assay evidence resulting from determining the presence, abundance, structure, function, or activity of proteins."^^ . "ECO:0005022"^^ . "eco"^^ . "ECO:0000039"^^ . "protein assay evidence"^^ . "true"^^ . _:genid180 . _:genid180 . _:genid180 . _:genid180 "A type of direct assay evidence resulting from determining the presence, abundance, structure, function, or activity of proteins."^^ . _:genid180 "PMID:18429326"^^ . . . _:genid181 . _:genid181 . _:genid181 . _:genid181 . _:genid182 . _:genid182 . _:genid182 . _:genid182 . "A type of affinity evidence resulting from quantitation of the analyte which depends on the reaction of an antigen (analyte) and an antibody."^^ . "ECO:0005018"^^ . "eco"^^ . "ECO:0000040"^^ . "immunological assay evidence"^^ . _:genid183 . _:genid183 . _:genid183 . _:genid183 "A type of affinity evidence resulting from quantitation of the analyte which depends on the reaction of an antigen (analyte) and an antibody."^^ . _:genid183 "ERO:0001362"^^ . _:genid183 "url:http://www.ncbi.nlm.nih.gov/books/NBK21589/,http://cores.ucsf.edu/protein-assay.html"^^ . . . "A type of evidence resulting from comparing likeness of distinct biological entities."^^ . "IS"^^ . "eco"^^ . "inferred from similarity"^^ . "ECO:0000041"^^ . "similarity evidence"^^ . _:genid184 . _:genid184 . _:genid184 . _:genid184 "A type of evidence resulting from comparing likeness of distinct biological entities."^^ . _:genid184 "ECO:SN"^^ . . . "A type of mutant phenotype evidence resulting from an altered gene product which possesses a new molecular function or a new pattern of gene expression."^^ . "gain-of-function mutant phenotype evidence"^^ . "eco"^^ . "ECO:0000042"^^ . "gain-of-function mutant phenotypic evidence"^^ . _:genid185 . _:genid185 . _:genid185 . _:genid185 "A type of mutant phenotype evidence resulting from an altered gene product which possesses a new molecular function or a new pattern of gene expression."^^ . _:genid185 "SO:0002053"^^ . _:genid185 "url:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3614608/"^^ . . . . "A type of similarity based on biomolecular sequence."^^ . "eco"^^ . "ECO:0000044"^^ . "A sequence similarity analysis may involve a gene or a gene product, and it could be based on similarity to a single other gene or to a group of other genes."^^ . "sequence similarity evidence"^^ . _:genid186 . _:genid186 . _:genid186 . _:genid186 "A type of similarity based on biomolecular sequence."^^ . _:genid186 "ECO:MCC"^^ . _:genid186 "TAIR:TED"^^ . . . "A type of protein expression evidence that accounts for the position of RNA translation to a protein product ranging in scale from differing tissues to regions of an anatomical structure."^^ . "eco"^^ . "ECO:0000045"^^ . "spatial pattern of protein expression evidence"^^ . . . "A type of transcript expression evidence that accounts for the position of transcription ranging in scale from the position of genes on the chromosome to differing tissues to regions of an anatomical structure."^^ . "eco"^^ . "ECO:0000047"^^ . "spatial pattern of transcript expression evidence"^^ . . . _:genid187 . _:genid187 . _:genid187 . _:genid187 . _:genid188 . _:genid188 . _:genid188 . _:genid188 . _:genid189 . _:genid189 . _:genid190 . _:genid191 . _:genid193 _:genid192 . _:genid191 _:genid193 . _:genid192 . _:genid192 . _:genid194 . _:genid194 . _:genid195 . _:genid196 . _:genid198 _:genid197 . _:genid196 _:genid198 . _:genid197 . _:genid197 . _:genid197 . _:genid198 . _:genid195 _:genid196 . _:genid194 _:genid195 . _:genid192 _:genid194 . _:genid193 . _:genid190 _:genid191 . _:genid189 _:genid190 . _:genid189 . "A type of expression pattern evidence that is based on the expression pattern of a reporter gene."^^ . "eco"^^ . "expression of a reporter gene"^^ . "ECO:0000049"^^ . "reporter gene assay evidence"^^ . _:genid199 . _:genid199 . _:genid199 . _:genid199 "A type of expression pattern evidence that is based on the expression pattern of a reporter gene."^^ . _:genid199 "TAIR:TED"^^ . . . _:genid200 . _:genid200 . _:genid201 . _:genid202 . _:genid204 _:genid203 . _:genid202 _:genid204 . _:genid203 . _:genid203 . _:genid205 . _:genid205 . _:genid205 . _:genid203 _:genid205 . _:genid204 . _:genid201 _:genid202 . _:genid200 _:genid201 . _:genid200 . "A type of experimental phenotypic evidence based on an authors phenotypic description of a species (or higher-level group), which explicitly references an observation made of a voucher specimen (a specimen with a permanent museum catalog)."^^ . "IVS"^^ . "voucher specimen analysis evidence"^^ . "eco"^^ . "ECO:0000050"^^ . "voucher specimen phenotypic analysis evidence"^^ . _:genid206 . _:genid206 . _:genid206 . _:genid206 "A type of experimental phenotypic evidence based on an authors phenotypic description of a species (or higher-level group), which explicitly references an observation made of a voucher specimen (a specimen with a permanent museum catalog)."^^ . _:genid206 "TAIR:TED"^^ . . . "A type of similarity based on genotype without respect to expression."^^ . "IGTS"^^ . "eco"^^ . "inferred from genetic similarity"^^ . "ECO:0000051"^^ . "A genetic similarity analysis might consider genetic markers, polymorphisms, alleles, or other characteristics sometimes considered as part of the field of traditional genetics. Although an attempt has been made to treat as distinct the concepts of \"genetic\", \"genotypic\", \"genomic\", and \"sequence\", there is considerable overlap in usage throughout the field of biology."^^ . "genetic similarity evidence"^^ . _:genid207 . _:genid207 . _:genid207 . _:genid207 "A type of similarity based on genotype without respect to expression."^^ . _:genid207 "ECO:MCC"^^ . _:genid207 "PhenoScape:IGTS"^^ . . . "A type of genetic interaction evidence resulting from a second mutation that either suppresses or enhances the phenotype expressed from an original mutation."^^ . "TAIR:TED"^^ . "suppressor/enhancer interaction evidence"^^ . "eco"^^ . "'traditional' genetic interactions (e.g. suppressors, synthetic lethals)"^^ . "ECO:0000052"^^ . "suppressor/enhancer interaction phenotypic evidence"^^ . _:genid208 . _:genid208 . _:genid208 . _:genid208 "A type of genetic interaction evidence resulting from a second mutation that either suppresses or enhances the phenotype expressed from an original mutation."^^ . _:genid208 "url:http://biorxiv.org/content/early/2015/10/03/021592"^^ . _:genid208 "url:http://www.wormbook.org/chapters/www:geneticsuppression/geneticsuppression.html"^^ . . _:genid209 . _:genid210 . _:genid212 _:genid211 . _:genid210 _:genid212 . _:genid211 . _:genid211 . _:genid211 . _:genid212 . _:genid209 _:genid210 . _:genid209 . . . "IEA"^^ . "A type of automatically integrated combinatorial evidence that is used in an automatic assertion."^^ . "ECO:0000246"^^ . "TAIR:TED"^^ . "eco"^^ . "ECO:0000053"^^ . "Combinatorial analyses could include experimental or computational results. Examples include: (i) large-scale experiment such as a genome-wide two-hybrid or genome-wide synthetic interactions; (ii) integration of large-scale data sets of various types; and (iii) text-based-computation, e.g. text-mining. For simple sequence comparisons, one should use the sequence similarity analysis evidence type. For microarray results alone, expression pattern analysis is appropriate; whereas, large-scale computational analysis should be used when microarray results are combined with the results of other types of large-scale experiments."^^ . "automatically integrated combinatorial evidence used in automatic assertion"^^ . _:genid213 . _:genid213 . _:genid213 . _:genid213 . _:genid213 "true"^^ . _:genid214 . _:genid214 . _:genid214 . _:genid214 . _:genid214 "true"^^ . _:genid215 . _:genid215 . _:genid215 . _:genid215 "A type of automatically integrated combinatorial evidence that is used in an automatic assertion."^^ . _:genid215 "ECO:MCC"^^ . _:genid215 "ECO:RCT"^^ . . . "In the hns slyA double mutant, hlyE expression was twofold greater than in the parent, and slightly higher than the hns single mutant, suggesting that slyA has a small negative effect on hlyE expressionin the absence of H-NS."^^ . "A type of mutant phenotype evidence resulting from an experiment typically constructed to determine if two different genes have an observable genetic interaction (functional connection) as the result of a mutation occurring in the alleles of the two genes of interest."^^ . "double mutant phenotype evidence"^^ . "eco"^^ . "double mutant analysis"^^ . "ECO:0000054"^^ . "double mutant phenotypic evidence"^^ . _:genid216 . _:genid216 . _:genid216 . _:genid216 "In the hns slyA double mutant, hlyE expression was twofold greater than in the parent, and slightly higher than the hns single mutant, suggesting that slyA has a small negative effect on hlyE expressionin the absence of H-NS."^^ . _:genid216 "PMID:17892462"^^ . _:genid217 . _:genid217 . _:genid217 . _:genid217 "A type of mutant phenotype evidence resulting from an experiment typically constructed to determine if two different genes have an observable genetic interaction (functional connection) as the result of a mutation occurring in the alleles of the two genes of interest."^^ . _:genid217 "ECO:RCT"^^ . _:genid217 "PMID:18305163"^^ . . "eco"^^ . "ECO:0000055"^^ . "This general 'array experiment' term should not be used - replace with the specific type of array (e.g. ECO:0000097, ECO:0000062, ECO:0000104, etc.)"^^ . "array experiment evidence"^^ . "true"^^ . . . "A type of genetic interaction evidence resulting from the suppression of one allelic effect by an allele at another genetic locus."^^ . "epistatic interaction evidence"^^ . "eco"^^ . "epistatic interactions"^^ . "ECO:0000056"^^ . "Epistasis' can be used in different contexts in different areas of genetics. It is sometimes used to mean 'genetic interaction', whereas other times it may be specific to mutations that block the effects of other mutations."^^ . "epistatic interaction phenotypic evidence"^^ . _:genid218 . _:genid218 . _:genid218 . _:genid218 "A type of genetic interaction evidence resulting from the suppression of one allelic effect by an allele at another genetic locus."^^ . _:genid218 "PMID:18852697"^^ . . . "A type of similarity based on the expression of a genotype in an environment."^^ . "IPTS"^^ . "phenotype similarity evidence"^^ . "eco"^^ . "inferred from phenotypic similarity"^^ . "ECO:0000057"^^ . "Phenotype is defined as the outcome of the expression of a genotype in a given environment. A comparison might involve whole organisms or sub-parts of organisms."^^ . "phenotypic similarity evidence"^^ . _:genid219 . _:genid219 . _:genid219 . _:genid219 "A type of similarity based on the expression of a genotype in an environment."^^ . _:genid219 "ECO:MCC"^^ . _:genid219 "PhenoScape:IPTS"^^ . . . _:genid220 . _:genid220 . _:genid220 . _:genid220 . _:genid221 . _:genid221 . _:genid222 . _:genid223 . _:genid225 _:genid224 . _:genid223 _:genid225 . _:genid224 . _:genid224 . _:genid226 . _:genid226 . _:genid226 . _:genid224 _:genid226 . _:genid225 . _:genid222 _:genid223 . _:genid221 _:genid222 . _:genid221 . "S. lividans AdpA directly regulates at least the six AdpA-dependent genes listed above and identified by microarrays and qRT-PCR analysis."^^ . "To identify the regulon of the response regulator CopR, the transcriptome of the DeltacopRS deletion mutant was compared to that of the wild type using DNA microarrays. For cells grown in standard CGXII medium (1.25 microM CuSO4), no significant gene expression differences were observed, indicating that the CopRS two-component system is not active under this condition (data not shown)."^^ . "A type of transcript expression evidence resulting from simultaneous profiling of the expression levels of thousands of genes in a single experiment allowing analysis of genes and their networks."^^ . "ECO:0000356"^^ . "differential gene expression evidence from microarray experiment"^^ . "eco"^^ . "ECO:0000058"^^ . "expression microarray evidence"^^ . _:genid227 . _:genid227 . _:genid227 . _:genid227 "S. lividans AdpA directly regulates at least the six AdpA-dependent genes listed above and identified by microarrays and qRT-PCR analysis."^^ . _:genid227 "PMID:24694298"^^ . _:genid228 . _:genid228 . _:genid228 . _:genid228 "To identify the regulon of the response regulator CopR, the transcriptome of the DeltacopRS deletion mutant was compared to that of the wild type using DNA microarrays. For cells grown in standard CGXII medium (1.25 microM CuSO4), no significant gene expression differences were observed, indicating that the CopRS two-component system is not active under this condition (data not shown)."^^ . _:genid228 "PMID:21799779"^^ . _:genid229 . _:genid229 . _:genid229 . _:genid229 "A type of transcript expression evidence resulting from simultaneous profiling of the expression levels of thousands of genes in a single experiment allowing analysis of genes and their networks."^^ . _:genid229 "url:http://www.illumina.com/techniques/microarrays/gene-expression-arrays.html"^^ . _:genid229 "url:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2435252/"^^ . . . _:genid230 . _:genid230 . _:genid230 . _:genid230 . _:genid231 . _:genid231 . _:genid231 . _:genid231 . _:genid232 . _:genid232 . _:genid233 . _:genid234 . _:genid236 _:genid235 . _:genid234 _:genid236 . _:genid235 . _:genid235 . _:genid237 . _:genid237 . _:genid237 . _:genid235 _:genid237 . _:genid236 . _:genid233 _:genid234 . _:genid232 _:genid233 . _:genid232 . "A type of experimental evidence that is based on an observable characteristic trait, which is the result of the expression of an organisms genotype in an environment."^^ . "ECO:0000014"^^ . "ECO:0005017"^^ . "eco"^^ . "inferred from phenotype"^^ . "ECO:0000059"^^ . "Observable characteristic traits can be morphology, development, behavior, biochemical or physiological properties, etc."^^ . "experimental phenotypic evidence"^^ . _:genid238 . _:genid238 . _:genid238 . _:genid238 "A type of experimental evidence that is based on an observable characteristic trait, which is the result of the expression of an organisms genotype in an environment."^^ . _:genid238 "ECO:SN"^^ . . . "A type of phenotypic similarity evidence based on the similarity of stucture locations or arrangements."^^ . "IPS"^^ . "eco"^^ . "ECO:0000060"^^ . "positional similarity evidence"^^ . _:genid239 . _:genid239 . _:genid239 . _:genid239 "A type of phenotypic similarity evidence based on the similarity of stucture locations or arrangements."^^ . _:genid239 "TAIR:TED"^^ . . . "A type of phenotypic evidence that is based on a gene product that is associated with a quantitative trait locus, but has not been cloned."^^ . "QTL analysis evidence"^^ . "eco"^^ . "quantitative trait analysis"^^ . "ECO:0000061"^^ . "quantitative trait analysis evidence"^^ . _:genid240 . _:genid240 . _:genid240 . _:genid240 "A type of phenotypic evidence that is based on a gene product that is associated with a quantitative trait locus, but has not been cloned."^^ . _:genid240 "TAIR:TED"^^ . . . _:genid241 . _:genid241 . _:genid242 . _:genid243 . _:genid245 _:genid244 . _:genid243 _:genid245 . _:genid244 . _:genid244 . _:genid244 . _:genid245 . _:genid242 _:genid243 . _:genid241 _:genid242 . _:genid241 . "A type of expression microarray evidence where expression level is quantified by sample biotin-labeled cRNA (transcribed from an unknown RNA sample) hybridized to DNA oligonuclotides immoblized on a solid surface."^^ . "genomic microarray evidence"^^ . "eco"^^ . "ECO:0000062"^^ . "cRNA to DNA expression microarray evidence"^^ . _:genid246 . _:genid246 . _:genid246 . _:genid246 "A type of expression microarray evidence where expression level is quantified by sample biotin-labeled cRNA (transcribed from an unknown RNA sample) hybridized to DNA oligonuclotides immoblized on a solid surface."^^ . _:genid246 "url:https://link.springer.com/chapter/10.1007/978-94-017-9716-0_30"^^ . . . "A type of phenotypic similarity evidence based on the similarity of the histological makeup of structures."^^ . "ICS"^^ . "eco"^^ . "ECO:0000063"^^ . "compositional similarity evidence"^^ . _:genid247 . _:genid247 . _:genid247 . _:genid247 "A type of phenotypic similarity evidence based on the similarity of the histological makeup of structures."^^ . _:genid247 "TAIR:TED"^^ . . . "A type of functional complementation evidence that is based on the insertion of a wild-type copy of a gene into a heterologous organism, with the mutation occurring in a homologous gene."^^ . "eco"^^ . "functional complementation in heterologous system"^^ . "ECO:0000064"^^ . "functional complementation in heterologous system evidence"^^ . _:genid248 . _:genid248 . _:genid248 . _:genid248 "A type of functional complementation evidence that is based on the insertion of a wild-type copy of a gene into a heterologous organism, with the mutation occurring in a homologous gene."^^ . _:genid248 "TAIR:TED"^^ . . . _:genid249 . _:genid249 . _:genid249 . _:genid249 . _:genid250 . _:genid250 . _:genid250 . _:genid250 . "A type of bait-prey hybrid interaction evidence that is based on a protein-DNA complementation assay where a single promoter acts as bait and is screened against a library of prey transcription factors."^^ . "MI:0432"^^ . "eco"^^ . "yeast one-hybrid assay"^^ . "ECO:0000066"^^ . "The assay involves screening a library of candidate proteins for the ability bind to a target, cis-regulatory element or any other short, DNA binding sequence placed 5' to a yeast reporter gene (TAIR:TED)."^^ . "yeast one-hybrid evidence"^^ . _:genid251 . _:genid251 . _:genid251 . _:genid251 "A type of bait-prey hybrid interaction evidence that is based on a protein-DNA complementation assay where a single promoter acts as bait and is screened against a library of prey transcription factors."^^ . _:genid251 "ECO:MCC"^^ . _:genid251 "PSI-MI:MI:0432"^^ . _:genid251 "TAIR:TED"^^ . _:genid252 . _:genid252 . _:genid252 . _:genid252 "MI:0432"^^ . _:genid252 "one hybrid"^^ . . . "A type of phenotypic similarity evidence based on the similarity of embryological or post-embryonic orgin of structures."^^ . "IDS"^^ . "eco"^^ . "ECO:0000067"^^ . "developmental similarity evidence"^^ . _:genid253 . _:genid253 . _:genid253 . _:genid253 "A type of phenotypic similarity evidence based on the similarity of embryological or post-embryonic orgin of structures."^^ . _:genid253 "TAIR:TED"^^ . . . _:genid254 . _:genid254 . _:genid254 . _:genid254 . _:genid255 . _:genid255 . _:genid255 . _:genid255 . "A type of bait-prey hybrid interaction evidence that is based on detection of protein-protein interaction by activation of a yeast reporter gene after a bait protein fused to a DNA-binding domain (which has been transfected into a yeast cell) is used to screen a cDNA library of clones fused to an activation domain."^^ . "eco"^^ . "yeast two-hybrid assay"^^ . "ECO:0000068"^^ . "yeast 2-hybrid evidence"^^ . _:genid256 . _:genid256 . _:genid256 . _:genid256 "A type of bait-prey hybrid interaction evidence that is based on detection of protein-protein interaction by activation of a yeast reporter gene after a bait protein fused to a DNA-binding domain (which has been transfected into a yeast cell) is used to screen a cDNA library of clones fused to an activation domain."^^ . _:genid256 "PMID:12734586"^^ . . . _:genid257 . _:genid257 . _:genid257 . _:genid257 . _:genid258 . _:genid258 . _:genid258 . _:genid258 . _:genid259 . _:genid259 . _:genid260 . _:genid261 . _:genid263 _:genid262 . _:genid261 _:genid263 . _:genid262 . _:genid262 . _:genid264 . _:genid264 . _:genid264 . _:genid262 _:genid264 . _:genid263 . _:genid260 _:genid261 . _:genid259 _:genid260 . _:genid259 . "A type of in vitro methylation assay evidence where methylation-sensitive restriction enzymes are utilized to compare differential methylation between two samples by first shearing DNA, followed by end-blunting, ligation of linkers, methylation sensitive restriction, PCR using linker primers, dye labeling and relative quantification of methylated DNA fragments by two-colored array hybridization to a CpG island microarray for visual assessment."^^ . "ECO:0000065"^^ . "CpG island microarray evidence"^^ . "eco"^^ . "ECO:0000069"^^ . "Color is indicative of methylation status - be it hypo- (pseudo-green), hyper- (pseudo-red), or equal methylation (pseudo-yellow)."^^ . "differential methylation hybridization evidence"^^ . _:genid265 . _:genid265 . _:genid265 . _:genid265 "A type of in vitro methylation assay evidence where methylation-sensitive restriction enzymes are utilized to compare differential methylation between two samples by first shearing DNA, followed by end-blunting, ligation of linkers, methylation sensitive restriction, PCR using linker primers, dye labeling and relative quantification of methylated DNA fragments by two-colored array hybridization to a CpG island microarray for visual assessment."^^ . _:genid265 "PMID:18987809"^^ . . . "A type of immunoprecipitation evidence that involves precipitating two or more proteins via binding to an antibody specific to a single protein, followed by protein identification."^^ . "MI:0019"^^ . "eco"^^ . "co-immunoprecipitation"^^ . "ECO:0000070"^^ . "If performing GO annotation, the interacting protein is referenced in the evidence_with column."^^ . "co-immunoprecipitation evidence"^^ . _:genid266 . _:genid266 . _:genid266 . _:genid266 "A type of immunoprecipitation evidence that involves precipitating two or more proteins via binding to an antibody specific to a single protein, followed by protein identification."^^ . _:genid266 "ECO:MCC"^^ . _:genid267 . _:genid267 . _:genid267 . _:genid267 "MI:0019"^^ . _:genid267 "coimmunoprecipitation"^^ . . . "A type of phenotypic similarity evidence based on the similarity of shape, structure, or configuration in structures."^^ . "IMS"^^ . "eco"^^ . "ECO:0000071"^^ . "morphological similarity evidence"^^ . _:genid268 . _:genid268 . _:genid268 . _:genid268 "A type of phenotypic similarity evidence based on the similarity of shape, structure, or configuration in structures."^^ . _:genid268 "TAIR:TED"^^ . . "eco"^^ . "ECO:0000072"^^ . "Sos-recruitment assay evidence"^^ . "true"^^ . . "A type of experimental evidence that is based on the characterization of an attribute of the genome underlying a gene product."^^ . "inferred from genomic analysis"^^ . "eco"^^ . "ECO:0000073"^^ . "This term has been made obsolete with the clean up of experimental genomic evidence branch."^^ . "experimental genomic evidence"^^ . "true"^^ . _:genid269 . _:genid269 . _:genid269 . _:genid269 "A type of experimental evidence that is based on the characterization of an attribute of the genome underlying a gene product."^^ . _:genid269 "ECO:MCC"^^ . . . _:genid270 . _:genid270 . _:genid270 . _:genid270 . _:genid271 . _:genid271 . _:genid271 . _:genid271 . "A type of protein fragment functional complementation evidence that is based on detection of protein-protein interaction between a bait and prey protein by in vivo reconstitution of split-ubiquitin (when bait and prey interact) and release of a reporter protein."^^ . "MI:0112"^^ . "eco"^^ . "split-ubiquitin assay"^^ . "ECO:0000074"^^ . "The bait protein is fused to the C-terminal ubiquitin (Cub) domain followed by a reporter protein, and the prey protein is fused to a mutated N terminal ubiquitin (NubG) domain. If bait and prey interact, their interaction brings the NubG and Cub domains close enough to reconstitute.TAIR:TED"^^ . "split-ubiquitin functional complementation evidence"^^ . _:genid272 . _:genid272 . _:genid272 . _:genid272 "A type of protein fragment functional complementation evidence that is based on detection of protein-protein interaction between a bait and prey protein by in vivo reconstitution of split-ubiquitin (when bait and prey interact) and release of a reporter protein."^^ . _:genid272 "PMID:15064465"^^ . _:genid273 . _:genid273 . _:genid273 . _:genid273 "MI:0112"^^ . _:genid273 "ubiquitin reconstruction"^^ . . . "A type of phenotypic similarity evidence that is based on the categorization of genes by the similarity of expression profiles."^^ . "IGES"^^ . "eco"^^ . "ECO:0000075"^^ . "gene expression similarity evidence"^^ . _:genid274 . _:genid274 . _:genid274 . _:genid274 "A type of phenotypic similarity evidence that is based on the categorization of genes by the similarity of expression profiles."^^ . _:genid274 "PMID:19958477"^^ . . . _:genid275 . _:genid275 . _:genid275 . _:genid275 . "A type of physical interaction evidence that is based on detection of protein-protein interactions by separation of target proteins by SDS-PAGE which are blotted to a membrane, followed by denaturation and renaturation, probing with purified bait proteins, and detection of the target-bait complexes."^^ . "MI:0047"^^ . "eco"^^ . "far-Western analysis"^^ . "ECO:0000076"^^ . "The interacting protein is referenced in the evidence_with column."^^ . "far-Western blotting evidence"^^ . _:genid276 . _:genid276 . _:genid276 . _:genid276 "A type of physical interaction evidence that is based on detection of protein-protein interactions by separation of target proteins by SDS-PAGE which are blotted to a membrane, followed by denaturation and renaturation, probing with purified bait proteins, and detection of the target-bait complexes."^^ . _:genid276 "PMID:18079728"^^ . . . _:genid277 . _:genid277 . _:genid277 . _:genid277 . _:genid278 . _:genid278 . _:genid278 . _:genid278 . _:genid279 . _:genid279 . _:genid280 . _:genid281 . _:genid283 _:genid282 . _:genid281 _:genid283 . _:genid282 . _:genid282 . _:genid284 . _:genid284 . _:genid285 . _:genid286 . _:genid288 _:genid287 . _:genid286 _:genid288 . _:genid287 . _:genid287 . _:genid287 . _:genid288 . _:genid285 _:genid286 . _:genid284 _:genid285 . _:genid282 _:genid284 . _:genid283 . _:genid280 _:genid281 . _:genid279 _:genid280 . _:genid279 . "A type of in vitro methylation assay evidence resulting from initial modification of DNA by sodium bisulfite, converting all unmethylated cytosines to uracil, and subsequent amplification with primers specific for methylated versus unmethylated DNA."^^ . "MS-PCR"^^ . "MSP"^^ . "methylation-specific PCR evidence"^^ . "eco"^^ . "ECO:0000077"^^ . "The product is the amplification of existing sequences - i.e. more DNA that can be further processed e.g. sequenced, DNA fingerprinting."^^ . "methylation-specific polymerase chain reaction evidence"^^ . _:genid289 . _:genid289 . _:genid289 . _:genid289 "A type of in vitro methylation assay evidence resulting from initial modification of DNA by sodium bisulfite, converting all unmethylated cytosines to uracil, and subsequent amplification with primers specific for methylated versus unmethylated DNA."^^ . _:genid289 "PMC:38513"^^ . _:genid289 "PMID:8790415"^^ . . . _:genid290 . _:genid290 . _:genid290 . _:genid290 . _:genid291 . _:genid291 . _:genid292 . _:genid293 . _:genid295 _:genid294 . _:genid293 _:genid295 . _:genid294 . _:genid294 . _:genid296 . _:genid296 . _:genid296 . _:genid294 _:genid296 . _:genid295 . _:genid292 _:genid293 . _:genid291 _:genid292 . _:genid291 . "A type of DNA detection assay evidence that is based on detection of a specific DNA sequence by hybridization of labeled probes to any immobilized DNA fragment with sequence similarity."^^ . "Southern blot"^^ . "eco"^^ . "Southern blotting"^^ . "ECO:0000078"^^ . "The DNA fragments are prepared through gel electrophoresis then transferred to a filter membrane."^^ . "southern hybridization evidence"^^ . _:genid297 . _:genid297 . _:genid297 . _:genid297 "A type of DNA detection assay evidence that is based on detection of a specific DNA sequence by hybridization of labeled probes to any immobilized DNA fragment with sequence similarity."^^ . _:genid297 "PMID:18432697"^^ . . . _:genid298 . _:genid298 . _:genid298 . _:genid298 . _:genid299 . _:genid299 . _:genid300 . _:genid301 . _:genid303 _:genid302 . _:genid301 _:genid303 . _:genid302 . _:genid302 . _:genid304 . _:genid305 . _:genid307 _:genid306 . _:genid305 _:genid307 . _:genid306 . _:genid306 . _:genid306 . _:genid307 . _:genid304 _:genid305 . _:genid302 _:genid304 . _:genid303 . _:genid300 _:genid301 . _:genid299 _:genid300 . _:genid299 . "A type of affinity evidence that results from separation of biochemical mixtures by selective binding of a compound to an immobilized compound on a polymeric matrix, subsequent removal of unattached components, and then displacement of the bound compound."^^ . "MI:0004"^^ . "eco"^^ . "affinity chromatography"^^ . "ECO:0000079"^^ . "\"Used when an annotation is made based on affinity chromatography, which is a selective separation technique by which a compound (e.g., an antibody) is immobilized on a polymeric matrix and used to bind selectively other compounds. Following removal of the unattached components, the bound compound is displaced by changing the concentration of protons, salts, or cofactors in the eluent\" (from original definition by TAIR:TED). Types of highly specific interaction might include those of antigen and antibody, enzyme and substrate, or receptor and ligand."^^ . "affinity chromatography evidence"^^ . _:genid308 . _:genid308 . _:genid308 . _:genid308 "A type of affinity evidence that results from separation of biochemical mixtures by selective binding of a compound to an immobilized compound on a polymeric matrix, subsequent removal of unattached components, and then displacement of the bound compound."^^ . _:genid308 "ECO:MCC"^^ . _:genid308 "TAIR:TED"^^ . _:genid309 . _:genid309 . _:genid309 . _:genid309 "MI:0004"^^ . _:genid309 "affinity chromatography technology"^^ . . . "Comparative phylogenomics along with MLST (multilocus sequence typing) and whole genome sequecing has shown that ribotype 078 lineage is different than other C. difficile lineages [22]."^^ . "A type of similarity that indicates common ancestry."^^ . "IP"^^ . "eco"^^ . "ECO:0000080"^^ . "phylogenetic evidence"^^ . _:genid310 . _:genid310 . _:genid310 . _:genid310 "Comparative phylogenomics along with MLST (multilocus sequence typing) and whole genome sequecing has shown that ribotype 078 lineage is different than other C. difficile lineages [22]."^^ . _:genid310 "PMID:24713082"^^ . _:genid311 . _:genid311 . _:genid311 . _:genid311 "A type of similarity that indicates common ancestry."^^ . _:genid311 "ECO:MCC"^^ . _:genid311 "PhenoScape:IP"^^ . _:genid312 . _:genid312 . _:genid312 . _:genid312 "IP"^^ . _:genid312 "PhenoScape:IP"^^ . . . "A type of motif similarity evidence that is based on detection of a targeting sequence in the primary sequence of a protein through computational prediction and/or a manual examination of the sequence."^^ . "eco"^^ . "targeting sequence prediction"^^ . "ECO:0000081"^^ . "targeting sequence prediction evidence"^^ . _:genid313 . _:genid313 . _:genid313 . _:genid313 "A type of motif similarity evidence that is based on detection of a targeting sequence in the primary sequence of a protein through computational prediction and/or a manual examination of the sequence."^^ . _:genid313 "ECO:RCT"^^ . _:genid313 "TAIR:TED"^^ . . "A type of experimental genomic evidence where DNA polymerase is used to synthesize new strand of DNA complementary to the offered template strand."^^ . "PCR evidence"^^ . "eco"^^ . "ECO:0000082"^^ . "This term has been made obsolete because PCR is not evidence. The children have been appropriately placed under other parents."^^ . "polymerase chain reaction evidence"^^ . "true"^^ . _:genid314 . _:genid314 . _:genid314 . _:genid314 "A type of experimental genomic evidence where DNA polymerase is used to synthesize new strand of DNA complementary to the offered template strand."^^ . _:genid314 "OBI:0000415"^^ . . . "A type of motif similarity evidence that is based on detection of one, or more, transmembrane domains in the primary sequence of a protein through computational prediction and/or a manual examination of the sequence."^^ . "eco"^^ . "transmembrane domain prediction"^^ . "ECO:0000083"^^ . "transmembrane domain prediction evidence"^^ . _:genid315 . _:genid315 . _:genid315 . _:genid315 "A type of motif similarity evidence that is based on detection of one, or more, transmembrane domains in the primary sequence of a protein through computational prediction and/or a manual examination of the sequence."^^ . _:genid315 "ECO:RCT"^^ . _:genid315 "TAIR:TED"^^ . . . "A type of genomic context evidence in which a gene product's identity is supported on the basis of the identity of neighboring genes."^^ . "mgiglio"^^ . "2009-03-20T11:55:18Z"^^ . "GO_REF:0000025"^^ . "inferred from genome cluster"^^ . "eco"^^ . "ICL"^^ . "ECO:0000084"^^ . "Genomic cluster analyses include synteny and operon structure."^^ . "gene neighbors evidence"^^ . _:genid316 . _:genid316 . _:genid316 . _:genid316 "A type of genomic context evidence in which a gene product's identity is supported on the basis of the identity of neighboring genes."^^ . _:genid316 "ECO:MCC"^^ . _:genid316 "GOC:MG"^^ . _:genid317 . _:genid317 . _:genid317 . _:genid317 "GO_REF:0000025"^^ . _:genid317 "Operon structure as IGC evidence"^^ . . . _:genid318 . _:genid318 . _:genid318 . _:genid318 . _:genid319 . _:genid319 . _:genid319 . _:genid319 . _:genid320 . _:genid320 . _:genid321 . _:genid322 . _:genid324 _:genid323 . _:genid322 _:genid324 . _:genid323 . _:genid323 . _:genid323 . _:genid324 . _:genid321 _:genid322 . _:genid320 _:genid321 . _:genid320 . "A type of protein binding evidence that involves precipitation of a multivalent antigen by a bivalent antibody for protein isolation."^^ . "CollecTF"^^ . "eco"^^ . "immunoprecipitation"^^ . "ECO:0000085"^^ . "Transcription factors isolated in this way can be incubated with a radiolabeled probe to demonstrate binding."^^ . "immunoprecipitation evidence"^^ . _:genid325 . _:genid325 . _:genid325 . _:genid325 "A type of protein binding evidence that involves precipitation of a multivalent antigen by a bivalent antibody for protein isolation."^^ . _:genid325 "ECO:MCC"^^ . _:genid325 "ECO:SW"^^ . _:genid325 "TAIR:TED"^^ . . . _:genid326 . _:genid326 . _:genid326 . _:genid326 . _:genid327 . _:genid327 . _:genid327 . _:genid327 . _:genid328 . _:genid328 . _:genid329 . _:genid330 . _:genid332 _:genid331 . _:genid330 _:genid332 . _:genid331 . _:genid331 . _:genid333 . _:genid333 . _:genid334 . _:genid335 . _:genid337 _:genid336 . _:genid335 _:genid337 . _:genid336 . _:genid336 . _:genid336 . _:genid337 . _:genid334 _:genid335 . _:genid333 _:genid334 . _:genid331 _:genid333 . _:genid332 . _:genid329 _:genid330 . _:genid328 _:genid329 . _:genid328 . "A type of in vitro methylation assay evidence resulting from a genome-wide estimate of DNA methylation by differential enzymatic digestion of genomic DNA with methylation-sensitive and methylation-insensitive isoschizomers, followed by restrained PCR amplification of sequences methylated at both ends and resolving the PCR products in a denaturing polyacrylamide-sequencing gel to generate fingerprints that consist of multiple anonymous bands that represent the DNA methylome of the cell."^^ . "AIMS"^^ . "eco"^^ . "ECO:0000086"^^ . "The bands can be individually isolated and characterized which leads to the identification of hypo- and hypermethylation events."^^ . "amplification of intermethylated sites evidence"^^ . _:genid338 . _:genid338 . _:genid338 . _:genid338 "A type of in vitro methylation assay evidence resulting from a genome-wide estimate of DNA methylation by differential enzymatic digestion of genomic DNA with methylation-sensitive and methylation-insensitive isoschizomers, followed by restrained PCR amplification of sequences methylated at both ends and resolving the PCR products in a denaturing polyacrylamide-sequencing gel to generate fingerprints that consist of multiple anonymous bands that represent the DNA methylome of the cell."^^ . _:genid338 "PMID:18987810"^^ . _:genid338 "url:https://www.ncbi.nlm.nih.gov/probe/docs/techpcr/"^^ . . . . _:genid339 . _:genid339 . _:genid339 . _:genid339 . _:genid340 . _:genid340 . _:genid341 . _:genid342 . _:genid344 _:genid343 . _:genid342 _:genid344 . _:genid343 . _:genid343 . _:genid345 . _:genid345 . _:genid346 . _:genid347 . _:genid349 _:genid348 . _:genid347 _:genid349 . _:genid348 . _:genid348 . _:genid348 . _:genid349 . _:genid346 _:genid347 . _:genid345 _:genid346 . _:genid343 _:genid345 . _:genid344 . _:genid341 _:genid342 . _:genid340 _:genid341 . _:genid340 . _:genid350 . _:genid350 . _:genid351 . _:genid352 . _:genid353 . _:genid352 _:genid353 . _:genid353 . _:genid351 _:genid352 . _:genid350 _:genid351 . _:genid350 . "A type of microscopy evidence where antibodies are used to detect the location of molecules or other structures within cells or tissues."^^ . "eco"^^ . "immunolocalization"^^ . "ECO:0000087"^^ . "immunolocalization evidence"^^ . _:genid354 . _:genid354 . _:genid354 . _:genid354 "A type of microscopy evidence where antibodies are used to detect the location of molecules or other structures within cells or tissues."^^ . _:genid354 "ECO:MCC"^^ . _:genid354 "ECO:SN"^^ . . . "A type of evidence that is based on a combination of experimental evidences or existing models of that system in a related species used for the reconstruction of a biological system."^^ . "mgiglio"^^ . "2009-03-20T12:00:17Z"^^ . "eco"^^ . "ISR"^^ . "inferred from system reconstruction"^^ . "ECO:0000088"^^ . "The biological system in question might be a multi-step process or pathway or a physical complex comprising several components. The components in the experimental evidence can come from the same species or a mix of species. The experimental evidences may be only partial or weak."^^ . "biological system reconstruction evidence"^^ . _:genid355 . _:genid355 . _:genid355 . _:genid355 "A type of evidence that is based on a combination of experimental evidences or existing models of that system in a related species used for the reconstruction of a biological system."^^ . _:genid355 "ECO:MCC"^^ . _:genid355 "GOC:mg"^^ . . . "A type of DNA detection assay evidence resulting from the use of restriction enzymes for direct end-labeling of DNA (creating landmarks), followed by high-resolution two-dimensional electrophoresis to visualize the landmarks."^^ . "SIB:PG"^^ . "ECO:0001125"^^ . "RLGS evidence"^^ . "restriction landmark genome scanning evidence"^^ . "eco"^^ . "ECO:0000089"^^ . "restriction landmark genomic scanning evidence"^^ . _:genid356 . _:genid356 . _:genid356 . _:genid356 "A type of DNA detection assay evidence resulting from the use of restriction enzymes for direct end-labeling of DNA (creating landmarks), followed by high-resolution two-dimensional electrophoresis to visualize the landmarks."^^ . _:genid356 "PMID:8388788"^^ . . . "A type of immunolocalization evidence where the antibodies are labeled with colloidal gold particles whose location is then detected via microscopy."^^ . "eco"^^ . "immunogold labelling"^^ . "ECO:0000090"^^ . "immunogold labelling evidence"^^ . _:genid357 . _:genid357 . _:genid357 . _:genid357 "A type of immunolocalization evidence where the antibodies are labeled with colloidal gold particles whose location is then detected via microscopy."^^ . _:genid357 "ECO:MCC"^^ . . . "A type of immunolocalization evidence in which recombinant proteins fused with epitopes are recognized by antibodies."^^ . "eco"^^ . "immunolocalization of epitope-tagged protein"^^ . "ECO:0000092"^^ . "epitope-tagged protein immunolocalization evidence"^^ . _:genid358 . _:genid358 . _:genid358 . _:genid358 "A type of immunolocalization evidence in which recombinant proteins fused with epitopes are recognized by antibodies."^^ . _:genid358 "TAIR:TED"^^ . . . _:genid359 . _:genid359 . _:genid360 . _:genid361 . _:genid363 _:genid362 . _:genid361 _:genid363 . _:genid362 . _:genid362 . _:genid362 . _:genid363 . _:genid360 _:genid361 . _:genid359 _:genid360 . _:genid359 . "A type of DNA detection assay evidence evidence where gene sequence or variation is determined or detected by fluorescently-labeled DNA fragments hybridized to sequence-specific oligonucleotides immobilized on an array."^^ . "DNA microarray"^^ . "oligonucleotide microarray evidence"^^ . "SNP array evidence"^^ . "single nucleotide polymorphism array evidence"^^ . "eco"^^ . "ECO:0000093"^^ . "array-based sequence capture evidence"^^ . _:genid364 . _:genid364 . _:genid364 . _:genid364 "A type of DNA detection assay evidence evidence where gene sequence or variation is determined or detected by fluorescently-labeled DNA fragments hybridized to sequence-specific oligonucleotides immobilized on an array."^^ . _:genid364 "PMID:21049075"^^ . . "eco"^^ . "ECO:0000094"^^ . "The children of 'biological assay evidence' have been moved under 'direct assay evidence', and this term has been deprecated with no children left."^^ . "biological assay evidence"^^ . "true"^^ . . . _:genid365 . _:genid365 . _:genid365 . _:genid365 . "A type of cell growth assay evidence that measures one or more aspects of cell growth over a specified time period to indicate an induced or repressed regulatory effect."^^ . "mchibucos"^^ . "2014-10-15T00:58:50Z"^^ . "eco"^^ . "growth curve analysis"^^ . "ECO:0000095"^^ . "Cell growth aspects can include growth rate and extent of growth. A cell growth curve acts as a natural reporter."^^ . "cell growth regulation assay evidence"^^ . _:genid366 . _:genid366 . _:genid366 . _:genid366 "A type of cell growth assay evidence that measures one or more aspects of cell growth over a specified time period to indicate an induced or repressed regulatory effect."^^ . _:genid366 "ECO:SW"^^ . _:genid366 "PomBase:MAH"^^ . . . _:genid367 . _:genid367 . _:genid367 . _:genid367 . "Each of the promoter-proximal regions of qrr2 - 4 was subjected to EMSA with the purified His-OpaR protein (Fig. 6b). The results showed that His-OpaR was able to bind to each of the three DNA fragments tested in a dose-dependent manner in vitro."^^ . "A type of affinity evidence based on an electrophoretic mobility shift of macromolecules, where proteins, nucleic acids, or both, are combined and the resulting mixtures are electrophoresed under native conditions through polyacrylamide or agarose gel to detect interactions/complexes between proteins and/or nucleic acid."^^ . "CollecTF"^^ . "MI:0413"^^ . "EMSA: electrophoretic mobility shift assay"^^ . "eco"^^ . "Gel retardation assay"^^ . "electrophoretic mobility shift assay"^^ . "ECO:0000096"^^ . "EMSA is often used for assessing TF-binding with fluorophore labelling. Protein-nucleic acid complexes generally migrate at a slower rate than the corresponding non-bonded nucleic acid."^^ . "electrophoretic mobility shift assay evidence"^^ . _:genid368 . _:genid368 . _:genid368 . _:genid368 "Each of the promoter-proximal regions of qrr2 - 4 was subjected to EMSA with the purified His-OpaR protein (Fig. 6b). The results showed that His-OpaR was able to bind to each of the three DNA fragments tested in a dose-dependent manner in vitro."^^ . _:genid368 "PMID:22506036"^^ . _:genid369 . _:genid369 . _:genid369 . _:genid369 "A type of affinity evidence based on an electrophoretic mobility shift of macromolecules, where proteins, nucleic acids, or both, are combined and the resulting mixtures are electrophoresed under native conditions through polyacrylamide or agarose gel to detect interactions/complexes between proteins and/or nucleic acid."^^ . _:genid369 "ECO:KIM"^^ . _:genid369 "ECO:SW"^^ . _:genid369 "PMID:17703195"^^ . _:genid369 "TAIR:TED"^^ . _:genid370 . _:genid370 . _:genid370 . _:genid370 "MI:0413"^^ . _:genid370 "electrophoretic mobility shift assay"^^ . _:genid371 . _:genid371 . _:genid371 . _:genid371 "Gel retardation assay"^^ . _:genid371 "PMID:17703195"^^ . . . _:genid372 . _:genid372 . _:genid373 . _:genid374 . _:genid376 _:genid375 . _:genid374 _:genid376 . _:genid375 . _:genid375 . _:genid375 . _:genid376 . _:genid373 _:genid374 . _:genid372 _:genid373 . _:genid372 . "A type of expression microarray evidence where expression level is quantified by fluroescently-labeled cDNA (reverse transcribed from an unknown RNA sample) hybridized to DNA immobilized on a solid surface."^^ . "CollecTF"^^ . "ECO:0001041"^^ . "ECO:0005524"^^ . "eco"^^ . "DNA microarray"^^ . "RNA microarray"^^ . "ECO:0000097"^^ . "cDNA to DNA expression microarray evidence"^^ . _:genid377 . _:genid377 . _:genid377 . _:genid377 "A type of expression microarray evidence where expression level is quantified by fluroescently-labeled cDNA (reverse transcribed from an unknown RNA sample) hybridized to DNA immobilized on a solid surface."^^ . _:genid377 "ECO:RCT"^^ . . "A type of nucleic acid hybridization evidence based on localization of a specific segment of DNA or RNA by the application of a complementary strand of nucleic acid to which a reporter molecule is attached."^^ . "eco"^^ . "in situ hybridization"^^ . "ECO:0000098"^^ . "This term has been made obsolete with the clean up of experimental genomic evidence branch."^^ . "obsolete in situ hybridization evidence"^^ . "true"^^ . _:genid378 . _:genid378 . _:genid378 . _:genid378 "A type of nucleic acid hybridization evidence based on localization of a specific segment of DNA or RNA by the application of a complementary strand of nucleic acid to which a reporter molecule is attached."^^ . _:genid378 "url:https://www.ncbi.nlm.nih.gov/probe/docs/techish/"^^ . . . "A type of direct assay evidence resulting from the separation of various cell components while preserving their individual functions."^^ . "eco"^^ . "ECO:0000100"^^ . "fractionation evidence"^^ . _:genid379 . _:genid379 . _:genid379 . _:genid379 "A type of direct assay evidence resulting from the separation of various cell components while preserving their individual functions."^^ . _:genid379 "NBK:26936"^^ . _:genid379 "url:https://www.ncbi.nlm.nih.gov/books/NBK26936/"^^ . . . "A type of cRNA to DNA expression microarray evidence resulting from the use of a proprietary Affymetrix GeneChip System for analyzing complex genetic information."^^ . "Affymetrix array experiment evidence"^^ . "eco"^^ . "ECO:0000101"^^ . "Affymetrix GeneChip evidence"^^ . _:genid380 . _:genid380 . _:genid380 . _:genid380 "A type of cRNA to DNA expression microarray evidence resulting from the use of a proprietary Affymetrix GeneChip System for analyzing complex genetic information."^^ . _:genid380 "ERO:0001265"^^ . . . "A type of fractionation evidence resulting from a protein fractionated with other compounds, factors, or macromolecules."^^ . "eco"^^ . "co-fractionation"^^ . "ECO:0000102"^^ . "co-fractionation evidence"^^ . _:genid381 . _:genid381 . _:genid381 . _:genid381 "A type of fractionation evidence resulting from a protein fractionated with other compounds, factors, or macromolecules."^^ . _:genid381 "TAIR:TED"^^ . . . _:genid382 . _:genid382 . _:genid383 . _:genid384 . _:genid386 _:genid385 . _:genid384 _:genid386 . _:genid385 . _:genid385 . _:genid385 . _:genid386 . _:genid383 _:genid384 . _:genid382 _:genid383 . _:genid382 . "A type of expression microarray evidence where expression levels are quantified by hybridization of fluorescently-labeled DNA to cDNA (reverse transcribed from an unknown RNA sample) immobilized on a solid surface."^^ . "REM evidence"^^ . "RNA expression microarray evidence"^^ . "microarray RNA expression level evidence"^^ . "eco"^^ . "transcript levels (e.g. microarray data)"^^ . "ECO:0000104"^^ . "REM is a 'reverse-format' microarray, where the unknown sample is immoblized to a surface and known DNA is hybridized to that."^^ . "DNA to cDNA expression microarray evidence"^^ . _:genid387 . _:genid387 . _:genid387 . _:genid387 "A type of expression microarray evidence where expression levels are quantified by hybridization of fluorescently-labeled DNA to cDNA (reverse transcribed from an unknown RNA sample) immobilized on a solid surface."^^ . _:genid387 "ECO:RCT"^^ . _:genid387 "PMID:15329382"^^ . _:genid388 . _:genid388 . _:genid388 . _:genid388 "REM is a 'reverse-format' microarray, where the unknown sample is immoblized to a surface and known DNA is hybridized to that."^^ . _:genid388 "PMID:15329382"^^ . . . "A type of cDNA to DNA expression microarray evidence resulting from the use of a proprietary NimbleGen array to measure expression levels."^^ . "eco"^^ . "ECO:0000105"^^ . "Nimblegen array evidence"^^ . _:genid389 . _:genid389 . _:genid389 . _:genid389 "A type of cDNA to DNA expression microarray evidence resulting from the use of a proprietary NimbleGen array to measure expression levels."^^ . _:genid389 "PMID:15607417"^^ . _:genid389 "url:https://roche-biochem.jp/pdf/products/microarray/user_guide/SeqCap/SeqCap_UserGuide_Delivery_ver3.0.pdf"^^ . . . _:genid390 . _:genid390 . _:genid390 . _:genid390 . "Northern blot analysis indicated that there was one major band of 1.5-kb (which was used for the stability determination) and two other minor bands of approximately 3.0- and 6.0-kb, which constituted less than 5% of the total signal (Fig. 1C), suggesting that other genes may be cotranscribed along with SMU.1882."^^ . "A type of transcript expression evidence based on electrophoresis and probing to determine levels of RNA expression using a complementary hybridization probe on the separated RNA samples."^^ . "CollecTF"^^ . "RNA blot evidence"^^ . "northern assay evidence"^^ . "eco"^^ . "transcript levels (e.g. Northerns)"^^ . "ECO:0000106"^^ . "northern blot evidence"^^ . _:genid391 . _:genid391 . _:genid391 . _:genid391 "Northern blot analysis indicated that there was one major band of 1.5-kb (which was used for the stability determination) and two other minor bands of approximately 3.0- and 6.0-kb, which constituted less than 5% of the total signal (Fig. 1C), suggesting that other genes may be cotranscribed along with SMU.1882."^^ . _:genid391 "PMID:21124877"^^ . _:genid392 . _:genid392 . _:genid392 . _:genid392 "A type of transcript expression evidence based on electrophoresis and probing to determine levels of RNA expression using a complementary hybridization probe on the separated RNA samples."^^ . _:genid392 "ECO:SW"^^ . _:genid392 "TAIR:TED"^^ . . . _:genid393 . _:genid393 . _:genid393 . _:genid393 . _:genid394 . _:genid394 . _:genid395 . _:genid396 . _:genid398 _:genid397 . _:genid396 _:genid398 . _:genid397 . _:genid397 . _:genid399 . _:genid399 . _:genid399 . _:genid397 _:genid399 . _:genid398 . _:genid395 _:genid396 . _:genid394 _:genid395 . _:genid394 . "Taken together, the results of the RT-PCR analyses and the reporter fusion assays indicate that expression of SMU.1882 is up regulated in the presence of CovR."^^ . "The RT-PCR assay indicated that the sycO, ypkA and yopJ genes (designated as pCD12, pCD13 and pCD14 in Y. pestis 91001 [19], respectively) were transcribed as a single primary RNA (Fig. 1), and thereby these three genes constituted a single operon in Y. pestis Microtus strain 201."^^ . "Using reverse transcription-PCR, we found that primers designed to span the intergenic regions between zur and the znuC homolog, as well as znuC and znuB homolog each generated a PCR product (Figure 2A). This indicated that these genes were transcribed on the same mRNA."^^ . "A type of RNA detection assay evidence where an RNA transcript is reverse transcribed into cDNA and amplified to qualitatively detect gene expression."^^ . "CollecTF"^^ . "ECO:0000108"^^ . "reverse transcription polymerase chain reaction transcription evidence"^^ . "RT-PCR"^^ . "eco"^^ . "transcript levels (e.g. RT-PCR)"^^ . "ECO:0000109"^^ . "The starting product for PCR, and therefore amplification volume, is directly correlated to the transcription rate."^^ . "reverse transcription polymerase chain reaction evidence"^^ . _:genid400 . _:genid400 . _:genid400 . _:genid400 "Taken together, the results of the RT-PCR analyses and the reporter fusion assays indicate that expression of SMU.1882 is up regulated in the presence of CovR."^^ . _:genid400 "PMID:21124877"^^ . _:genid401 . _:genid401 . _:genid401 . _:genid401 "The RT-PCR assay indicated that the sycO, ypkA and yopJ genes (designated as pCD12, pCD13 and pCD14 in Y. pestis 91001 [19], respectively) were transcribed as a single primary RNA (Fig. 1), and thereby these three genes constituted a single operon in Y. pestis Microtus strain 201."^^ . _:genid401 "PMID:19703315"^^ . _:genid402 . _:genid402 . _:genid402 . _:genid402 "Using reverse transcription-PCR, we found that primers designed to span the intergenic regions between zur and the znuC homolog, as well as znuC and znuB homolog each generated a PCR product (Figure 2A). This indicated that these genes were transcribed on the same mRNA."^^ . _:genid402 "PMID:24086521"^^ . _:genid403 . _:genid403 . _:genid403 . _:genid403 "A type of RNA detection assay evidence where an RNA transcript is reverse transcribed into cDNA and amplified to qualitatively detect gene expression."^^ . _:genid403 "ECO:SW"^^ . _:genid403 "PMID:11013345"^^ . _:genid403 "PMID:12901609"^^ . . . _:genid404 . _:genid404 . _:genid405 . _:genid406 . _:genid408 _:genid407 . _:genid406 _:genid408 . _:genid407 . _:genid407 . _:genid409 . _:genid410 . _:genid412 _:genid411 . _:genid410 _:genid412 . _:genid411 . _:genid411 . _:genid411 . _:genid412 . _:genid409 _:genid410 . _:genid407 _:genid409 . _:genid408 . _:genid405 _:genid406 . _:genid404 _:genid405 . _:genid404 . "fur RPAs were performed on RNA isolated from each strain, and an increase in fur expression was seen for G27, 26695, and the Fur swap strain under iron-depletion shock conditions while little to no increase was seen under iron-limited growth conditions (Fig. 4D and data not shown). This data shows that Fur autoregulation is consistent in each strain and further supports the notion that the AA difference in Fur is not responsible for the difference in sodB regulation between G27 and 26695."^^ . "A type of nuclease protection assay evidence where mRNA is hybridized with radiolabeled RNA probes after which RNAse is added to digest the unbound, nonresistant single-stranded overhang regions, later the remaining probe target hybrids are purified and resolved on denaturing polyacrylamide gel, and quantified by autoradiography."^^ . "CollecTF"^^ . "ribonuclease protection assay"^^ . "RPA"^^ . "eco"^^ . "RNA protection assay"^^ . "RNAse protection assay"^^ . "ECO:0000110"^^ . "RNA protection assay evidence"^^ . _:genid413 . _:genid413 . _:genid413 . _:genid413 "fur RPAs were performed on RNA isolated from each strain, and an increase in fur expression was seen for G27, 26695, and the Fur swap strain under iron-depletion shock conditions while little to no increase was seen under iron-limited growth conditions (Fig. 4D and data not shown). This data shows that Fur autoregulation is consistent in each strain and further supports the notion that the AA difference in Fur is not responsible for the difference in sodB regulation between G27 and 26695."^^ . _:genid413 "PMID:19399190"^^ . _:genid414 . _:genid414 . _:genid414 . _:genid414 "A type of nuclease protection assay evidence where mRNA is hybridized with radiolabeled RNA probes after which RNAse is added to digest the unbound, nonresistant single-stranded overhang regions, later the remaining probe target hybrids are purified and resolved on denaturing polyacrylamide gel, and quantified by autoradiography."^^ . _:genid414 "ECO:SW"^^ . _:genid414 "PMID:23457339"^^ . _:genid414 "TAIR:TED"^^ . . . . . "When we determined the proteolysis role of Lons in VapBC10 proteins by Western blot analysis using the strains BL21(DE3)(pJS882) and BL21(DE3)(pJS427), the levels of VapB10 and VapC10 remained stable over the course of translation inhibition (Figure 7D and E). Thus, Lon could not degrade VapBC10 proteins, consistent with our drop growth evidence (Figure 6B)."^^ . "A type of protein expression evidence where proteins are separated using gel electrophoresis, blotted onto a membrane, and probed with an antibody that can be detected via light or radioactive emission."^^ . "CollecTF"^^ . "ECO:0005602"^^ . "protein expression level evidence based on western blot"^^ . "eco"^^ . "Western blot expression analysis"^^ . "protein immunoblot"^^ . "protein levels (e.g. Western blots)"^^ . "ECO:0000112"^^ . "Western blot is used for protein detection and analysis. A mixed protein sample is separated through polyacrylamide gel electrophoresis then transferred to a membrane, such as polyvinylidene fluoride (PVDF), and labeled with protein-specific antibodies."^^ . "qualitative western immunoblotting evidence"^^ . _:genid415 . _:genid415 . _:genid415 . _:genid415 "When we determined the proteolysis role of Lons in VapBC10 proteins by Western blot analysis using the strains BL21(DE3)(pJS882) and BL21(DE3)(pJS427), the levels of VapB10 and VapC10 remained stable over the course of translation inhibition (Figure 7D and E). Thus, Lon could not degrade VapBC10 proteins, consistent with our drop growth evidence (Figure 6B)."^^ . _:genid415 "PMID:24260461"^^ . _:genid416 . _:genid416 . _:genid416 . _:genid416 "A type of protein expression evidence where proteins are separated using gel electrophoresis, blotted onto a membrane, and probed with an antibody that can be detected via light or radioactive emission."^^ . _:genid416 "ECO:SW"^^ . _:genid416 "PMID:23050259"^^ . _:genid416 "TAIR:TED"^^ . . . "A type of protein expression evidence where a protein of interest is isolated on the basis of its hybridization to an antibody raised to a homologous protein."^^ . "eco"^^ . "expression library screening"^^ . "ECO:0000114"^^ . "expression library screen evidence"^^ . _:genid417 . _:genid417 . _:genid417 . _:genid417 "A type of protein expression evidence where a protein of interest is isolated on the basis of its hybridization to an antibody raised to a homologous protein."^^ . _:genid417 "ECO:MCC"^^ . _:genid417 "TAIR:TED"^^ . . . _:genid418 . _:genid418 . _:genid419 . _:genid420 . _:genid422 _:genid421 . _:genid420 _:genid422 . _:genid421 . _:genid421 . _:genid421 . _:genid422 . _:genid419 _:genid420 . _:genid418 _:genid419 . _:genid418 . _:genid423 . _:genid423 . _:genid424 . _:genid425 . _:genid427 _:genid426 . _:genid425 _:genid427 . _:genid426 . _:genid426 . _:genid428 . _:genid428 . _:genid429 . _:genid430 . _:genid432 _:genid431 . _:genid430 _:genid432 . _:genid431 . _:genid431 . _:genid431 . _:genid432 . _:genid429 _:genid430 . _:genid428 _:genid429 . _:genid426 _:genid428 . _:genid427 . _:genid424 _:genid425 . _:genid423 _:genid424 . _:genid423 . "A type of nucleic acid hybridization evidence in which preferential or exclusive expression of genes in one cell type or tissue is compared to another cell type or tissue when mRNA from each sample is reverse transcribed, labeled, and hybridized to a cDNA library to compare hybridization patterns."^^ . "eco"^^ . "differential hybridization"^^ . "ECO:0000116"^^ . "Differential hybridization identifies differentially expressed cloned genes. Two different mRNA-derived probes are used to demonstrate RNA expression under a specific condition."^^ . "differential hybridization evidence"^^ . _:genid433 . _:genid433 . _:genid433 . _:genid433 "A type of nucleic acid hybridization evidence in which preferential or exclusive expression of genes in one cell type or tissue is compared to another cell type or tissue when mRNA from each sample is reverse transcribed, labeled, and hybridized to a cDNA library to compare hybridization patterns."^^ . _:genid433 "PMID:14668817"^^ . . . _:genid434 . _:genid434 . _:genid435 . _:genid436 . _:genid438 _:genid437 . _:genid436 _:genid438 . _:genid437 . _:genid437 . _:genid437 . _:genid438 . _:genid435 _:genid436 . _:genid434 _:genid435 . _:genid434 . _:genid439 . _:genid439 . _:genid440 . _:genid441 . _:genid443 _:genid442 . _:genid441 _:genid443 . _:genid442 . _:genid442 . _:genid444 . _:genid444 . _:genid445 . _:genid446 . _:genid448 _:genid447 . _:genid446 _:genid448 . _:genid447 . _:genid447 . _:genid447 . _:genid448 . _:genid445 _:genid446 . _:genid444 _:genid445 . _:genid442 _:genid444 . _:genid443 . _:genid440 _:genid441 . _:genid439 _:genid440 . _:genid439 . "A type of nucleic acid hybridization evidence in which preferential or exclusive expression of genes in one cell type or tissue are compared to another cell type or tissue when denatured ds-cDNA from the two samples are hybridized, and the common sequences are 'subtracted'."^^ . "eco"^^ . "subtractive hybridization"^^ . "ECO:0000118"^^ . "Subtractive hybridization is used for isolation and identification of transcripts involving the removal of any sequences present in the control from the test probe to detect only transcripts present in the sample. The method is PCR-based for the comparison of two cDNA libraries."^^ . "subtractive hybridization evidence"^^ . _:genid449 . _:genid449 . _:genid449 . _:genid449 "A type of nucleic acid hybridization evidence in which preferential or exclusive expression of genes in one cell type or tissue are compared to another cell type or tissue when denatured ds-cDNA from the two samples are hybridized, and the common sequences are 'subtracted'."^^ . _:genid449 "PMID:11298187"^^ . . . "In contrast, when RpoQ was overexpressed in either the wild type or the DeltalitR mutant, both were essentially nonmotile (Fig. 7), suggesting that quorum signaling regulates motility, at least in part, through an RpoQ mechanism downstream of LitR."^^ . "A type of experimental phenotypic evidence in which a gene and/or gene product is investigated in a transgenic organism that has been engineered to overexpress that gene product."^^ . "eco"^^ . "analysis of overexpression/ectopic expression phenotype"^^ . "ECO:0000120"^^ . "over expression analysis evidence"^^ . _:genid450 . _:genid450 . _:genid450 . _:genid450 "In contrast, when RpoQ was overexpressed in either the wild type or the DeltalitR mutant, both were essentially nonmotile (Fig. 7), suggesting that quorum signaling regulates motility, at least in part, through an RpoQ mechanism downstream of LitR."^^ . _:genid450 "PMID:22233679"^^ . _:genid451 . _:genid451 . _:genid451 . _:genid451 "A type of experimental phenotypic evidence in which a gene and/or gene product is investigated in a transgenic organism that has been engineered to overexpress that gene product."^^ . _:genid451 "PMID:22419077"^^ . . . "A type of localization evidence where sub-cellular localization of a protein is determined."^^ . "eco"^^ . "ECO:0000122"^^ . "protein localization evidence"^^ . _:genid452 . _:genid452 . _:genid452 . _:genid452 "A type of localization evidence where sub-cellular localization of a protein is determined."^^ . _:genid452 "GO:0008104"^^ . _:genid452 "url:http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0019937"^^ . . . _:genid453 . _:genid453 . _:genid453 . _:genid453 . _:genid454 . _:genid454 . _:genid454 . _:genid454 . _:genid455 . _:genid455 . _:genid456 . _:genid457 . _:genid459 _:genid458 . _:genid457 _:genid459 . _:genid458 . _:genid458 . _:genid460 . _:genid460 . _:genid460 . _:genid458 _:genid460 . _:genid459 . _:genid456 _:genid457 . _:genid455 _:genid456 . _:genid455 . "A type of protein localization evidence resulting from the fusion of a protein of interest to a labeling protein which has enzymatic activity or fluorescence properties."^^ . "eco"^^ . "ECO:0000124"^^ . "fusion protein localization evidence"^^ . _:genid461 . _:genid461 . _:genid461 . _:genid461 "A type of protein localization evidence resulting from the fusion of a protein of interest to a labeling protein which has enzymatic activity or fluorescence properties."^^ . _:genid461 "MI:0240"^^ . . . "A type of fusion protein localization evidence resulting from the labeling of a protein of interest with green fluorescent protein (GFP) from the jellyfish Aequorea victoria."^^ . "GFP fusion protein localization evidence"^^ . "eco"^^ . "localization of GFP/YFP fusion protein"^^ . "ECO:0000126"^^ . "green fluorescent protein fusion protein localization evidence"^^ . _:genid462 . _:genid462 . _:genid462 . _:genid462 "A type of fusion protein localization evidence resulting from the labeling of a protein of interest with green fluorescent protein (GFP) from the jellyfish Aequorea victoria."^^ . _:genid462 "PMID:9759496"^^ . . . "A type of fusion protein localization evidence resulting from the labeling of a protein of interest with yellow fluorescent protein (YFP), which was created by mutating green fluorescent protein (GFP) of the Aequorea victoria."^^ . "YFP fusion protein localization evidence"^^ . "eco"^^ . "localization of GFP/YFP fusion protein"^^ . "ECO:0000128"^^ . "yellow fluorescent protein fusion protein localization evidence"^^ . _:genid463 . _:genid463 . _:genid463 . _:genid463 "A type of fusion protein localization evidence resulting from the labeling of a protein of interest with yellow fluorescent protein (YFP), which was created by mutating green fluorescent protein (GFP) of the Aequorea victoria."^^ . _:genid463 "MI:0368"^^ . _:genid463 "url:http://www.jbc.org/content/276/31/29188.long"^^ . . . "A type of fusion protein localization evidence resulting from the targeted insertion of the beta-glucuronidase (GUS) coding gene as a reporter gene for the localization of a particular gene product."^^ . "GUS fusion protein localization evidence"^^ . "GUS staining evidence"^^ . "eco"^^ . "localization of GUS fusion protein"^^ . "ECO:0000130"^^ . "beta-glucuronidase fusion protein localization evidence"^^ . _:genid464 . _:genid464 . _:genid464 . _:genid464 "A type of fusion protein localization evidence resulting from the targeted insertion of the beta-glucuronidase (GUS) coding gene as a reporter gene for the localization of a particular gene product."^^ . _:genid464 "ECO:RCT"^^ . . . "A type of fusion protein localization evidence resulting from the targeted insertion of the beta-galactosidase coding gene (lacZ) into a specific gene to create a beta-galactosidase-tagged fusion protein."^^ . "LacZ fusion protein localization evidence"^^ . "eco"^^ . "ECO:0000132"^^ . "beta-galactosidase fusion protein localization evidence"^^ . _:genid465 . _:genid465 . _:genid465 . _:genid465 "A type of fusion protein localization evidence resulting from the targeted insertion of the beta-galactosidase coding gene (lacZ) into a specific gene to create a beta-galactosidase-tagged fusion protein."^^ . _:genid465 "PMID:23681629"^^ . . . _:genid466 . _:genid466 . _:genid466 . _:genid466 . _:genid467 . _:genid467 . _:genid467 . _:genid467 . _:genid468 . _:genid468 . _:genid469 . _:genid470 . _:genid472 _:genid471 . _:genid470 _:genid472 . _:genid471 . _:genid471 . _:genid473 . _:genid473 . _:genid473 . _:genid471 _:genid473 . _:genid472 . _:genid469 _:genid470 . _:genid468 _:genid469 . _:genid468 . "A type of direct assay evidence resulting from the activity assessment of transport proteins."^^ . "eco"^^ . "transport assay"^^ . "ECO:0000134"^^ . "transport assay evidence"^^ . _:genid474 . _:genid474 . _:genid474 . _:genid474 "A type of direct assay evidence resulting from the activity assessment of transport proteins."^^ . _:genid474 "PMID:18401524"^^ . . . _:genid475 . _:genid475 . _:genid476 . _:genid477 . _:genid479 _:genid478 . _:genid477 _:genid479 . _:genid478 . _:genid478 . _:genid478 . _:genid479 . _:genid476 _:genid477 . _:genid475 _:genid476 . _:genid475 . _:genid480 . _:genid480 . _:genid480 . _:genid480 . "A type of affinity evidence resulting from the binding of a molecule to a nucleic acid."^^ . "eco"^^ . "ECO:0000136"^^ . "nucleic acid binding evidence"^^ . _:genid481 . _:genid481 . _:genid481 . _:genid481 "A type of affinity evidence resulting from the binding of a molecule to a nucleic acid."^^ . _:genid481 "GO:0003676"^^ . . . _:genid482 . _:genid482 . _:genid482 . _:genid482 . "A type of nucleic acid binding evidence resulting from an enzyme displaying binding activity to specific ribohomopolymer."^^ . "eco"^^ . "ribohomopolymer binding assay"^^ . "ECO:0000138"^^ . "ribohomopolymer binding assay evidence"^^ . _:genid483 . _:genid483 . _:genid483 . _:genid483 "A type of nucleic acid binding evidence resulting from an enzyme displaying binding activity to specific ribohomopolymer."^^ . _:genid483 "PMC:102612"^^ . . . "A type of chromatography evidence that uses a thin layer of adsorbent (such as silica gel, alumina, or cellulose) on a flat, inert substrate."^^ . "TLC evidence"^^ . "eco"^^ . "thin layer chromatography"^^ . "ECO:0000140"^^ . "thin layer chromatography evidence"^^ . _:genid484 . _:genid484 . _:genid484 . _:genid484 "A type of chromatography evidence that uses a thin layer of adsorbent (such as silica gel, alumina, or cellulose) on a flat, inert substrate."^^ . _:genid484 "ECO:MCC"^^ . . . _:genid485 . _:genid485 . _:genid486 . _:genid487 . _:genid489 _:genid488 . _:genid487 _:genid489 . _:genid488 . _:genid488 . _:genid488 . _:genid489 . _:genid486 _:genid487 . _:genid485 _:genid486 . _:genid485 . _:genid490 . _:genid490 . _:genid490 . _:genid490 . "A type of protein binding evidence resulting from a metal ion binding to a protein at a specific binding site."^^ . "eco"^^ . "ECO:0000142"^^ . "protein:ion binding evidence"^^ . _:genid491 . _:genid491 . _:genid491 . _:genid491 "A type of protein binding evidence resulting from a metal ion binding to a protein at a specific binding site."^^ . _:genid491 "PMID:2377604"^^ . . . "A type of nucleic acid binding evidence in which DNA-protein binding is detected using labeled DNA as probes, hybridized to electrophoretically separated proteins."^^ . "eco"^^ . "Southwestern analysis"^^ . "ECO:0000144"^^ . "Southwestern blot evidence"^^ . _:genid492 . _:genid492 . _:genid492 . _:genid492 "A type of nucleic acid binding evidence in which DNA-protein binding is detected using labeled DNA as probes, hybridized to electrophoretically separated proteins."^^ . _:genid492 "ECO:RCT"^^ . _:genid492 "TAIR:TED"^^ . . . "A type of nucleic acid binding evidence in which RNA-protein binding is detected using labeled RNA as probes, hybridized to electrophoretically separated proteins."^^ . "eco"^^ . "Northwestern analysis"^^ . "ECO:0000146"^^ . "Northwestern blot evidence"^^ . _:genid493 . _:genid493 . _:genid493 . _:genid493 "A type of nucleic acid binding evidence in which RNA-protein binding is detected using labeled RNA as probes, hybridized to electrophoretically separated proteins."^^ . _:genid493 "ECO:RCT"^^ . _:genid493 "TAIR:TED"^^ . . "eco"^^ . "ECO:0000148"^^ . "in vitro binding evidence"^^ . "true"^^ . . . _:genid494 . _:genid494 . _:genid494 . _:genid494 . _:genid495 . _:genid495 . _:genid495 . _:genid495 . "As shown in Fig. 5, addition of reconstituted RNA polymerase holoenzyme, but not the core enzyme, generated expected size bands of 193-nt and 158-nt when P1882 and Pami, respectively, were used as template (lanes 2 and 7). However, the addition of CovR did not lead to any observable increase in transcription from P1882."^^ . "A type of reconstitution assay evidence resulting from the use of reconstituted polymerase transcription systems to investigate RNA synthesis."^^ . "eco"^^ . "in vitro reconstitution assay with recombinant protein"^^ . "ECO:0000150"^^ . "in vitro transcription reconstitution assay evidence"^^ . _:genid496 . _:genid496 . _:genid496 . _:genid496 "As shown in Fig. 5, addition of reconstituted RNA polymerase holoenzyme, but not the core enzyme, generated expected size bands of 193-nt and 158-nt when P1882 and Pami, respectively, were used as template (lanes 2 and 7). However, the addition of CovR did not lead to any observable increase in transcription from P1882."^^ . _:genid496 "PMID:21124877"^^ . _:genid497 . _:genid497 . _:genid497 . _:genid497 "A type of reconstitution assay evidence resulting from the use of reconstituted polymerase transcription systems to investigate RNA synthesis."^^ . _:genid497 "PMID:9237163"^^ . . . _:genid498 . _:genid498 . _:genid499 . _:genid500 . _:genid502 _:genid501 . _:genid500 _:genid502 . _:genid501 . _:genid501 . _:genid501 . _:genid502 . _:genid499 _:genid500 . _:genid498 _:genid499 . _:genid498 . "A type of in vitro transcription reconstitution assay evidence resulting from the use of recombinant proteins in preparation of a fully-defined transcription system."^^ . "eco"^^ . "in vitro reconstitution assay with recombinant protein"^^ . "ECO:0000152"^^ . "in vitro recombinant protein transcription reconstitution assay evidence"^^ . _:genid503 . _:genid503 . _:genid503 . _:genid503 "A type of in vitro transcription reconstitution assay evidence resulting from the use of recombinant proteins in preparation of a fully-defined transcription system."^^ . _:genid503 "PMID:9237165"^^ . . . "A type of protein expression evidence where a gene from one cell is inserted into a cell that does not typically contain that gene and heterologous protein expression is assessed."^^ . "eco"^^ . "protein expression in heterologous system"^^ . "ECO:0000154"^^ . "heterologous protein expression evidence"^^ . _:genid504 . _:genid504 . _:genid504 . _:genid504 "A type of protein expression evidence where a gene from one cell is inserted into a cell that does not typically contain that gene and heterologous protein expression is assessed."^^ . _:genid504 "ECO:KAV"^^ . . . "A type of fractionation evidence resulting from the isolation of a single type of protein from a complex mixture."^^ . "eco"^^ . "ECO:0000156"^^ . "protein separation evidence"^^ . _:genid505 . _:genid505 . _:genid505 . _:genid505 "A type of fractionation evidence resulting from the isolation of a single type of protein from a complex mixture."^^ . _:genid505 "ERO:0000526"^^ . . . "A type of protein separation evidence that is followed by direct protein sequencing whereby a protein's amino acid sequence is determined experimentally by Edman degradation or by mass spectrometry."^^ . "eco"^^ . "protein separation and direct sequencing"^^ . "ECO:0000158"^^ . "protein separation followed by direct sequencing evidence"^^ . . . "A type of protein separation evidence which then utilizes the screening and identification of small-molecules that bind to proteins."^^ . "eco"^^ . "protein separation and fragment identification"^^ . "ECO:0000160"^^ . "protein separation followed by fragment identification evidence"^^ . _:genid506 . _:genid506 . _:genid506 . _:genid506 "A type of protein separation evidence which then utilizes the screening and identification of small-molecules that bind to proteins."^^ . _:genid506 "https://pubs.acs.org/doi/10.1021/bi3005126" . _:genid506 "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5632530/" . . . "A type of transport assay evidence in which the uptake mechanism of a transporter is investigated in a cell that does not normally express that protein."^^ . "eco"^^ . "uptake assay in heterologous system"^^ . "ECO:0000162"^^ . "The transporter is a recombinant protein."^^ . "heterologous system uptake evidence"^^ . _:genid507 . _:genid507 . _:genid507 . _:genid507 "A type of transport assay evidence in which the uptake mechanism of a transporter is investigated in a cell that does not normally express that protein."^^ . _:genid507 "ECO:RCT"^^ . _:genid507 "doi:10.1146/annurev.pp.46.060195.002223"^^ . . . _:genid508 . _:genid508 . _:genid508 . _:genid508 . _:genid509 . _:genid509 . _:genid510 . _:genid511 . _:genid513 _:genid512 . _:genid511 _:genid513 . _:genid512 . _:genid512 . _:genid514 . _:genid514 . _:genid514 . _:genid512 _:genid514 . _:genid513 . _:genid510 _:genid511 . _:genid509 _:genid510 . _:genid509 . "A type of direct assay evidence where electrical properties of cells or tissues are studied."^^ . "eco"^^ . "ECO:0000164"^^ . "The scale of electrophysiology assays can range from small, e.g. a single ion channel, to large, e.g. an entire organ such as a heart."^^ . "electrophysiology assay evidence"^^ . _:genid515 . _:genid515 . _:genid515 . _:genid515 "A type of direct assay evidence where electrical properties of cells or tissues are studied."^^ . _:genid515 "ECO:KAV"^^ . . . "A type of voltage clamp recording evidence which involves using two electrodes inserted into a large cell (often a xenopus oocyte) where one electrode is used to measure the internal potential (voltage) of the cell and the other electrode is used to clamp the current."^^ . "eco"^^ . "two-electrode voltage clamp technique"^^ . "ECO:0000166"^^ . "two-electrode voltage clamp recording evidence"^^ . _:genid516 . _:genid516 . _:genid516 . _:genid516 "A type of voltage clamp recording evidence which involves using two electrodes inserted into a large cell (often a xenopus oocyte) where one electrode is used to measure the internal potential (voltage) of the cell and the other electrode is used to clamp the current."^^ . _:genid516 "ECO:SN"^^ . _:genid516 "PMID:23529422"^^ . . . "A type of direct assay evidence resulting from the detection and quantification of transcribed RNA."^^ . "eco"^^ . "ECO:0000168"^^ . "transcription assay evidence"^^ . _:genid517 . _:genid517 . _:genid517 . _:genid517 "A type of direct assay evidence resulting from the detection and quantification of transcribed RNA."^^ . _:genid517 "MeSH:D014158"^^ . _:genid517 "url:https://bmcmolbiol.biomedcentral.com/articles/10.1186/1471-2199-15-7"^^ . . . _:genid518 . _:genid518 . _:genid518 . _:genid518 . _:genid519 . _:genid519 . _:genid520 . _:genid521 . _:genid523 _:genid522 . _:genid521 _:genid523 . _:genid522 . _:genid522 . _:genid524 . _:genid524 . _:genid524 . _:genid522 _:genid524 . _:genid523 . _:genid520 _:genid521 . _:genid519 _:genid520 . _:genid519 . _:genid525 . _:genid525 . _:genid526 . _:genid527 . _:genid528 . _:genid527 _:genid528 . _:genid528 . _:genid526 _:genid527 . _:genid525 _:genid526 . _:genid525 . "A type of transcription assay evidence in which sequence-specific binding proteins that increase transcription of a specific target gene or genes are identified, quantified, and/or analyzed."^^ . "eco"^^ . "transcriptional activation assay"^^ . "ECO:0000170"^^ . "transcriptional activation assay evidence"^^ . _:genid529 . _:genid529 . _:genid529 . _:genid529 "A type of transcription assay evidence in which sequence-specific binding proteins that increase transcription of a specific target gene or genes are identified, quantified, and/or analyzed."^^ . _:genid529 "url:http://smcg.ccg.unam.mx/enp-unam/05-TranscripYRegulacion/transcription.pdf"^^ . . . _:genid530 . _:genid530 . _:genid530 . _:genid530 . "A type of experimental phenotypic evidence in which the biochemical aspect of a mutation is analyzed."^^ . "eco"^^ . "analysis of biochemical trait"^^ . "ECO:0000172"^^ . "For example, the accumulation of a biosynthetic intermediate."^^ . "biochemical trait analysis evidence"^^ . _:genid531 . _:genid531 . _:genid531 . _:genid531 "A type of experimental phenotypic evidence in which the biochemical aspect of a mutation is analyzed."^^ . _:genid531 "ECO:RCT"^^ . . . _:genid532 . _:genid532 . _:genid533 . _:genid534 . _:genid536 _:genid535 . _:genid534 _:genid536 . _:genid535 . _:genid535 . _:genid537 . _:genid538 . _:genid540 _:genid539 . _:genid538 _:genid540 . _:genid539 . _:genid539 . _:genid539 . _:genid540 . _:genid537 _:genid538 . _:genid535 _:genid537 . _:genid536 . _:genid533 _:genid534 . _:genid532 _:genid533 . _:genid532 . _:genid541 . _:genid541 . _:genid542 . _:genid543 . _:genid545 _:genid544 . _:genid543 _:genid545 . _:genid544 . _:genid544 . _:genid544 . _:genid545 . _:genid542 _:genid543 . _:genid541 _:genid542 . _:genid541 . _:genid546 . _:genid546 . _:genid547 . _:genid548 . _:genid550 _:genid549 . _:genid548 _:genid550 . _:genid549 . _:genid549 . _:genid551 . _:genid551 . _:genid551 . _:genid549 _:genid551 . _:genid550 . _:genid547 _:genid548 . _:genid546 _:genid547 . _:genid546 . "A type of mutant phenotype evidence in which the physiological response of a mutant when presented with an external stimulus is determined."^^ . "eco"^^ . "analysis of physiological response"^^ . "ECO:0000174"^^ . "Examples include: abnormal growth of the root in response to gravity, delay in flowering in response to varying light conditions."^^ . "mutant physiological response evidence"^^ . _:genid552 . _:genid552 . _:genid552 . _:genid552 "A type of mutant phenotype evidence in which the physiological response of a mutant when presented with an external stimulus is determined."^^ . _:genid552 "ECO:RCT"^^ . . . "A type of mutant phenotype evidence in which traits arising from a mutation are visually examined."^^ . "eco"^^ . "analysis of visible trait"^^ . "ECO:0000176"^^ . "mutant visible phenotype evidence"^^ . _:genid553 . _:genid553 . _:genid553 . _:genid553 "A type of mutant phenotype evidence in which traits arising from a mutation are visually examined."^^ . _:genid553 "ECO:RCT"^^ . . . "A type of similarity evidence in which the location of the gene within the genome provides insight into the gene's function or evolutionary insight."^^ . "eco"^^ . "ECO:0000177"^^ . "This type of evidence might include identity of neighboring genes, operon structure, synteny, phylogenetic analysis, or other whole-genome analysis."^^ . "genomic context evidence"^^ . _:genid554 . _:genid554 . _:genid554 . _:genid554 "A type of similarity evidence in which the location of the gene within the genome provides insight into the gene's function or evolutionary insight."^^ . _:genid554 "PMID:10958625"^^ . _:genid554 "PMID:21609955"^^ . . . _:genid555 . _:genid555 . _:genid555 . _:genid555 . _:genid556 . _:genid556 . _:genid557 . _:genid558 . _:genid560 _:genid559 . _:genid558 _:genid560 . _:genid559 . _:genid559 . _:genid561 . _:genid561 . _:genid561 . _:genid559 _:genid561 . _:genid560 . _:genid557 _:genid558 . _:genid556 _:genid557 . _:genid556 . "A type of direct assay evidence resulting from a sample of microorganisms or living tissue grown in a medium."^^ . "eco"^^ . "ECO:0000178"^^ . "in vivo assay evidence"^^ . _:genid562 . _:genid562 . _:genid562 . _:genid562 "A type of direct assay evidence resulting from a sample of microorganisms or living tissue grown in a medium."^^ . _:genid562 "ECO:RCT"^^ . _:genid562 "url:https://www.cancer.gov/publications/dictionaries/cancer-terms?cdrid=46352"^^ . . . _:genid563 . _:genid563 . _:genid563 . _:genid563 . _:genid564 . _:genid564 . _:genid564 . _:genid564 . _:genid565 . _:genid565 . _:genid566 . _:genid567 . _:genid569 _:genid568 . _:genid567 _:genid569 . _:genid568 . _:genid568 . _:genid570 . _:genid570 . _:genid570 . _:genid568 _:genid570 . _:genid569 . _:genid566 _:genid567 . _:genid565 _:genid566 . _:genid565 . "A type of experimental evidence arising from the investigation of an animal model system."^^ . "eco"^^ . "ECO:0000179"^^ . "animal model system study evidence"^^ . _:genid571 . _:genid571 . _:genid571 . _:genid571 "A type of experimental evidence arising from the investigation of an animal model system."^^ . _:genid571 "ECO:MCC"^^ . . . _:genid572 . _:genid572 . _:genid573 . _:genid574 . _:genid576 _:genid575 . _:genid574 _:genid576 . _:genid575 . _:genid575 . _:genid577 . _:genid577 . _:genid577 . _:genid575 _:genid577 . _:genid576 . _:genid573 _:genid574 . _:genid572 _:genid573 . _:genid572 . "A type of experimental evidence arising from a controlled investigation that uses human subjects."^^ . "eco"^^ . "ECO:0000180"^^ . "clinical study evidence"^^ . _:genid578 . _:genid578 . _:genid578 . _:genid578 "A type of experimental evidence arising from a controlled investigation that uses human subjects."^^ . _:genid578 "ECO:MCC"^^ . . . _:genid579 . _:genid579 . _:genid579 . _:genid579 . _:genid580 . _:genid580 . _:genid581 . _:genid582 . _:genid584 _:genid583 . _:genid582 _:genid584 . _:genid583 . _:genid583 . _:genid585 . _:genid585 . _:genid585 . _:genid583 _:genid585 . _:genid584 . _:genid581 _:genid582 . _:genid580 _:genid581 . _:genid580 . "A type of direct assay evidence resulting from a process performed outside the living organism, where the components of an organism have been isolated from their usual biological context, to permit a more detailed or more convenient analysis in an artificial setting."^^ . "ECO:0005013"^^ . "eco"^^ . "ECO:0000181"^^ . "in vitro assay evidence"^^ . _:genid586 . _:genid586 . _:genid586 . _:genid586 "A type of direct assay evidence resulting from a process performed outside the living organism, where the components of an organism have been isolated from their usual biological context, to permit a more detailed or more convenient analysis in an artificial setting."^^ . _:genid586 "ECO:RCT"^^ . _:genid586 "url:https://www.cancer.gov/publications/dictionaries/cancer-terms?cdrid=45733"^^ . . "eco"^^ . "ECO:0000182"^^ . "Use ECO:0001563 (cell growth assay evidence) in place of this term."^^ . "in vitro culture assay evidence"^^ . "true"^^ . . . _:genid587 . _:genid587 . _:genid587 . _:genid587 . _:genid588 . _:genid588 . _:genid588 . _:genid588 . _:genid589 . _:genid589 . _:genid590 . _:genid591 . _:genid593 _:genid592 . _:genid591 _:genid593 . _:genid592 . _:genid592 . _:genid594 . _:genid594 . _:genid594 . _:genid592 _:genid594 . _:genid593 . _:genid590 _:genid591 . _:genid589 _:genid590 . _:genid589 . "A type of direct assay evidence resulting from studies in which cytoplasmic and/or nuclear cellular components from resting, nonstimulated cells, are isolated by ultracentrifugation to provide molecular machinery that can be used in reactions in the absence of many of the other cellular components for the purpose of in vitro protein synthesis, transcription, DNA replication, etc."^^ . "in vitro assay"^^ . "eco"^^ . "ECO:0000183"^^ . "cell-free assay evidence"^^ . _:genid595 . _:genid595 . _:genid595 . _:genid595 "A type of direct assay evidence resulting from studies in which cytoplasmic and/or nuclear cellular components from resting, nonstimulated cells, are isolated by ultracentrifugation to provide molecular machinery that can be used in reactions in the absence of many of the other cellular components for the purpose of in vitro protein synthesis, transcription, DNA replication, etc."^^ . _:genid595 "PMID:18453125"^^ . . . . "A type of protein inhibition evidence and enzymatic acitivty evidence where the protein under study is an enzyme."^^ . "eco"^^ . "ECO:0000184"^^ . "enzyme inhibition evidence"^^ . _:genid596 . _:genid596 . _:genid596 . _:genid596 "A type of protein inhibition evidence and enzymatic acitivty evidence where the protein under study is an enzyme."^^ . _:genid596 "ECO:MCC"^^ . . . "A type of sequence similarity evidence in which an annotation is made based on a manually-reviewed or published sequence alignment"^^ . "mchibucos"^^ . "2010-03-18T12:21:31Z"^^ . "ECO:00000057"^^ . "eco"^^ . "ECO:0000200"^^ . "Such alignments may be pairwise alignments or multiple alignments."^^ . "sequence alignment evidence"^^ . _:genid597 . _:genid597 . _:genid597 . _:genid597 "A type of sequence similarity evidence in which an annotation is made based on a manually-reviewed or published sequence alignment"^^ . _:genid597 "url:http://www.geneontology.org/GO.evidence.shtml"^^ . . . "A type of sequence similarity evidence in which orthology is established by multiple criteria, including amino acid and/or nucleotide sequence comparisons and one or more of the following: phylogenetic analysis, coincident expression, conserved map location, functional complementation, immunological cross-reaction, similarity in subcellular localization, subunit structure, substrate specificity, and response to specific inhibitors."^^ . "mchibucos"^^ . "2010-03-18T12:30:06Z"^^ . "ECO:00000060"^^ . "eco"^^ . "ortholog evidence"^^ . "ECO:0000201"^^ . "Orthology is a relationship between genes in different species indicating that the genes derive from a common ancestor."^^ . "sequence orthology evidence"^^ . _:genid598 . _:genid598 . _:genid598 . _:genid598 "A type of sequence similarity evidence in which orthology is established by multiple criteria, including amino acid and/or nucleotide sequence comparisons and one or more of the following: phylogenetic analysis, coincident expression, conserved map location, functional complementation, immunological cross-reaction, similarity in subcellular localization, subunit structure, substrate specificity, and response to specific inhibitors."^^ . _:genid598 "url:http://www.geneontology.org/GO.evidence.shtml"^^ . . . "A putative rho-independent terminator sequence (GCCTGACTACATAGATGTCAGGC) was identified at position 402-bp downstream of SMU.1882 by TransTerm (transterm.dev.java.net) program."^^ . "A type of sequence similarity evidence in which the function of a gene product is predicted based on a sequence-based statistical model."^^ . "mchibucos"^^ . "2010-03-18T12:32:30Z"^^ . "ECO:00000063"^^ . "eco"^^ . "ECO:0000202"^^ . "Used when evidence from any kind of statistical model of a sequence or group of sequences is used to make a prediction about the function of a protein or RNA. Examples of relevant evidence are: Hidden Markov Models, PROSITE motifs, and tools such as tRNASCAN."^^ . "match to sequence model evidence"^^ . _:genid599 . _:genid599 . _:genid599 . _:genid599 "A putative rho-independent terminator sequence (GCCTGACTACATAGATGTCAGGC) was identified at position 402-bp downstream of SMU.1882 by TransTerm (transterm.dev.java.net) program."^^ . _:genid599 "PMID:21124877"^^ . _:genid600 . _:genid600 . _:genid600 . _:genid600 "A type of sequence similarity evidence in which the function of a gene product is predicted based on a sequence-based statistical model."^^ . _:genid600 "ECO:MCC"^^ . _:genid600 "url:http://www.geneontology.org/GO.evidence.shtml" . . . . "An assertion method that does not involve human review."^^ . "mchibucos"^^ . "2010-03-18T12:36:04Z"^^ . "ECO:00000067"^^ . "eco"^^ . "ECO:0000203"^^ . "An automatic assertion is based on computationally generated information that is not reviewed by a person prior to making the assertion. For example, one common type of automatic assertion involves creating an association of evidence with an entity based on commonness of attributes of that entity and another entity for which an assertion already exists. The commonness is determined algorithmically."^^ . "automatic assertion"^^ . _:genid601 . _:genid601 . _:genid601 . _:genid601 "An assertion method that does not involve human review."^^ . _:genid601 "ECO:MCC"^^ . . _:genid602 . _:genid603 . _:genid604 . _:genid603 _:genid604 . _:genid604 . _:genid602 _:genid603 . _:genid602 . . "A type of documented statement evidence that is based on an assertion by the author of a paper, which is read by a curator."^^ . "mchibucos"^^ . "2010-06-21T11:17:21Z"^^ . "ECO:0007010" . "eco"^^ . "ECO:0000204"^^ . "author statement"^^ . _:genid605 . _:genid605 . _:genid605 . _:genid605 "A type of documented statement evidence that is based on an assertion by the author of a paper, which is read by a curator."^^ . _:genid605 "ECO:MCC"^^ . . . "A type of inferential evidence that is based on a conclusion drawn by a curator."^^ . "mchibucos"^^ . "2010-08-18T05:55:12Z"^^ . "eco"^^ . "ECO:0000205"^^ . "curator inference"^^ . _:genid606 . _:genid606 . _:genid606 . _:genid606 "A type of inferential evidence that is based on a conclusion drawn by a curator."^^ . _:genid606 "ECO:MCC"^^ . . . "A type of pairwise sequence alignment evidence obtained with basic local alignment search tool (BLAST)."^^ . "mchibucos"^^ . "2010-08-06T04:48:24Z"^^ . "eco"^^ . "ECO:0000206"^^ . "BLAST evidence"^^ . _:genid607 . _:genid607 . _:genid607 . _:genid607 "A type of pairwise sequence alignment evidence obtained with basic local alignment search tool (BLAST)."^^ . _:genid607 "ECO:MCC"^^ . . . "A type of BLAST evidence in which nucleotide sequences are aligned."^^ . "mchibucos"^^ . "2010-08-06T04:49:58Z"^^ . "eco"^^ . "ECO:0000207"^^ . "nucleotide BLAST evidence"^^ . _:genid608 . _:genid608 . _:genid608 . _:genid608 "A type of BLAST evidence in which nucleotide sequences are aligned."^^ . _:genid608 "ECO:MCC"^^ . . . "Blast search of S. meliloti genome for homologues of X. campestris Ohr protein revealed two paralogues, SMa2389 and SMc00040, showing 52 and 57% identity respectively with Ohr of X. campestris."^^ . "A type of BLAST evidence in which amino acid or translated nucleotide sequences are aligned."^^ . "mchibucos"^^ . "2010-08-06T04:50:45Z"^^ . "eco"^^ . "ECO:0000208"^^ . "protein BLAST evidence"^^ . _:genid609 . _:genid609 . _:genid609 . _:genid609 "Blast search of S. meliloti genome for homologues of X. campestris Ohr protein revealed two paralogues, SMa2389 and SMc00040, showing 52 and 57% identity respectively with Ohr of X. campestris."^^ . _:genid609 "PMID:21569462"^^ . _:genid610 . _:genid610 . _:genid610 . _:genid610 "A type of BLAST evidence in which amino acid or translated nucleotide sequences are aligned."^^ . _:genid610 "ECO:MCC"^^ . . _:genid611 . _:genid612 . _:genid614 _:genid613 . _:genid612 _:genid614 . _:genid613 . _:genid613 . _:genid613 . _:genid614 . _:genid611 _:genid612 . _:genid611 . . . "IEA"^^ . "A type of BLAST evidence that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-08-06T04:55:21Z"^^ . "eco"^^ . "ECO:0000209"^^ . "BLAST evidence used in automatic assertion"^^ . _:genid615 . _:genid615 . _:genid615 . _:genid615 . _:genid615 "true"^^ . _:genid616 . _:genid616 . _:genid616 . _:genid616 "A type of BLAST evidence that is used in an automatic assertion."^^ . _:genid616 "ECO:MCC"^^ . . _:genid617 . _:genid618 . _:genid620 _:genid619 . _:genid618 _:genid620 . _:genid619 . _:genid619 . _:genid619 . _:genid620 . _:genid617 _:genid618 . _:genid617 . . . "IEA"^^ . "A type of nucleotide BLAST evidence that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-08-06T05:09:51Z"^^ . "eco"^^ . "ECO:0000210"^^ . "nucleotide BLAST evidence used in automatic assertion"^^ . _:genid621 . _:genid621 . _:genid621 . _:genid621 . _:genid621 "true"^^ . _:genid622 . _:genid622 . _:genid622 . _:genid622 "A type of nucleotide BLAST evidence that is used in an automatic assertion."^^ . _:genid622 "ECO:RCT"^^ . . _:genid623 . _:genid624 . _:genid626 _:genid625 . _:genid624 _:genid626 . _:genid625 . _:genid625 . _:genid625 . _:genid626 . _:genid623 _:genid624 . _:genid623 . . . "IEA"^^ . "A type of protein BLAST evidence that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-08-06T05:11:04Z"^^ . "eco"^^ . "ECO:0000211"^^ . "protein BLAST evidence used in automatic assertion"^^ . _:genid627 . _:genid627 . _:genid627 . _:genid627 . _:genid627 "true"^^ . _:genid628 . _:genid628 . _:genid628 . _:genid628 "A type of protein BLAST evidence that is used in an automatic assertion."^^ . _:genid628 "ECO:RCT"^^ . . _:genid629 . _:genid630 . _:genid632 _:genid631 . _:genid630 _:genid632 . _:genid631 . _:genid631 . _:genid631 . _:genid632 . _:genid629 _:genid630 . _:genid629 . . "A type of evidence in which at least two distinct types of evidence have been integrated."^^ . "mchibucos"^^ . "2010-08-06T05:24:57Z"^^ . "ECO:0000036"^^ . "ECO:0000043"^^ . "eco"^^ . "inferred from in-silico analysis"^^ . "ECO:0000212"^^ . "A key aspect of this type of evidence is that two or more pieces of information are combined to generate an emergent type of evidence not possible with the constituent pieces of evidence alone. A combinatorial analysis typically involves incorporation of different types of evidence."^^ . "combinatorial evidence"^^ . _:genid633 . _:genid633 . _:genid633 . _:genid633 "A type of evidence in which at least two distinct types of evidence have been integrated."^^ . _:genid633 "ECO:MCC"^^ . _:genid633 "ECO:RCT"^^ . . _:genid634 . _:genid635 . _:genid637 _:genid636 . _:genid635 _:genid637 . _:genid636 . _:genid636 . _:genid636 . _:genid637 . _:genid634 _:genid635 . _:genid634 . . . "IEA"^^ . "A type of combinatorial analysis that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-08-06T05:28:33Z"^^ . "eco"^^ . "inferred from in-silico analysis"^^ . "ECO:0000213"^^ . "Combinatorial analyses could include experimental or computational results. Examples include: (i) large-scale experiment such as a genome-wide two-hybrid or genome-wide synthetic interactions; (ii) integration of large-scale data sets of various types; and (iii) text-based-computation, e.g. text-mining. For simple sequence comparisons, one should use the sequence similarity analysis evidence type. For microarray results alone, expression pattern analysis is appropriate; whereas, large-scale computational analysis should be used when microarray results are combined with the results of other types of large-scale experiments."^^ . "combinatorial evidence used in automatic assertion"^^ . _:genid638 . _:genid638 . _:genid638 . _:genid638 . _:genid638 "true"^^ . _:genid639 . _:genid639 . _:genid639 . _:genid639 "A type of combinatorial analysis that is used in an automatic assertion."^^ . _:genid639 "ECO:MCC"^^ . . . "A type of phylogenetic evidence whereby an aspect of an ancestral gene is inferred through the characterization of an aspect of a descendant gene."^^ . "mchibucos"^^ . "2010-10-05T11:16:50Z"^^ . "eco"^^ . "ECO:0000214"^^ . "This type of evidence can be used in support of both positive and \"not\" GO annotations. It should be used to annotate ancestral genes but not extant ones."^^ . "biological aspect of descendant evidence"^^ . _:genid640 . _:genid640 . _:genid640 . _:genid640 "A type of phylogenetic evidence whereby an aspect of an ancestral gene is inferred through the characterization of an aspect of a descendant gene."^^ . _:genid640 "ECO:MCC"^^ . . . "A type of phylogenetic evidence characterized by long phylogenetic tree branch lengths following a duplication event."^^ . "mchibucos"^^ . "2010-10-05T03:41:34Z"^^ . "eco"^^ . "ECO:0000215"^^ . "Long branch lengths indicate that descendant sequences may have acquired different or additional functions than the ancestral sequence."^^ . "rapid divergence from ancestral sequence evidence"^^ . _:genid641 . _:genid641 . _:genid641 . _:genid641 "A type of phylogenetic evidence characterized by long phylogenetic tree branch lengths following a duplication event."^^ . _:genid641 "ECO:MCC"^^ . . . "A type of phylogenetic evidence characterized by the absence of key sequence residues."^^ . "mchibucos"^^ . "2010-10-05T03:43:17Z"^^ . "eco"^^ . "ECO:0000216"^^ . "The loss of certain residues important for function can indicate that a sequence lacks a particular function."^^ . "phylogenetic determination of loss of key residues evidence"^^ . _:genid642 . _:genid642 . _:genid642 . _:genid642 "A type of phylogenetic evidence characterized by the absence of key sequence residues."^^ . _:genid642 "ECO:MCC"^^ . . _:genid643 . _:genid644 . _:genid645 . _:genid644 _:genid645 . _:genid645 . _:genid643 _:genid644 . _:genid643 . "A means by which a statement is made about an entity."^^ . "mchibucos"^^ . "2010-11-12T04:17:37Z"^^ . "eco"^^ . "ECO:0000217"^^ . "assertion method"^^ . _:genid646 . _:genid646 . _:genid646 . _:genid646 "A means by which a statement is made about an entity."^^ . _:genid646 "ECO:MCC"^^ . . . "An assertion method that involves human review."^^ . "mchibucos"^^ . "2010-11-12T04:20:02Z"^^ . "eco"^^ . "ECO:0000218"^^ . "A manual assertion could be based on evidence that is generated by and interpreted by a human or it could involve human review of computationally generated information."^^ . "manual assertion"^^ . _:genid647 . _:genid647 . _:genid647 . _:genid647 "An assertion method that involves human review."^^ . _:genid647 "ECO:MCC"^^ . . . "A type of sequencing assay that determines the sequence of a biopolymer comprised of nucleotides."^^ . "mchibucos"^^ . "2010-11-15T12:22:40Z"^^ . "eco"^^ . "DNA sequencing"^^ . "ECO:0000219"^^ . "nucleotide sequencing assay evidence"^^ . _:genid648 . _:genid648 . _:genid648 . _:genid648 "A type of sequencing assay that determines the sequence of a biopolymer comprised of nucleotides."^^ . _:genid648 "ECO:MCC"^^ . _:genid649 . _:genid649 . _:genid649 . _:genid649 "DNA sequencing"^^ . _:genid649 "OBI:0000626"^^ . . . "A type of experimental evidence where the order of molecules that constitute a biopolymer is determined."^^ . "mchibucos"^^ . "2010-11-15T01:44:45Z"^^ . "eco"^^ . "ECO:0000220"^^ . "sequencing assay evidence"^^ . _:genid650 . _:genid650 . _:genid650 . _:genid650 "A type of experimental evidence where the order of molecules that constitute a biopolymer is determined."^^ . _:genid650 "ECO:MCC"^^ . _:genid650 "OBI:0600047"^^ . . . _:genid651 . _:genid651 . _:genid651 . _:genid651 . _:genid652 . _:genid652 . _:genid653 . _:genid654 . _:genid656 _:genid655 . _:genid654 _:genid656 . _:genid655 . _:genid655 . _:genid657 . _:genid657 . _:genid657 . _:genid655 _:genid657 . _:genid656 . _:genid653 _:genid654 . _:genid652 _:genid653 . _:genid652 . "A type of nucleotide sequencing assay evidence in which a sequence is derived from a parallelized sequencing technique."^^ . "mchibucos"^^ . "2010-11-15T02:19:34Z"^^ . "eco"^^ . "next generation sequencing evidence"^^ . "ECO:0000221"^^ . "Typically thousands to millions of reads are produced in parallel."^^ . "high throughput nucleotide sequencing assay evidence"^^ . _:genid658 . _:genid658 . _:genid658 . _:genid658 "A type of nucleotide sequencing assay evidence in which a sequence is derived from a parallelized sequencing technique."^^ . _:genid658 "ECO:MCC"^^ . . . "A type of high throughput nucleotide sequencing evidence in which sequence is determined through hybridization of adaptor-ligated DNA to a glass slide on which each fragment is simultaneously clonally amplified, followed by progressive rounds of base incorporation with fluorescently-tagged nucleotides, washing, imaging, and cleavage."^^ . "mchibucos"^^ . "2010-11-15T02:38:03Z"^^ . "eco"^^ . "Solexa sequencing result"^^ . "ECO:0000222"^^ . "In Illumina sequencing technology, adapters are ligated onto the ends of randomly fragmented DNA. After single-stranded fragments are bound to the inside surface of a flow cell channel, they undergo in-place bridge PCR amplification. To begin the sequencing cycle, labeled reversible terminators, primers and DNA polymerase are added, followed by laser excitation of the fluorescent label and high resolution scanning. After non-incorporated nucleotides are washed away and the dye is chemically removed, the next cycle repeats with four labeled reversible terminators, primers and DNA polymerase, again followed by imaging."^^ . "Illumina sequencing evidence"^^ . _:genid659 . _:genid659 . _:genid659 . _:genid659 "A type of high throughput nucleotide sequencing evidence in which sequence is determined through hybridization of adaptor-ligated DNA to a glass slide on which each fragment is simultaneously clonally amplified, followed by progressive rounds of base incorporation with fluorescently-tagged nucleotides, washing, imaging, and cleavage."^^ . _:genid659 "OBI:0000724"^^ . _:genid659 "PMID:26000844"^^ . _:genid660 . _:genid660 . _:genid660 . _:genid660 "Solexa sequencing result"^^ . _:genid660 "OBI:0000724"^^ . . . "A type of high throughput nucleotide sequencing evidence in which the sequence for a ssDNA is determined by addition of primers and then nucleotides, one base pair at a time (which generate a specific fluorescence), to the target strand."^^ . "mchibucos"^^ . "2010-11-15T03:50:14Z"^^ . "pyrosequencing"^^ . "eco"^^ . "ECO:0000223"^^ . "454 pyrosequencing technology amplifies individual DNA fragments inside water droplets within an oil solution (emulsion PCR). Within each droplet, a single DNA template is attached to a single primer-coated bead. Each bead is subsequently captured in a picolitre well within the sequencing machine. A luciferase-based readout system is used to identify individual nucleotides added to the nascent DNA.\n\nThe target strand is usually prepared by fragmentation, adaptor ligation, and amplification by emulsion PCR."^^ . "454 pyrosequencing evidence"^^ . _:genid661 . _:genid661 . _:genid661 . _:genid661 "A type of high throughput nucleotide sequencing evidence in which the sequence for a ssDNA is determined by addition of primers and then nucleotides, one base pair at a time (which generate a specific fluorescence), to the target strand."^^ . _:genid661 "EFO:0005016"^^ . _:genid662 . _:genid662 . _:genid662 . _:genid662 "pyrosequencing"^^ . _:genid662 "OBI:0000730"^^ . . . "A type of high throughput nucleotide sequencing evidence in which sequence is determined through rounds of ligation-based sequencing with fluorescently-labeled Di-base probes and cleavage, after which the template is reset, with a primer offset by one base, for subsequent rounds of ligation."^^ . "mchibucos"^^ . "2010-11-15T04:17:41Z"^^ . "eco"^^ . "ECO:0000224"^^ . "SOLiD sequencing technology is based on sequencing by ligation. After library preparation, emulsion PCR and bead enrichment are performed, including 3' modification of templates on selected beads to allow covalent bonding to a slide. 3' modified beads are attached to a glass slide and primers are added. Four fluorescently labeled di-base probes are added and multiple cycles of ligation, detection and cleavage are performed. The number of cycles determines read length. After a number of ligation cycles, the extension product is removed and another round of ligation cycles is performed with a new primer complimentary to the n-1 position of the template. Five rounds of primer reset are performed for each sequence tag.\n\nSamples are prepared by fragmentation of a sample library, adaptor ligation, emulsion PCR, and attachment of resultant beads to glass slides."^^ . "SOLiD sequencing evidence"^^ . _:genid663 . _:genid663 . _:genid663 . _:genid663 "A type of high throughput nucleotide sequencing evidence in which sequence is determined through rounds of ligation-based sequencing with fluorescently-labeled Di-base probes and cleavage, after which the template is reset, with a primer offset by one base, for subsequent rounds of ligation."^^ . _:genid663 "OBI:0000706"^^ . . . "A type of nucleotide sequencing assay in which DNA sequence is determined by addition of a primed DNA template to a reaction mixture, followed by addition of DNA polymerase, deoxynucleosidetriphosphates (dNTPs - one of which may be radiolabeled), and one of four di-deoxynucleotidetriphosphates (ddNTPs), after which DNA elongation is terminated and the DNA is separated by size and imaged."^^ . "mchibucos"^^ . "2010-11-15T04:46:31Z"^^ . "Sanger sequencing"^^ . "dye terminator sequencing"^^ . "eco"^^ . "ECO:0000225"^^ . "Chain termination sequencing, also called Sanger sequencing after its developer, uses dideoxynucleotide triphosphates (ddNTPs) as DNA chain terminators. Single-stranded DNA template, DNA primer, DNA polymerase, fluorescently or radioactively labeled nucleotides, and one of four ddNTPs are added together in each of four separate sequencing reactions. The synthesized and labeled DNA fragments from each of the four reactions are denatured, separated by size by gel electrophoresis, and visualized by autoradiography or UV light.\n\nThe ddNTPs lack an OH group so the next dNTP cannot be attached, causing chain termination."^^ . "chain termination sequencing evidence"^^ . _:genid664 . _:genid664 . _:genid664 . _:genid664 "A type of nucleotide sequencing assay in which DNA sequence is determined by addition of a primed DNA template to a reaction mixture, followed by addition of DNA polymerase, deoxynucleosidetriphosphates (dNTPs - one of which may be radiolabeled), and one of four di-deoxynucleotidetriphosphates (ddNTPs), after which DNA elongation is terminated and the DNA is separated by size and imaged."^^ . _:genid664 "OBI:0000695"^^ . . . _:genid665 . _:genid665 . _:genid665 . _:genid665 . _:genid666 . _:genid666 . _:genid666 . _:genid666 . _:genid667 . _:genid667 . _:genid668 . _:genid669 . _:genid671 _:genid670 . _:genid669 _:genid671 . _:genid670 . _:genid670 . _:genid672 . _:genid672 . _:genid672 . _:genid670 _:genid672 . _:genid671 . _:genid668 _:genid669 . _:genid667 _:genid668 . _:genid667 . "A type of immunoprecipitation evidence that is used to identify a protein binding site on a genomic DNA sequence."^^ . "mchibucos"^^ . "2010-11-16T01:29:08Z"^^ . "MI:0402"^^ . "ChIP evidence"^^ . "eco"^^ . "ECO:0000226"^^ . "Chromatin immunoprecipitation (ChIP) is used to investigate protein-DNA interactions in vivo. DNA and proteins are chemically cross-linked in vivo to form chromatin complexes, followed by cell lysis and DNA shearing. Fragmented DNA-protein complexes are selectively enriched for a protein of interest using a specific antibody (immunoprecipitation). Protein digestion and DNA purification are performed prior to DNA detection via molecular cloning and sequencing, polymerase chain reaction (PCR), microarray analysis (ChIP-on-chip), or direct high-throughput sequencing (ChIP-seq)."^^ . "chromatin immunoprecipitation evidence"^^ . _:genid673 . _:genid673 . _:genid673 . _:genid673 "A type of immunoprecipitation evidence that is used to identify a protein binding site on a genomic DNA sequence."^^ . _:genid673 "ECO:MCC"^^ . _:genid674 . _:genid674 . _:genid674 . _:genid674 "MI:0402"^^ . _:genid674 "chromatin immunoprecipitation assay"^^ . . . "A type of chromatin immunoprecipitation evidence that uses polymerase chain reaction (PCR) where specific primers are used on the pulled-down DNA for DNA detection."^^ . "CollecTF"^^ . "mchibucos"^^ . "2010-11-16T05:02:00Z"^^ . "ChIP-PCR evidence"^^ . "eco"^^ . "ECO:0000227"^^ . "ChIP-PCR is often used to validate ChIP-chip results and less frequently,ChIP-Seq results."^^ . "chromatin immunoprecipitation-PCR evidence"^^ . _:genid675 . _:genid675 . _:genid675 . _:genid675 "A type of chromatin immunoprecipitation evidence that uses polymerase chain reaction (PCR) where specific primers are used on the pulled-down DNA for DNA detection."^^ . _:genid675 "ECO:MCC"^^ . _:genid675 "ECO:SW"^^ . _:genid675 "PMID:18388953"^^ . . . _:genid676 . _:genid676 . _:genid676 . _:genid676 . "To confirm the in vivo binding of FimR to pfim, and to determine the impact of Mn2+ and Fe2+ on the binding activity of FimR, chromatin immunoprecipitation (ChIP) assay-quantitative real time PCR (qPCR) with anti-FimR antibody was employed as detailed in the materials and methods. The strongest binding of FimR to pfim was detected in cells grown in the presence of 50 microM MnCl2 and 50 microM FeSO4 (Figure 5, lane IV), whereas minimal amounts of MnCl2 (0.01 microM) and FeSO4 (0.1 microM) led to the weakest binding (Figure 5, lane I)."^^ . "A type of chromatin immunoprecipitation evidence in which protein-DNA interactions are investigated at known genomic binding sites through a process of ChIP, DNA purification, and finally quantitative polymerase chain reaction (qPCR) for DNA detection."^^ . "mchibucos"^^ . "2010-11-16T05:26:47Z"^^ . "ChIP-qPCR evidence"^^ . "eco"^^ . "ECO:0000228"^^ . "chromatin immunoprecipitation-qPCR evidence"^^ . _:genid677 . _:genid677 . _:genid677 . _:genid677 "To confirm the in vivo binding of FimR to pfim, and to determine the impact of Mn2+ and Fe2+ on the binding activity of FimR, chromatin immunoprecipitation (ChIP) assay-quantitative real time PCR (qPCR) with anti-FimR antibody was employed as detailed in the materials and methods. The strongest binding of FimR to pfim was detected in cells grown in the presence of 50 microM MnCl2 and 50 microM FeSO4 (Figure 5, lane IV), whereas minimal amounts of MnCl2 (0.01 microM) and FeSO4 (0.1 microM) led to the weakest binding (Figure 5, lane I)."^^ . _:genid677 "PMID:23823757"^^ . _:genid678 . _:genid678 . _:genid678 . _:genid678 "A type of chromatin immunoprecipitation evidence in which protein-DNA interactions are investigated at known genomic binding sites through a process of ChIP, DNA purification, and finally quantitative polymerase chain reaction (qPCR) for DNA detection."^^ . _:genid678 "url:https://www.diagenode.com/applications/chip-qpcr"^^ . . . _:genid679 . _:genid679 . _:genid679 . _:genid679 . _:genid680 . _:genid680 . _:genid681 . _:genid682 . _:genid684 _:genid683 . _:genid682 _:genid684 . _:genid683 . _:genid683 . _:genid685 . _:genid685 . _:genid685 . _:genid683 _:genid685 . _:genid684 . _:genid681 _:genid682 . _:genid680 _:genid681 . _:genid680 . "A type of chromatin immunoprecipitation evidence that uses high-throughput sequencing where immunoprecipitated DNA fragments are funnelled into a massively parallel sequencer to produce multiple short reads for locating binding sites of DNA-associated proteins."^^ . "CollecTF"^^ . "mchibucos"^^ . "2010-11-16T05:30:41Z"^^ . "ChIP-SEQ evidence"^^ . "ChIP-seq evidence"^^ . "eco"^^ . "ECO:0000229"^^ . "ChIP-Seq experiments often use the input as a control to eliminate biases. To obtain similar results, ChIP-chip with high-density tiling arrays can be used."^^ . "chromatin immunoprecipitation-seq evidence"^^ . _:genid686 . _:genid686 . _:genid686 . _:genid686 "A type of chromatin immunoprecipitation evidence that uses high-throughput sequencing where immunoprecipitated DNA fragments are funnelled into a massively parallel sequencer to produce multiple short reads for locating binding sites of DNA-associated proteins."^^ . _:genid686 "ECO:MCC"^^ . _:genid686 "ECO:SW"^^ . _:genid686 "OBI:0000716"^^ . _:genid686 "PMID:22955991"^^ . _:genid687 . _:genid687 . _:genid687 . _:genid687 "ChIP-SEQ evidence"^^ . _:genid687 "OBI:0000716"^^ . _:genid688 . _:genid688 . _:genid688 . _:genid688 "ChIP-seq evidence"^^ . _:genid688 "PMID:22955991"^^ . . . _:genid689 . _:genid689 . _:genid689 . _:genid689 . _:genid690 . _:genid690 . _:genid691 . _:genid692 . _:genid694 _:genid693 . _:genid692 _:genid694 . _:genid693 . _:genid693 . _:genid695 . _:genid695 . _:genid695 . _:genid693 _:genid695 . _:genid694 . _:genid691 _:genid692 . _:genid690 _:genid691 . _:genid690 . "A type of chromatin immunoprecipitation evidence that uses a tiling microarray for the detection of protein-bound DNA regions where chromatin is immunoprecipitated for protein tagging and DNA is sheared from the cross-linked protein-DNA complex to be arrayed revealing the protein-bound genomic regions."^^ . "CollecTF"^^ . "mchibucos"^^ . "2010-11-16T05:43:55Z"^^ . "MI:0225"^^ . "ChIP-chip evidence"^^ . "ChIP-on-chip evidence"^^ . "eco"^^ . "ECO:0000230"^^ . "A fixating agent such as formaldehyde is used to cross link proteins and DNA. Sonication is applied for DNA shearing. For transcription factor tagging, an antibody or epitope is employed. After cross-linking is reversed, the DNA is amplified and labeled with a flourophore for microarray which produces a resolution of aproximately 500 bp."^^ . "chromatin immunoprecipitation-chip evidence"^^ . _:genid696 . _:genid696 . _:genid696 . _:genid696 "A type of chromatin immunoprecipitation evidence that uses a tiling microarray for the detection of protein-bound DNA regions where chromatin is immunoprecipitated for protein tagging and DNA is sheared from the cross-linked protein-DNA complex to be arrayed revealing the protein-bound genomic regions."^^ . _:genid696 "ECO:MCC"^^ . _:genid696 "ECO:SW"^^ . _:genid696 "PMID:18388953"^^ . _:genid696 "PMID:19381927"^^ . _:genid697 . _:genid697 . _:genid697 . _:genid697 "MI:0225"^^ . _:genid697 "chromatin immunoprecipitation array"^^ . . . _:genid698 . _:genid698 . _:genid698 . _:genid698 . "A type of DNA detection assay evidence where the reaction product is quantified in real-time across cycles by means of fluorescent dyes or fluorescent probes for detection and quantification of specific sequences in a DNA sample."^^ . "CollecTF"^^ . "mchibucos"^^ . "2010-11-16T05:57:20Z"^^ . "Q-PCR evidence"^^ . "qPCR evidence"^^ . "quantitative PCR evidence"^^ . "quantitative real-time PCR evidence"^^ . "real time polymerase chain reaction evidence"^^ . "real-time PCR evidence"^^ . "real-time quantitative PCR"^^ . "eco"^^ . "qRT-PCR evidence"^^ . "ECO:0000231"^^ . "Quantitative PCR enables both detection and quantification (as absolute number of copies or relative amount when normalized to DNA input or additional normalizing genes) of one or more specific sequences in a DNA sample. The dye is activated upon binding double-stranded DNA.\n\nAlthough qRT-PCR is commonly found in literature synonymous to qPCR, it is preferable not to use this synonym as it is the accepted abbreviation for reverse transcription PCR. qPCR should be used instead (ISBN 978-0-470-68386-6 page 173).\n\nqPCR can be used to quantitatively determine levels of gene expression."^^ . "quantitative polymerase chain reaction evidence"^^ . _:genid699 . _:genid699 . _:genid699 . _:genid699 "A type of DNA detection assay evidence where the reaction product is quantified in real-time across cycles by means of fluorescent dyes or fluorescent probes for detection and quantification of specific sequences in a DNA sample."^^ . _:genid699 "ECO:MCC"^^ . _:genid699 "ECO:SW"^^ . . . _:genid700 . _:genid700 . _:genid700 . _:genid700 . _:genid701 . _:genid701 . _:genid702 . _:genid703 . _:genid705 _:genid704 . _:genid703 _:genid705 . _:genid704 . _:genid704 . _:genid706 . _:genid706 . _:genid707 . _:genid708 . _:genid710 _:genid709 . _:genid708 _:genid710 . _:genid709 . _:genid709 . _:genid709 . _:genid710 . _:genid707 _:genid708 . _:genid706 _:genid707 . _:genid704 _:genid706 . _:genid705 . _:genid702 _:genid703 . _:genid701 _:genid702 . _:genid701 . "A type of experimental evidence that is based on a five-step technique of cross-linking DNA in vivo, restriction digestion, intramolecular ligation, reversing DNA cross-links, DNA processing, and quantitation that serves to analyze the spatial organization of chromatin in a cell and quantify the number of interactions between genomic loci that are nearby in 3-D space."^^ . "mchibucos"^^ . "2010-11-17T12:27:14Z"^^ . "chromosome conformation capture-based evidence" . "3C"^^ . "chromosome conformation capture"^^ . "eco"^^ . "ECO:0000232"^^ . "Chromosome conformation capture technologies are used to study the structural properties and spatial organization of chromosomes inside cells. All types of chromosome conformation capture technology involve five primary steps: cross-linking of DNA in vivo, restriction digestion, intramolecular ligation, reversing cross-linkages, and DNA enrichment and quantitation. The last step is different for each type of chromosome conformation capture technology, and may include PCR (3C), inverse PCR (4C), or ligation-mediated amplification (5C). Methods for product quantitation can include agarose gel detection or real-time quantitative PCR in the case of 3C, or high-throughput sequencing or microarray analysis for 4C and 5C."^^ . "chromosome conformation-based evidence"^^ . _:genid711 . _:genid711 . _:genid711 . _:genid711 "A type of experimental evidence that is based on a five-step technique of cross-linking DNA in vivo, restriction digestion, intramolecular ligation, reversing DNA cross-links, DNA processing, and quantitation that serves to analyze the spatial organization of chromatin in a cell and quantify the number of interactions between genomic loci that are nearby in 3-D space."^^ . _:genid711 "ECO:MCC"^^ . . . _:genid712 . _:genid712 . _:genid712 . _:genid712 . "A type of chromosome conformation-based evidence that is derived by 1) quantifying interactions between a single pair of genomic loci and not multiple interactions and 2) performing polymerase chain reaction (PCR) in the final product quantitation step."^^ . "mchibucos"^^ . "2010-11-17T12:46:15Z"^^ . "3C"^^ . "chromosome conformation capture evidence" . "chromosome conformation capture-PCR evidence"^^ . "eco"^^ . "ECO:0000233"^^ . "3C is used to study the structural properties and spatial organization of chromosomes inside cells. Like other types of chromosome conformation capture technology, 3C differs only in the fifth step, which involves performing either standard polymerase chain reaction (PCR) or quantitative PCR (qPCR) for product quantitation."^^ . "3C evidence"^^ . _:genid713 . _:genid713 . _:genid713 . _:genid713 "A type of chromosome conformation-based evidence that is derived by 1) quantifying interactions between a single pair of genomic loci and not multiple interactions and 2) performing polymerase chain reaction (PCR) in the final product quantitation step."^^ . _:genid713 "ECO:MCC"^^ . . . "A type of chromosome conformation-based evidence that is derived by inverse polymerase chain reaction (inverse PCR) on a prior circularized 3C library followed by product quantitation with a microarray."^^ . "mchibucos"^^ . "2010-11-19T01:20:28Z"^^ . "chromosome conformation capture on chip"^^ . "circularized 3C"^^ . "circularized chromosome conformation capture evidence"^^ . "eco"^^ . "ECO:0000234"^^ . "4C is used to study the structural properties and spatial organization of chromosomes inside cells. Like other types of chromosome conformation capture technology, 4C differs only in the fifth step, which involves inverse polymerase chain reaction (inverse PCR) on a circularized 3C library prior to product quantitation."^^ . "4C evidence"^^ . _:genid714 . _:genid714 . _:genid714 . _:genid714 "A type of chromosome conformation-based evidence that is derived by inverse polymerase chain reaction (inverse PCR) on a prior circularized 3C library followed by product quantitation with a microarray."^^ . _:genid714 "ECO:MCC"^^ . _:genid714 "PMID:17033624"^^ . . . _:genid715 . _:genid715 . _:genid715 . _:genid715 . "A type of chromosome conformation-based evidence that is derived by performing ligation-mediated amplification (LMA) prior to product quantitation."^^ . "mchibucos"^^ . "2010-11-19T01:22:20Z"^^ . "5C"^^ . "carbon-copy 3C"^^ . "carbon-copy chromosome conformation capture evidence" . "eco"^^ . "ECO:0000235"^^ . "5C is used to study the structural properties and spatial organization of chromosomes inside cells. Like other types of chromosome conformation capture technology, 5C differs only in the fifth step, which involves ligation-mediated amplification (LMA) followed by product quantitation."^^ . "5C evidence"^^ . _:genid716 . _:genid716 . _:genid716 . _:genid716 "A type of chromosome conformation-based evidence that is derived by performing ligation-mediated amplification (LMA) prior to product quantitation."^^ . _:genid716 "ECO:MCC"^^ . . "A type of chromosome conformation capture evidence that is derived by performing polymerase chain reaction (PCR) in the quantitation step."^^ . "mchibucos"^^ . "2010-11-19T03:00:47Z"^^ . "3C"^^ . "3C-PCR"^^ . "eco"^^ . "ECO:0000236"^^ . "See 3C evidence. 3C evidence was initially developed using PCR."^^ . "chromosome conformation capture-PCR evidence"^^ . "true"^^ . _:genid717 . _:genid717 . _:genid717 . _:genid717 "A type of chromosome conformation capture evidence that is derived by performing polymerase chain reaction (PCR) in the quantitation step."^^ . _:genid717 "ECO:MCC"^^ . . . _:genid718 . _:genid718 . _:genid719 . _:genid720 . _:genid721 . _:genid720 _:genid721 . _:genid721 . _:genid719 _:genid720 . _:genid718 _:genid719 . _:genid718 . "A type of 3C evidence evidence that 1) quantifies interactions between a single pair of genomic loci (not multiple interactions) and 2) performs quantitative polymerase chain reaction (qPCR) in the quantitation step."^^ . "mchibucos"^^ . "2010-11-19T03:06:47Z"^^ . "3C-quantitative PCR"^^ . "3C-real-time PCR"^^ . "chromosome conformation capture-qPCR evidence"^^ . "eco"^^ . "ECO:0000237"^^ . "3C-qPCR evidence"^^ . _:genid722 . _:genid722 . _:genid722 . _:genid722 "A type of 3C evidence evidence that 1) quantifies interactions between a single pair of genomic loci (not multiple interactions) and 2) performs quantitative polymerase chain reaction (qPCR) in the quantitation step."^^ . _:genid722 "ECO:MCC"^^ . _:genid722 "PMID:17641637"^^ . _:genid722 "PMID:26025624"^^ . . . _:genid723 . _:genid723 . _:genid723 . _:genid723 . "A type of chromosome conformation-based evidence that is derived by performing immunoprecipitation enrichment of the biotin labelled ligated fragments events prior to sequencing of the library and mapping it to the genome."^^ . "mchibucos"^^ . "2010-11-19T04:24:03Z"^^ . "eco"^^ . "ECO:0000238"^^ . "Hi-C is used to study the structural properties and spatial organization of chromosomes inside cells. Hi-C is similar to other types of chromosome conformation capture technology, but involves the addition of biotinylated nucleotides during the second or fourth step and enrichment for ligated fragments using immunoprecipitation after the fourth step."^^ . "Hi-C evidence"^^ . _:genid724 . _:genid724 . _:genid724 . _:genid724 "A type of chromosome conformation-based evidence that is derived by performing immunoprecipitation enrichment of the biotin labelled ligated fragments events prior to sequencing of the library and mapping it to the genome."^^ . _:genid724 "ECO:MCC"^^ . . . "A type of chromosome conformation-based evidence that is derived by inverse polymerase chain reaction (inverse PCR) on a circularized 3C library prior to product quantitation with multiplexed high-throughput (HT) sequencing."^^ . "mchibucos"^^ . "2010-11-30T03:22:25Z"^^ . "3C sequencing"^^ . "circularized 3C sequencing"^^ . "circularized 3C-seq"^^ . "eco"^^ . "chromosome conformation capture sequencing evidence" . "ECO:0000239"^^ . "3C-seq is used to study the structural properties and spatial organization of chromosomes inside cells. Like other types of chromosome conformation capture technology, 3C-seq differs only in the fifth step, which involves inverse polymerase chain reaction (PCR) on a circularized 3C library prior to product quantitation."^^ . "3C-seq evidence"^^ . _:genid725 . _:genid725 . _:genid725 . _:genid725 "A type of chromosome conformation-based evidence that is derived by inverse polymerase chain reaction (inverse PCR) on a circularized 3C library prior to product quantitation with multiplexed high-throughput (HT) sequencing."^^ . _:genid725 "ECO:MCC"^^ . _:genid725 "PMID:23411633"^^ . . . "A type of experimental phenotypic evidence resulting from the disruption of a structural feature."^^ . "mchibucos"^^ . "2010-12-06T12:24:16Z"^^ . "anatomical perturbation evidence"^^ . "eco"^^ . "ECO:0000240"^^ . "anatomical perturbation phenotypic evidence"^^ . _:genid726 . _:genid726 . _:genid726 . _:genid726 "A type of experimental phenotypic evidence resulting from the disruption of a structural feature."^^ . _:genid726 "ECO:MCC"^^ . . . "A type of experimental phenotypic evidence resulting from modification to the surroundings or conditions in which an organism lives or operates."^^ . "mchibucos"^^ . "2010-12-06T12:33:58Z"^^ . "environmental perturbation evidence"^^ . "eco"^^ . "mechanical constraint evidence"^^ . "ECO:0000241"^^ . "Many environmental factors are subject to modification, such as temperature, pressure, humidity, radiation, and so forth."^^ . "environmental perturbation phenotypic evidence"^^ . _:genid727 . _:genid727 . _:genid727 . _:genid727 "A type of experimental phenotypic evidence resulting from modification to the surroundings or conditions in which an organism lives or operates."^^ . _:genid727 "ECO:MCC"^^ . . . "A type of anatomical perturbation phenotypic evidence resulting from the surgical removal of tissue or subcellular components."^^ . "mchibucos"^^ . "2010-12-06T12:33:58Z"^^ . "ablated tissue evidence"^^ . "tissue ablation evidence"^^ . "eco"^^ . "ECO:0000242"^^ . "tissue ablation phenotypic evidence"^^ . _:genid728 . _:genid728 . _:genid728 . _:genid728 "A type of anatomical perturbation phenotypic evidence resulting from the surgical removal of tissue or subcellular components."^^ . _:genid728 "ECO:MCC"^^ . . . _:genid729 . _:genid729 . _:genid730 . _:genid731 . _:genid733 _:genid732 . _:genid731 _:genid733 . _:genid732 . _:genid732 . _:genid732 . _:genid733 . _:genid730 _:genid731 . _:genid729 _:genid730 . _:genid729 . "A type of anatomical perturbation phenotypic evidence resulting from the addition of tissue to an organism through a graft procedure."^^ . "mchibucos"^^ . "2010-12-06T12:33:58Z"^^ . "tissue grafting evidence"^^ . "eco"^^ . "ECO:0000243"^^ . "tissue grafting phenotypic evidence"^^ . _:genid734 . _:genid734 . _:genid734 . _:genid734 "A type of anatomical perturbation phenotypic evidence resulting from the addition of tissue to an organism through a graft procedure."^^ . _:genid734 "ECO:MCC"^^ . . _:genid735 . _:genid736 . _:genid738 _:genid737 . _:genid736 _:genid738 . _:genid737 . _:genid737 . _:genid737 . _:genid738 . _:genid735 _:genid736 . _:genid735 . . . "A type of combinatorial analysis that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-09T02:02:12Z"^^ . "eco"^^ . "inferred from in-silico analysis"^^ . "ECO:0000244"^^ . "Combinatorial analyses could include experimental or computational results. Examples include: (i) large-scale experiment such as a genome-wide two-hybrid or genome-wide synthetic interactions; (ii) integration of large-scale data sets of various types; and (iii) text-based-computation, e.g. text-mining. For simple sequence comparisons, one should use the sequence similarity analysis evidence type. For microarray results alone, expression pattern analysis is appropriate; whereas, large-scale computational analysis should be used when microarray results are combined with the results of other types of large-scale experiments."^^ . "combinatorial evidence used in manual assertion"^^ . _:genid739 . _:genid739 . _:genid739 . _:genid739 . _:genid739 "true"^^ . _:genid740 . _:genid740 . _:genid740 . _:genid740 "A type of combinatorial analysis that is used in a manual assertion."^^ . _:genid740 "ECO:MCC"^^ . . _:genid741 . _:genid742 . _:genid744 _:genid743 . _:genid742 _:genid744 . _:genid743 . _:genid743 . _:genid743 . _:genid744 . _:genid741 _:genid742 . _:genid741 . . . "RCA"^^ . "A type of automatically integrated combinatorial evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-09T02:37:54Z"^^ . "GOECO:RCA"^^ . "RCA"^^ . "inferred from reviewed computational analysis"^^ . "eco"^^ . "computational combinatorial evidence used in manual assertion"^^ . "ECO:0000245"^^ . . . . "automatically integrated combinatorial evidence used in manual assertion"^^ . "http://geneontology.org/page/rca-inferred-reviewed-computational-analysis"^^ . _:genid745 . _:genid745 . _:genid745 . _:genid745 . _:genid745 "true"^^ . _:genid746 . _:genid746 . _:genid746 . _:genid746 . _:genid746 "true"^^ . _:genid747 . _:genid747 . _:genid747 . _:genid747 "RCA"^^ . _:genid747 "Default"^^ . _:genid748 . _:genid748 . _:genid748 . _:genid748 "A type of automatically integrated combinatorial evidence that is used in a manual assertion."^^ . _:genid748 "ECO:RCT"^^ . _:genid749 . _:genid749 . _:genid749 . _:genid749 "GOECO:RCA"^^ . _:genid749 "inferred from reviewed computational analysis"^^ . _:genid750 . _:genid750 . _:genid750 . _:genid750 "RCA"^^ . _:genid750 "GOECO:RCA"^^ . _:genid751 . _:genid751 . _:genid751 . _:genid751 "inferred from reviewed computational analysis"^^ . _:genid751 "GOECO:RCA"^^ . . "A type of computational combinatorial analysis that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-12-09T02:37:54Z"^^ . "eco"^^ . "ECO:0000246"^^ . "Merged with ECO:0000053."^^ . "computational combinatorial evidence used in automatic assertion"^^ . "true"^^ . _:genid752 . _:genid752 . _:genid752 . _:genid752 "A type of computational combinatorial analysis that is used in an automatic assertion."^^ . _:genid752 "ECO:MCC"^^ . . _:genid753 . _:genid754 . _:genid756 _:genid755 . _:genid754 _:genid756 . _:genid755 . _:genid755 . _:genid755 . _:genid756 . _:genid753 _:genid754 . _:genid753 . . . "ISA"^^ . "A type of sequence alignment evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-09T05:12:27Z"^^ . "GOECO:ISA"^^ . "ISA"^^ . "inferred from sequence alignment"^^ . "eco"^^ . "ECO:0000247"^^ . . . "sequence alignment evidence used in manual assertion"^^ . "http://geneontology.org/page/isa-inferred-sequence-alignment"^^ . _:genid757 . _:genid757 . _:genid757 . _:genid757 . _:genid757 "true"^^ . _:genid758 . _:genid758 . _:genid758 . _:genid758 "ISA"^^ . _:genid758 "Default"^^ . _:genid759 . _:genid759 . _:genid759 . _:genid759 "A type of sequence alignment evidence that is used in a manual assertion."^^ . _:genid759 "ECO:RCT"^^ . _:genid760 . _:genid760 . _:genid760 . _:genid760 "GOECO:ISA"^^ . _:genid760 "inferred from sequence alignment"^^ . _:genid761 . _:genid761 . _:genid761 . _:genid761 "ISA"^^ . _:genid761 "GOECO:ISA"^^ . _:genid762 . _:genid762 . _:genid762 . _:genid762 "inferred from sequence alignment"^^ . _:genid762 "GOECO:ISA"^^ . . _:genid763 . _:genid764 . _:genid766 _:genid765 . _:genid764 _:genid766 . _:genid765 . _:genid765 . _:genid765 . _:genid766 . _:genid763 _:genid764 . _:genid763 . . . "IEA"^^ . "A type of sequence alignment evidence that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-12-09T05:12:27Z"^^ . "eco"^^ . "ECO:0000248"^^ . "sequence alignment evidence used in automatic assertion"^^ . _:genid767 . _:genid767 . _:genid767 . _:genid767 . _:genid767 "true"^^ . _:genid768 . _:genid768 . _:genid768 . _:genid768 "A type of sequence alignment evidence that is used in an automatic assertion."^^ . _:genid768 "ECO:RCT"^^ . . _:genid769 . _:genid770 . _:genid772 _:genid771 . _:genid770 _:genid772 . _:genid771 . _:genid771 . _:genid771 . _:genid772 . _:genid769 _:genid770 . _:genid769 . . . . "IEA"^^ . "A type of sequence similarity evidence that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-12-09T05:22:30Z"^^ . "GO_REF:0000107"^^ . "eco"^^ . "ECO:0000249"^^ . "sequence similarity evidence used in automatic assertion"^^ . _:genid773 . _:genid773 . _:genid773 . _:genid773 . _:genid773 "true"^^ . _:genid774 . _:genid774 . _:genid774 . _:genid774 . _:genid774 "true"^^ . _:genid775 . _:genid775 . _:genid775 . _:genid775 "A type of sequence similarity evidence that is used in an automatic assertion."^^ . _:genid775 "ECO:RCT"^^ . _:genid776 . _:genid776 . _:genid776 . _:genid776 "GO_REF:0000107"^^ . _:genid776 "Automatic transfer of experimentally verified manual GO annotation data to orthologs using Ensembl"^^ . . _:genid777 . _:genid778 . _:genid780 _:genid779 . _:genid778 _:genid780 . _:genid779 . _:genid779 . _:genid779 . _:genid780 . _:genid777 _:genid778 . _:genid777 . . . . "ISS"^^ . "A type of sequence similarity evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-09T05:22:30Z"^^ . "GOECO:ISS"^^ . "ISS"^^ . "inferred from sequence or structural similarity"^^ . "eco"^^ . "ECO:0000250"^^ . . . . "sequence similarity evidence used in manual assertion"^^ . "http://geneontology.org/page/iss-inferred-sequence-or-structural-similarity"^^ . _:genid781 . _:genid781 . _:genid781 . _:genid781 . _:genid781 "true"^^ . _:genid782 . _:genid782 . _:genid782 . _:genid782 . _:genid782 "true"^^ . _:genid783 . _:genid783 . _:genid783 . _:genid783 "ISS"^^ . _:genid783 "Default"^^ . _:genid784 . _:genid784 . _:genid784 . _:genid784 "A type of sequence similarity evidence that is used in a manual assertion."^^ . _:genid784 "ECO:MCC"^^ . _:genid785 . _:genid785 . _:genid785 . _:genid785 "GOECO:ISS"^^ . _:genid785 "inferred from sequence or structural similarity"^^ . _:genid786 . _:genid786 . _:genid786 . _:genid786 "ISS"^^ . _:genid786 "GOECO:ISS"^^ . _:genid787 . _:genid787 . _:genid787 . _:genid787 "inferred from sequence or structural similarity"^^ . _:genid787 "GOECO:ISS"^^ . . _:genid788 . _:genid789 . _:genid791 _:genid790 . _:genid789 _:genid791 . _:genid790 . _:genid790 . _:genid790 . _:genid791 . _:genid788 _:genid789 . _:genid788 . . . "IEA"^^ . "A type of similarity evidence that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-12-09T05:28:12Z"^^ . "IS"^^ . "eco"^^ . "inferred from similarity"^^ . "ECO:0000251"^^ . "similarity evidence used in automatic assertion"^^ . _:genid792 . _:genid792 . _:genid792 . _:genid792 . _:genid792 "true"^^ . _:genid793 . _:genid793 . _:genid793 . _:genid793 "A type of similarity evidence that is used in an automatic assertion."^^ . _:genid793 "ECO:RCT"^^ . . _:genid794 . _:genid795 . _:genid797 _:genid796 . _:genid795 _:genid797 . _:genid796 . _:genid796 . _:genid796 . _:genid797 . _:genid794 _:genid795 . _:genid794 . . . "A type of similarity evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-09T05:28:12Z"^^ . "IS"^^ . "eco"^^ . "inferred from similarity"^^ . "ECO:0000252"^^ . . "similarity evidence used in manual assertion"^^ . _:genid798 . _:genid798 . _:genid798 . _:genid798 . _:genid798 "true"^^ . _:genid799 . _:genid799 . _:genid799 . _:genid799 "A type of similarity evidence that is used in a manual assertion."^^ . _:genid799 "ECO:RCT"^^ . . _:genid800 . _:genid801 . _:genid803 _:genid802 . _:genid801 _:genid803 . _:genid802 . _:genid802 . _:genid802 . _:genid803 . _:genid800 _:genid801 . _:genid800 . . . "A type of genetic similarity evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-10T01:42:44Z"^^ . "IGTS"^^ . "eco"^^ . "inferred from genetic similarity"^^ . "ECO:0000253"^^ . "genetic similarity evidence used in manual assertion"^^ . _:genid804 . _:genid804 . _:genid804 . _:genid804 . _:genid804 "true"^^ . _:genid805 . _:genid805 . _:genid805 . _:genid805 "A type of genetic similarity evidence that is used in a manual assertion."^^ . _:genid805 "ECO:RCT"^^ . . _:genid806 . _:genid807 . _:genid809 _:genid808 . _:genid807 _:genid809 . _:genid808 . _:genid808 . _:genid808 . _:genid809 . _:genid806 _:genid807 . _:genid806 . . . "IEA"^^ . "A type of genetic similarity evidence that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-12-10T01:42:44Z"^^ . "IGTS"^^ . "eco"^^ . "inferred from genetic similarity"^^ . "ECO:0000254"^^ . "genetic similarity evidence used in automatic assertion"^^ . _:genid810 . _:genid810 . _:genid810 . _:genid810 . _:genid810 "true"^^ . _:genid811 . _:genid811 . _:genid811 . _:genid811 "A type of genetic similarity evidence that is used in an automatic assertion."^^ . _:genid811 "ECO:RCT"^^ . . _:genid812 . _:genid813 . _:genid815 _:genid814 . _:genid813 _:genid815 . _:genid814 . _:genid814 . _:genid814 . _:genid815 . _:genid812 _:genid813 . _:genid812 . . . "ISM"^^ . "A type of match to sequence model evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-10T02:26:35Z"^^ . "GOECO:ISM"^^ . "GO_REF:0000011"^^ . "ISM"^^ . "inferred from sequence model"^^ . "eco"^^ . "ECO:0000255"^^ . "match to sequence model evidence used in manual assertion"^^ . "http://geneontology.org/page/ism-inferred-sequence-model"^^ . _:genid816 . _:genid816 . _:genid816 . _:genid816 . _:genid816 "true"^^ . _:genid817 . _:genid817 . _:genid817 . _:genid817 "ISM"^^ . _:genid817 "Default"^^ . _:genid818 . _:genid818 . _:genid818 . _:genid818 "A type of match to sequence model evidence that is used in a manual assertion."^^ . _:genid818 "ECO:RCT"^^ . _:genid819 . _:genid819 . _:genid819 . _:genid819 "GOECO:ISM"^^ . _:genid819 "inferred from sequence model"^^ . _:genid820 . _:genid820 . _:genid820 . _:genid820 "GO_REF:0000011"^^ . _:genid820 "Hidden Markov Models (TIGR)"^^ . _:genid821 . _:genid821 . _:genid821 . _:genid821 "ISM"^^ . _:genid821 "GOECO:ISM"^^ . _:genid822 . _:genid822 . _:genid822 . _:genid822 "inferred from sequence model"^^ . _:genid822 "GOECO:ISM"^^ . . _:genid823 . _:genid824 . _:genid826 _:genid825 . _:genid824 _:genid826 . _:genid825 . _:genid825 . _:genid825 . _:genid826 . _:genid823 _:genid824 . _:genid823 . . . "IEA"^^ . "A type of match to sequence model evidence that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-12-10T02:26:35Z"^^ . "GO_REF:0000002"^^ . "eco"^^ . "ECO:0000256"^^ . "match to sequence model evidence used in automatic assertion"^^ . _:genid827 . _:genid827 . _:genid827 . _:genid827 . _:genid827 "true"^^ . _:genid828 . _:genid828 . _:genid828 . _:genid828 "A type of match to sequence model evidence that is used in an automatic assertion."^^ . _:genid828 "ECO:RCT"^^ . _:genid829 . _:genid829 . _:genid829 . _:genid829 "GO_REF:0000002"^^ . _:genid829 "Gene Ontology annotation through association of InterPro records with GO terms."^^ . . _:genid830 . _:genid831 . _:genid833 _:genid832 . _:genid831 _:genid833 . _:genid832 . _:genid832 . _:genid832 . _:genid833 . _:genid830 _:genid831 . _:genid830 . . . "ISM"^^ . "A type of motif similarity evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-10T02:44:34Z"^^ . "eco"^^ . "recognized domains"^^ . "ECO:0000257"^^ . "motif similarity evidence used in manual assertion"^^ . _:genid834 . _:genid834 . _:genid834 . _:genid834 . _:genid834 "true"^^ . _:genid835 . _:genid835 . _:genid835 . _:genid835 "A type of motif similarity evidence that is used in a manual assertion."^^ . _:genid835 "ECO:RCT"^^ . . _:genid836 . _:genid837 . _:genid839 _:genid838 . _:genid837 _:genid839 . _:genid838 . _:genid838 . _:genid838 . _:genid839 . _:genid836 _:genid837 . _:genid836 . . . "IEA"^^ . "A type of motif similarity evidence that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-12-10T02:44:34Z"^^ . "eco"^^ . "recognized domains"^^ . "ECO:0000258"^^ . "motif similarity evidence used in automatic assertion"^^ . _:genid840 . _:genid840 . _:genid840 . _:genid840 . _:genid840 "true"^^ . _:genid841 . _:genid841 . _:genid841 . _:genid841 "A type of motif similarity evidence that is used in an automatic assertion."^^ . _:genid841 "ECO:RCT"^^ . . _:genid842 . _:genid843 . _:genid845 _:genid844 . _:genid843 _:genid845 . _:genid844 . _:genid844 . _:genid844 . _:genid845 . _:genid842 _:genid843 . _:genid842 . . . "IEA"^^ . "A type of match to InterPro member signature evidence that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-12-10T02:54:51Z"^^ . "eco"^^ . "ECO:0000259"^^ . "match to InterPro member signature evidence used in automatic assertion"^^ . _:genid846 . _:genid846 . _:genid846 . _:genid846 . _:genid846 "true"^^ . _:genid847 . _:genid847 . _:genid847 . _:genid847 "A type of match to InterPro member signature evidence that is used in an automatic assertion."^^ . _:genid847 "ECO:RCT"^^ . . _:genid848 . _:genid849 . _:genid851 _:genid850 . _:genid849 _:genid851 . _:genid850 . _:genid850 . _:genid850 . _:genid851 . _:genid848 _:genid849 . _:genid848 . . . "ISM"^^ . "A type of match to InterPro member signature evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-10T02:54:51Z"^^ . "eco"^^ . "ECO:0000260"^^ . "match to InterPro member signature evidence used in manual assertion"^^ . _:genid852 . _:genid852 . _:genid852 . _:genid852 . _:genid852 "true"^^ . _:genid853 . _:genid853 . _:genid853 . _:genid853 "A type of match to InterPro member signature evidence that is used in a manual assertion."^^ . _:genid853 "ECO:RCT"^^ . . _:genid854 . _:genid855 . _:genid857 _:genid856 . _:genid855 _:genid857 . _:genid856 . _:genid856 . _:genid856 . _:genid857 . _:genid854 _:genid855 . _:genid854 . . . "IEA"^^ . "A type of targeting sequence prediction that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-12-10T03:02:49Z"^^ . "eco"^^ . "targeting sequence prediction"^^ . "ECO:0000261"^^ . "targeting sequence prediction evidence used in automatic assertion"^^ . _:genid858 . _:genid858 . _:genid858 . _:genid858 . _:genid858 "true"^^ . _:genid859 . _:genid859 . _:genid859 . _:genid859 "A type of targeting sequence prediction that is used in an automatic assertion."^^ . _:genid859 "ECO:RCT"^^ . . _:genid860 . _:genid861 . _:genid863 _:genid862 . _:genid861 _:genid863 . _:genid862 . _:genid862 . _:genid862 . _:genid863 . _:genid860 _:genid861 . _:genid860 . . . "ISM"^^ . "A type of targeting sequence prediction that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-10T03:02:49Z"^^ . "eco"^^ . "targeting sequence prediction"^^ . "ECO:0000262"^^ . "targeting sequence prediction evidence used in manual assertion"^^ . _:genid864 . _:genid864 . _:genid864 . _:genid864 . _:genid864 "true"^^ . _:genid865 . _:genid865 . _:genid865 . _:genid865 "A type of targeting sequence prediction that is used in a manual assertion."^^ . _:genid865 "ECO:RCT"^^ . . _:genid866 . _:genid867 . _:genid869 _:genid868 . _:genid867 _:genid869 . _:genid868 . _:genid868 . _:genid868 . _:genid869 . _:genid866 _:genid867 . _:genid866 . . . "IEA"^^ . "A type of transmembrane domain prediction that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-12-10T03:28:35Z"^^ . "eco"^^ . "transmembrane domain prediction"^^ . "ECO:0000263"^^ . "transmembrane domain prediction evidence used in automatic assertion"^^ . _:genid870 . _:genid870 . _:genid870 . _:genid870 . _:genid870 "true"^^ . _:genid871 . _:genid871 . _:genid871 . _:genid871 "A type of transmembrane domain prediction that is used in an automatic assertion."^^ . _:genid871 "ECO:RCT"^^ . . _:genid872 . _:genid873 . _:genid875 _:genid874 . _:genid873 _:genid875 . _:genid874 . _:genid874 . _:genid874 . _:genid875 . _:genid872 _:genid873 . _:genid872 . . . "ISM"^^ . "A type of transmembrane domain prediction that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-10T03:28:35Z"^^ . "eco"^^ . "transmembrane domain prediction"^^ . "ECO:0000264"^^ . "transmembrane domain prediction evidence used in manual assertion"^^ . _:genid876 . _:genid876 . _:genid876 . _:genid876 . _:genid876 "true"^^ . _:genid877 . _:genid877 . _:genid877 . _:genid877 "A type of transmembrane domain prediction that is used in a manual assertion."^^ . _:genid877 "ECO:RCT"^^ . . _:genid878 . _:genid879 . _:genid881 _:genid880 . _:genid879 _:genid881 . _:genid880 . _:genid880 . _:genid880 . _:genid881 . _:genid878 _:genid879 . _:genid878 . . . "IEA"^^ . "A type of sequence orthology evidence that is used in an automatic assertion."^^ . "mchibucos"^^ . "2010-12-10T03:39:41Z"^^ . "GO_REF:0000035"^^ . "eco"^^ . "Ortholog evidence"^^ . "ortholog evidence"^^ . "ECO:0000265"^^ . "sequence orthology evidence used in automatic assertion"^^ . _:genid882 . _:genid882 . _:genid882 . _:genid882 . _:genid882 "true"^^ . _:genid883 . _:genid883 . _:genid883 . _:genid883 "A type of sequence orthology evidence that is used in an automatic assertion."^^ . _:genid883 "ECO:RCT"^^ . _:genid884 . _:genid884 . _:genid884 . _:genid884 "GO_REF:0000035"^^ . _:genid884 "Automatic transfer of experimentally verified manual GO annotation data to plant orthologs using Ensembl Compara"^^ . . _:genid885 . _:genid886 . _:genid888 _:genid887 . _:genid886 _:genid888 . _:genid887 . _:genid887 . _:genid887 . _:genid888 . _:genid885 _:genid886 . _:genid885 . . . "ISO"^^ . "A type of sequence orthology evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-10T03:39:41Z"^^ . "GOECO:ISO"^^ . "ISO"^^ . "inferred from sequence orthology"^^ . "eco"^^ . "Ortholog evidence"^^ . "ortholog evidence"^^ . "ECO:0000266"^^ . . . . "sequence orthology evidence used in manual assertion"^^ . "http://geneontology.org/page/iso-inferred-sequence-orthology"^^ . _:genid889 . _:genid889 . _:genid889 . _:genid889 . _:genid889 "true"^^ . _:genid890 . _:genid890 . _:genid890 . _:genid890 "ISO"^^ . _:genid890 "Default"^^ . _:genid891 . _:genid891 . _:genid891 . _:genid891 "A type of sequence orthology evidence that is used in a manual assertion."^^ . _:genid891 "ECO:MCC"^^ . _:genid892 . _:genid892 . _:genid892 . _:genid892 "GOECO:ISO"^^ . _:genid892 "inferred from sequence orthology"^^ . _:genid893 . _:genid893 . _:genid893 . _:genid893 "ISO"^^ . _:genid893 "GOECO:ISO"^^ . _:genid894 . _:genid894 . _:genid894 . _:genid894 "inferred from sequence orthology"^^ . _:genid894 "GOECO:ISO"^^ . . . "A type of protein detection assay evidence where an antigen is bound to a substrate, and an antibody directly or indirectly linked to an enzyme is utilized to determine the amount of bound antigen which is visualized with a color change in the substrate."^^ . "CollecTF"^^ . "mchibucos"^^ . "2010-12-14T01:57:13Z"^^ . "MI:0411"^^ . "ELISA evidence"^^ . "enzyme-linked immunosorbent assay"^^ . "eco"^^ . "ECO:0000267"^^ . "ELISA is sometimes used in the study of transcriptional regulation to identify a produced protein, especially secreted protein."^^ . "enzyme-linked immunoabsorbent assay evidence"^^ . _:genid895 . _:genid895 . _:genid895 . _:genid895 "A type of protein detection assay evidence where an antigen is bound to a substrate, and an antibody directly or indirectly linked to an enzyme is utilized to determine the amount of bound antigen which is visualized with a color change in the substrate."^^ . _:genid895 "ECO:MCC"^^ . _:genid895 "ECO:SW"^^ . _:genid895 "PMID:23949770"^^ . _:genid896 . _:genid896 . _:genid896 . _:genid896 "MI:0411"^^ . _:genid896 "enzyme linked immunosorbent assay"^^ . . . _:genid897 . _:genid897 . _:genid897 . _:genid897 . _:genid898 . _:genid898 . _:genid899 . _:genid900 . _:genid902 _:genid901 . _:genid900 _:genid902 . _:genid901 . _:genid901 . _:genid903 . _:genid903 . _:genid904 . _:genid905 . _:genid907 _:genid906 . _:genid905 _:genid907 . _:genid906 . _:genid906 . _:genid906 . _:genid907 . _:genid904 _:genid905 . _:genid903 _:genid904 . _:genid901 _:genid903 . _:genid902 . _:genid899 _:genid900 . _:genid898 _:genid899 . _:genid898 . "A type of direct assay evidence in which cells or particles are characterized by passing them through a light source and monitoring the resultant light scatter or fluorochrome excitation."^^ . "mchibucos"^^ . "2010-12-14T02:07:08Z"^^ . "FCM"^^ . "eco"^^ . "ECO:0000268"^^ . "flow cytometry evidence"^^ . _:genid908 . _:genid908 . _:genid908 . _:genid908 "A type of direct assay evidence in which cells or particles are characterized by passing them through a light source and monitoring the resultant light scatter or fluorochrome excitation."^^ . _:genid908 "ECO:MCC"^^ . . _:genid909 . _:genid910 . _:genid912 _:genid911 . _:genid910 _:genid912 . _:genid911 . _:genid911 . _:genid911 . _:genid912 . _:genid909 _:genid910 . _:genid909 . . . "EXP"^^ . "A type of experimental evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T05:36:49Z"^^ . "GOECO:EXP"^^ . "EXP"^^ . "inferred from experiment"^^ . "eco"^^ . "ECO:0000269"^^ . "experimental evidence used in manual assertion"^^ . "http://geneontology.org/page/exp-inferred-experiment"^^ . _:genid913 . _:genid913 . _:genid913 . _:genid913 . _:genid913 "true"^^ . _:genid914 . _:genid914 . _:genid914 . _:genid914 "EXP"^^ . _:genid914 "Default"^^ . _:genid915 . _:genid915 . _:genid915 . _:genid915 "A type of experimental evidence that is used in a manual assertion."^^ . _:genid915 "ECO:MCC"^^ . _:genid916 . _:genid916 . _:genid916 . _:genid916 "GOECO:EXP"^^ . _:genid916 "inferred from experiment"^^ . _:genid917 . _:genid917 . _:genid917 . _:genid917 "EXP"^^ . _:genid917 "GOECO:EXP"^^ . _:genid918 . _:genid918 . _:genid918 . _:genid918 "inferred from experiment"^^ . _:genid918 "GOECO:EXP"^^ . . _:genid919 . _:genid920 . _:genid922 _:genid921 . _:genid920 _:genid922 . _:genid921 . _:genid921 . _:genid921 . _:genid922 . _:genid919 _:genid920 . _:genid919 . . . "IEP"^^ . "A type of expression pattern evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T05:46:39Z"^^ . "GOECO:IEP"^^ . "IEP"^^ . "inferred from expression pattern"^^ . "eco"^^ . "ECO:0000270"^^ . "expression pattern evidence used in manual assertion"^^ . "http://geneontology.org/page/iep-inferred-expression-pattern"^^ . _:genid923 . _:genid923 . _:genid923 . _:genid923 . _:genid923 "true"^^ . _:genid924 . _:genid924 . _:genid924 . _:genid924 "IEP"^^ . _:genid924 "Default"^^ . _:genid925 . _:genid925 . _:genid925 . _:genid925 "A type of expression pattern evidence that is used in a manual assertion."^^ . _:genid925 "ECO:MCC"^^ . _:genid926 . _:genid926 . _:genid926 . _:genid926 "GOECO:IEP"^^ . _:genid926 "inferred from expression pattern"^^ . _:genid927 . _:genid927 . _:genid927 . _:genid927 "IEP"^^ . _:genid927 "GOECO:IEP"^^ . _:genid928 . _:genid928 . _:genid928 . _:genid928 "inferred from expression pattern"^^ . _:genid928 "GOECO:IEP"^^ . . "mchibucos"^^ . "2010-12-20T05:51:58Z"^^ . "eco"^^ . "ECO:0000271"^^ . "This general 'array experiment' term should not be used - replace with the specific type of array (e.g. ECO:0000273, ECO:0000276, ECO:0000285, etc.)"^^ . "array experiment evidence used in manual assertion"^^ . "true"^^ . . _:genid929 . _:genid930 . _:genid932 _:genid931 . _:genid930 _:genid932 . _:genid931 . _:genid931 . _:genid931 . _:genid932 . _:genid929 _:genid930 . _:genid929 . . . "IEP"^^ . "A type of Affymetrix GeneChip evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T05:53:36Z"^^ . "Affymetrix array experiment evidence"^^ . "eco"^^ . "ECO:0000272"^^ . "Affymetrix GeneChip evidence used in manual assertion"^^ . _:genid933 . _:genid933 . _:genid933 . _:genid933 . _:genid933 "true"^^ . _:genid934 . _:genid934 . _:genid934 . _:genid934 "A type of Affymetrix GeneChip evidence that is used in a manual assertion."^^ . _:genid934 "ECO:MCC"^^ . . _:genid935 . _:genid936 . _:genid938 _:genid937 . _:genid936 _:genid938 . _:genid937 . _:genid937 . _:genid937 . _:genid938 . _:genid935 _:genid936 . _:genid935 . . . "IEP"^^ . "A type of cDNA to DNA expression microarray evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T05:55:49Z"^^ . "ECO:0001178"^^ . "ECO:0005525"^^ . "eco"^^ . "DNA microarray|RNA microarray"^^ . "ECO:0000273"^^ . "cDNA to DNA expression microarray evidence used in manual assertion"^^ . _:genid939 . _:genid939 . _:genid939 . _:genid939 . _:genid939 "true"^^ . _:genid940 . _:genid940 . _:genid940 . _:genid940 "A type of cDNA to DNA expression microarray evidence that is used in a manual assertion."^^ . _:genid940 "ECO:MCC"^^ . . _:genid941 . _:genid942 . _:genid944 _:genid943 . _:genid942 _:genid944 . _:genid943 . _:genid943 . _:genid943 . _:genid944 . _:genid941 _:genid942 . _:genid941 . . . "IDA"^^ . "A type of differential methylation hybridization evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T05:58:44Z"^^ . "CpG island microarray evidence"^^ . "CpG island microarray evidence used in manual assertion"^^ . "eco"^^ . "ECO:0000274"^^ . "differential methylation hybridization evidence used in manual assertion"^^ . _:genid945 . _:genid945 . _:genid945 . _:genid945 . _:genid945 "true"^^ . _:genid946 . _:genid946 . _:genid946 . _:genid946 "A type of differential methylation hybridization evidence that is used in a manual assertion."^^ . _:genid946 "ECO:RCT"^^ . . _:genid947 . _:genid948 . _:genid950 _:genid949 . _:genid948 _:genid950 . _:genid949 . _:genid949 . _:genid949 . _:genid950 . _:genid947 _:genid948 . _:genid947 . . . "IEP"^^ . "A type of expression microarray evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T06:01:26Z"^^ . "eco"^^ . "differential gene expression evidence from microarray experiment"^^ . "ECO:0000275"^^ . "expression microarray evidence used in manual assertion"^^ . _:genid951 . _:genid951 . _:genid951 . _:genid951 . _:genid951 "true"^^ . _:genid952 . _:genid952 . _:genid952 . _:genid952 "A type of expression microarray evidence that is used in a manual assertion."^^ . _:genid952 "ECO:MCC"^^ . . _:genid953 . _:genid954 . _:genid956 _:genid955 . _:genid954 _:genid956 . _:genid955 . _:genid955 . _:genid955 . _:genid956 . _:genid953 _:genid954 . _:genid953 . . . "IEP"^^ . "A type of cRNA to DNA expression microarray evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T06:03:28Z"^^ . "genomic microarray evidence"^^ . "genomic microarray evidence used in manual assertion"^^ . "eco"^^ . "ECO:0000276"^^ . "cRNA to DNA expression microarray evidence used in manual assertion"^^ . _:genid957 . _:genid957 . _:genid957 . _:genid957 . _:genid957 "true"^^ . _:genid958 . _:genid958 . _:genid958 . _:genid958 "A type of cRNA to DNA expression microarray evidence that is used in a manual assertion."^^ . _:genid958 "ECO:RCT"^^ . . _:genid959 . _:genid960 . _:genid962 _:genid961 . _:genid960 _:genid962 . _:genid961 . _:genid961 . _:genid961 . _:genid962 . _:genid959 _:genid960 . _:genid959 . . . "IEP"^^ . "A type of evidence arising from a Nimblegen array experiment that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T06:05:20Z"^^ . "eco"^^ . "ECO:0000277"^^ . "Nimblegen array evidence used in manual assertion"^^ . _:genid963 . _:genid963 . _:genid963 . _:genid963 . _:genid963 "true"^^ . _:genid964 . _:genid964 . _:genid964 . _:genid964 "A type of evidence arising from a Nimblegen array experiment that is used in a manual assertion."^^ . _:genid964 "ECO:MCC"^^ . . _:genid965 . _:genid966 . _:genid968 _:genid967 . _:genid966 _:genid968 . _:genid967 . _:genid967 . _:genid967 . _:genid968 . _:genid965 _:genid966 . _:genid965 . . . "EXP"^^ . "A type of array-based sequence capture evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T06:09:45Z"^^ . "DNA microarray"^^ . "oligonucleotide microarray evidence"^^ . "oligonucleotide microarray evidence used in manual assertion"^^ . "eco"^^ . "SNP array evidence"^^ . "single nucleotide polymorphism array evidence"^^ . "ECO:0000278"^^ . "array-based sequence capture evidence used in manual assertion"^^ . _:genid969 . _:genid969 . _:genid969 . _:genid969 . _:genid969 "true"^^ . _:genid970 . _:genid970 . _:genid970 . _:genid970 "A type of array-based sequence capture evidence that is used in a manual assertion."^^ . _:genid970 "ECO:MCC"^^ . . _:genid971 . _:genid972 . _:genid974 _:genid973 . _:genid972 _:genid974 . _:genid973 . _:genid973 . _:genid973 . _:genid974 . _:genid971 _:genid972 . _:genid971 . . . . "IEP"^^ . "A type of qualitative western immunoblotting evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T06:20:01Z"^^ . "ECO:0007183"^^ . "protein expression level evidence based on western blot used in manual assertion"^^ . "eco"^^ . "Western blot expression analysis"^^ . "protein immunoblot"^^ . "protein levels (e.g. Western blots)"^^ . "ECO:0000279"^^ . "qualitative western immunoblotting evidence used in manual assertion"^^ . _:genid975 . _:genid975 . _:genid975 . _:genid975 . _:genid975 "true"^^ . _:genid976 . _:genid976 . _:genid976 . _:genid976 . _:genid976 "true"^^ . _:genid977 . _:genid977 . _:genid977 . _:genid977 "A type of qualitative western immunoblotting evidence that is used in a manual assertion."^^ . _:genid977 "ECO:MCC"^^ . . _:genid978 . _:genid979 . _:genid981 _:genid980 . _:genid979 _:genid981 . _:genid980 . _:genid980 . _:genid980 . _:genid981 . _:genid978 _:genid979 . _:genid978 . . . "IEP"^^ . "A type of expression library screen evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T06:24:05Z"^^ . "eco"^^ . "expression library screening"^^ . "ECO:0000281"^^ . "expression library screen evidence used in manual assertion"^^ . _:genid982 . _:genid982 . _:genid982 . _:genid982 . _:genid982 "true"^^ . _:genid983 . _:genid983 . _:genid983 . _:genid983 "A type of expression library screen evidence that is used in a manual assertion."^^ . _:genid983 "ECO:MCC"^^ . . _:genid984 . _:genid985 . _:genid987 _:genid986 . _:genid985 _:genid987 . _:genid986 . _:genid986 . _:genid986 . _:genid987 . _:genid984 _:genid985 . _:genid984 . . . "IEP"^^ . "A type of heterologous protein expression analysis that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T06:27:04Z"^^ . "eco"^^ . "protein expression in heterologous system"^^ . "ECO:0000282"^^ . "heterologous protein expression evidence used in manual assertion"^^ . _:genid988 . _:genid988 . _:genid988 . _:genid988 . _:genid988 "true"^^ . _:genid989 . _:genid989 . _:genid989 . _:genid989 "A type of heterologous protein expression analysis that is used in a manual assertion."^^ . _:genid989 "ECO:MCC"^^ . . _:genid990 . _:genid991 . _:genid993 _:genid992 . _:genid991 _:genid993 . _:genid992 . _:genid992 . _:genid992 . _:genid993 . _:genid990 _:genid991 . _:genid990 . . . "IEP"^^ . "A type of protein expression spatial pattern analysis that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T06:31:44Z"^^ . "eco"^^ . "ECO:0000283"^^ . "spatial pattern of protein expression evidence used in manual assertion"^^ . _:genid994 . _:genid994 . _:genid994 . _:genid994 . _:genid994 "true"^^ . _:genid995 . _:genid995 . _:genid995 . _:genid995 "A type of protein expression spatial pattern analysis that is used in a manual assertion."^^ . _:genid995 "ECO:MCC"^^ . . _:genid996 . _:genid997 . _:genid999 _:genid998 . _:genid997 _:genid999 . _:genid998 . _:genid998 . _:genid998 . _:genid999 . _:genid996 _:genid997 . _:genid996 . . . "IEP"^^ . "A type of protein expression analysis that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T06:33:46Z"^^ . "ECO:0000280"^^ . "protein expression level evidence used in manual assertion"^^ . "eco"^^ . "ECO:0000284"^^ . "protein expression evidence used in manual assertion"^^ . _:genid1000 . _:genid1000 . _:genid1000 . _:genid1000 . _:genid1000 "true"^^ . _:genid1001 . _:genid1001 . _:genid1001 . _:genid1001 "A type of protein expression analysis that is used in a manual assertion."^^ . _:genid1001 "ECO:MCC"^^ . . _:genid1002 . _:genid1003 . _:genid1005 _:genid1004 . _:genid1003 _:genid1005 . _:genid1004 . _:genid1004 . _:genid1004 . _:genid1005 . _:genid1002 _:genid1003 . _:genid1002 . . . "IEP"^^ . "A type of DNA to cDNA expression microarray evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T06:41:33Z"^^ . "REM evidence"^^ . "RNA expression microarray evidence"^^ . "microarray RNA expression level evidence"^^ . "eco"^^ . "transcript levels (e.g. microarray data)"^^ . "ECO:0000285"^^ . "DNA to cDNA expression microarray evidence used in manual assertion"^^ . _:genid1006 . _:genid1006 . _:genid1006 . _:genid1006 . _:genid1006 "true"^^ . _:genid1007 . _:genid1007 . _:genid1007 . _:genid1007 "A type of DNA to cDNA expression microarray evidence that is used in a manual assertion."^^ . _:genid1007 "ECO:MCC"^^ . . _:genid1008 . _:genid1009 . _:genid1011 _:genid1010 . _:genid1009 _:genid1011 . _:genid1010 . _:genid1010 . _:genid1010 . _:genid1011 . _:genid1008 _:genid1009 . _:genid1008 . . . "IEP"^^ . "A type of differential hybridization experiment that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T06:55:14Z"^^ . "eco"^^ . "differential hybridization"^^ . "ECO:0000287"^^ . "differential hybridization evidence used in manual assertion"^^ . _:genid1012 . _:genid1012 . _:genid1012 . _:genid1012 . _:genid1012 "true"^^ . _:genid1013 . _:genid1013 . _:genid1013 . _:genid1013 "A type of differential hybridization experiment that is used in a manual assertion."^^ . _:genid1013 "ECO:MCC"^^ . . _:genid1014 . _:genid1015 . _:genid1017 _:genid1016 . _:genid1015 _:genid1017 . _:genid1016 . _:genid1016 . _:genid1016 . _:genid1017 . _:genid1014 _:genid1015 . _:genid1014 . . . "EXP"^^ . "A type of RNA protection assay that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T06:57:33Z"^^ . "ribonuclease protection assay"^^ . "eco"^^ . "RNA protection assay|RPA"^^ . "RNAse protection assay"^^ . "ECO:0000288"^^ . "RNA protection assay evidence used in manual assertion"^^ . _:genid1018 . _:genid1018 . _:genid1018 . _:genid1018 . _:genid1018 "true"^^ . _:genid1019 . _:genid1019 . _:genid1019 . _:genid1019 "A type of RNA protection assay that is used in a manual assertion."^^ . _:genid1019 "ECO:MCC"^^ . . _:genid1020 . _:genid1021 . _:genid1023 _:genid1022 . _:genid1021 _:genid1023 . _:genid1022 . _:genid1022 . _:genid1022 . _:genid1023 . _:genid1020 _:genid1021 . _:genid1020 . . . "IEP"^^ . "A type of spatial pattern of transcript expression analysis that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T06:59:18Z"^^ . "eco"^^ . "ECO:0000289"^^ . "spatial pattern of transcript expression evidence used in manual assertion"^^ . _:genid1024 . _:genid1024 . _:genid1024 . _:genid1024 . _:genid1024 "true"^^ . _:genid1025 . _:genid1025 . _:genid1025 . _:genid1025 "A type of spatial pattern of transcript expression analysis that is used in a manual assertion."^^ . _:genid1025 "ECO:MCC"^^ . . _:genid1026 . _:genid1027 . _:genid1029 _:genid1028 . _:genid1027 _:genid1029 . _:genid1028 . _:genid1028 . _:genid1028 . _:genid1029 . _:genid1026 _:genid1027 . _:genid1026 . . . "IEP"^^ . "A type of subtractive hybridization experiment that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T07:00:48Z"^^ . "eco"^^ . "subtractive hybridization"^^ . "ECO:0000290"^^ . "subtractive hybridization evidence used in manual assertion"^^ . _:genid1030 . _:genid1030 . _:genid1030 . _:genid1030 . _:genid1030 "true"^^ . _:genid1031 . _:genid1031 . _:genid1031 . _:genid1031 "A type of subtractive hybridization experiment that is used in a manual assertion."^^ . _:genid1031 "ECO:MCC"^^ . . _:genid1032 . _:genid1033 . _:genid1035 _:genid1034 . _:genid1033 _:genid1035 . _:genid1034 . _:genid1034 . _:genid1034 . _:genid1035 . _:genid1032 _:genid1033 . _:genid1032 . . . "IEP"^^ . "A type of transcript expression evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2010-12-20T07:02:08Z"^^ . "ECO:0000286"^^ . "transcript expression level evidence"^^ . "transcriptomics evidence used in manual assertion"^^ . "eco"^^ . "ECO:0000291"^^ . "transcript expression evidence used in manual assertion"^^ . _:genid1036 . _:genid1036 . _:genid1036 . _:genid1036 . _:genid1036 "true"^^ . _:genid1037 . _:genid1037 . _:genid1037 . _:genid1037 "A type of transcript expression evidence that is used in a manual assertion."^^ . _:genid1037 "ECO:MCC"^^ . . . "A type of mutant phenotype evidence that uses anti-sense by introducing morpholino oligonucleotides into the cytosol of a cell."^^ . "mchibucos"^^ . "2011-01-10T03:36:25Z"^^ . "anti-sense"^^ . "eco"^^ . "ECO:0000292"^^ . "Morpholino oligonucleotides modify gene expression by blocking access of other molecules to specific, approximately 25-base-long regions of the base-pairing surfaces of ribonucleic acid (RNA). To achieve this anti-sense knockdown technique, delivery of the morpholino can be achieved via microinjection, electroporation, or another method."^^ . "morpholino experiment evidence"^^ . _:genid1038 . _:genid1038 . _:genid1038 . _:genid1038 "A type of mutant phenotype evidence that uses anti-sense by introducing morpholino oligonucleotides into the cytosol of a cell."^^ . _:genid1038 "ECO:MCC"^^ . . . "A total of 160 SELEX fragments were cloned and sequenced, which were classified into 29 CRP-binding sequences, including 13 previously identified loci and 16 newly identified sites (Table S2). When the CRP-binding sequences are located upstream or near promoters of the flanking genes, these genes are predicted to be under the control of CRP."^^ . "A type of evidence arising from a physical interaction analysis where a combinatorial chemistry technique is used to identify oligonucleotides that bind to a target ligand."^^ . "mchibucos"^^ . "2011-01-10T04:23:50Z"^^ . "MI:0657"^^ . "SELEX evidence"^^ . "in vitro selection evidence"^^ . "eco"^^ . "in vitro evolution evidence"^^ . "ECO:0000293"^^ . "SELEX begins with the synthesis of a large oligonucleotide library, either single-stranded DNA or RNA, which consists of random fixed-length sequences flanked by constant 5' and 3' ends that serve as primers. The library is exposed to a target ligand, typically a protein or small organic compound. Unbound sequences are removed, typically with affinity chromatography. Bound sequences are eluted and the nucleic acid is extracted, followed by PCR amplification (RNA is first reverse transcribed). PCR product is converted to single stranded (DNA) or transcribed (RNA). Oligonucleotides are bound to the ligand again and the process is repeated with increasing elution stringency. After several rounds of the process, recovered oligonucleotides are sequenced and analyzed to reveal the binding specificity of the protein."^^ . "systematic evolution of ligands by exponential amplification evidence"^^ . _:genid1039 . _:genid1039 . _:genid1039 . _:genid1039 "A total of 160 SELEX fragments were cloned and sequenced, which were classified into 29 CRP-binding sequences, including 13 previously identified loci and 16 newly identified sites (Table S2). When the CRP-binding sequences are located upstream or near promoters of the flanking genes, these genes are predicted to be under the control of CRP."^^ . _:genid1039 "PMID:21673794"^^ . _:genid1040 . _:genid1040 . _:genid1040 . _:genid1040 "A type of evidence arising from a physical interaction analysis where a combinatorial chemistry technique is used to identify oligonucleotides that bind to a target ligand."^^ . _:genid1040 "ECO:MCC"^^ . _:genid1040 "url:http://en.wikipedia.org/wiki/Systematic_Evolution_of_Ligands_by_Exponential_Enrichment"^^ . _:genid1041 . _:genid1041 . _:genid1041 . _:genid1041 "MI:0657"^^ . _:genid1041 "systematic evolution of ligands by exponential enrichment"^^ . . . _:genid1042 . _:genid1042 . _:genid1042 . _:genid1042 . _:genid1043 . _:genid1043 . _:genid1043 . _:genid1043 . "Bacterial one-hybrid assays confirmed the interaction between MtrA and the regulatory sequence of the dnaA initiator gene."^^ . "A type of bait-prey hybrid interaction evidence that uses bacterial transformation with two plasmids to assess in vivo binding of a DNA-binding domain (bait) and DNA target site (prey)."^^ . "mchibucos"^^ . "2011-01-10T06:16:20Z"^^ . "B1H evidence"^^ . "eco"^^ . "ECO:0000294"^^ . "Bacterial one-hybrid assay is a method for screening a library of candidate proteins (prey plasmid) for the ability to bind to a target, cis-regulatory element or any other short, DNA binding sequence placed 5' to reporter genes (bait plasmid). Transformation of a bacterial host with two different plasmids is required: One is designed to express the \"bait\". The other plasmid contains a \"prey\" which, if bound to by the chimeric fusion product, drives expression of downstream reporter genes."^^ . "bacterial one-hybrid evidence"^^ . _:genid1044 . _:genid1044 . _:genid1044 . _:genid1044 "Bacterial one-hybrid assays confirmed the interaction between MtrA and the regulatory sequence of the dnaA initiator gene."^^ . _:genid1044 "PMID:20843371"^^ . _:genid1045 . _:genid1045 . _:genid1045 . _:genid1045 "A type of bait-prey hybrid interaction evidence that uses bacterial transformation with two plasmids to assess in vivo binding of a DNA-binding domain (bait) and DNA target site (prey)."^^ . _:genid1045 "ECO:MCC"^^ . . . _:genid1046 . _:genid1046 . _:genid1046 . _:genid1046 . _:genid1047 . _:genid1047 . _:genid1048 . _:genid1049 . _:genid1051 _:genid1050 . _:genid1049 _:genid1051 . _:genid1050 . _:genid1050 . _:genid1052 . _:genid1052 . _:genid1052 . _:genid1050 _:genid1052 . _:genid1051 . _:genid1048 _:genid1049 . _:genid1047 _:genid1048 . _:genid1047 . "A type of transcript evidence based on high-throughput (HT) sequencing of fragmented cDNA molecules."^^ . "mchibucos"^^ . "2011-01-11T12:54:50Z"^^ . "ECO:0000357"^^ . "RNA-seq evidence"^^ . "RNAseq evidence"^^ . "WTSS"^^ . "whole transcriptome shotgun sequencing"^^ . "differential gene expression evidence from RNA-seq experiment"^^ . "eco"^^ . "RNA sequencing"^^ . "ECO:0000295"^^ . "Total RNA is isolated from cells and mRNA is purified by targeting the 3' polyadenylated (poly(A)) tail with poly(T) oligos covalently attached to a substrate. Next, cDNA fragments are generated either by hydrolysis of RNA into 200-300 base oligonucleotides, preceded by reverse transcription, or by reverse transcription initiated by random primers. The cDNA second strand is synthesized, fragments are adapter ligated and high-throughput sequencing is performed by Roche 454, Illumina, ABI-SOLiD, or another HT sequencing technology. Resulting sort reads are aligned against a reference genome, and downstream analysis is performed."^^ . "RNA-sequencing evidence"^^ . _:genid1053 . _:genid1053 . _:genid1053 . _:genid1053 "A type of transcript evidence based on high-throughput (HT) sequencing of fragmented cDNA molecules."^^ . _:genid1053 "ECO:MCC"^^ . _:genid1054 . _:genid1054 . _:genid1054 . _:genid1054 "whole transcriptome shotgun sequencing"^^ . _:genid1054 "PMID:18611170"^^ . . . "A type of experimental phenotypic evidence where embryonic development proceeds although cytokinesis is blocked."^^ . "mchibucos"^^ . "2011-01-11T03:28:49Z"^^ . "eco"^^ . "ECO:0000298"^^ . "In the embryos of some organisms, inhibition of cytokinesis blocks neither the cell cycle nor the unfolding of the developmental program. As such, embryonic morphology can be frozen, allowing analysis of the developmental fate of each cell present at the time of cleavage arrest."^^ . "cleavage arrested development evidence"^^ . _:genid1055 . _:genid1055 . _:genid1055 . _:genid1055 "A type of experimental phenotypic evidence where embryonic development proceeds although cytokinesis is blocked."^^ . _:genid1055 "ECO:MCC"^^ . . . _:genid1056 . _:genid1056 . _:genid1056 . _:genid1056 . _:genid1057 . _:genid1057 . _:genid1057 . _:genid1057 . _:genid1058 . _:genid1058 . _:genid1059 . _:genid1060 . _:genid1062 _:genid1061 . _:genid1060 _:genid1062 . _:genid1061 . _:genid1061 . _:genid1061 . _:genid1062 . _:genid1059 _:genid1060 . _:genid1058 _:genid1059 . _:genid1058 . _:genid1063 . _:genid1063 . _:genid1064 . _:genid1065 . _:genid1067 _:genid1066 . _:genid1065 _:genid1067 . _:genid1066 . _:genid1066 . _:genid1068 . _:genid1068 . _:genid1068 . _:genid1066 _:genid1068 . _:genid1067 . _:genid1064 _:genid1065 . _:genid1063 _:genid1064 . _:genid1063 . "A type of cleavage arrested development that arises after treatment with cytochalasin."^^ . "mchibucos"^^ . "2011-01-11T03:30:29Z"^^ . "eco"^^ . "ECO:0000299"^^ . "Cytochalasin inhibits cytokinesis by blocking the formation of contractile microfilaments."^^ . "cytochalasin experiment evidence"^^ . _:genid1069 . _:genid1069 . _:genid1069 . _:genid1069 "A type of cleavage arrested development that arises after treatment with cytochalasin."^^ . _:genid1069 "ECO:MCC"^^ . . . "A type of immunolocalization evidence data that was generated using green fluorescent protein (GFP) as a marker."^^ . "mchibucos"^^ . "2011-01-11T03:48:50Z"^^ . "GFP immunolocalization evidence"^^ . "eco"^^ . "ECO:0000300"^^ . "This term describes immunolocalization of the protein; to describe transcriptional activation, use the term \"localization of green fluorescent protein transcript\"."^^ . "green fluorescent protein immunolocalization evidence"^^ . _:genid1070 . _:genid1070 . _:genid1070 . _:genid1070 "A type of immunolocalization evidence data that was generated using green fluorescent protein (GFP) as a marker."^^ . _:genid1070 "ECO:MCC"^^ . . . "A type of immunolocalization evidence that was generated using LacZ protein as a marker."^^ . "mchibucos"^^ . "2011-01-11T04:06:40Z"^^ . "LacZ protein immunolocalization evidence"^^ . "eco"^^ . "ECO:0000301"^^ . "This term describes immunolocalization of the protein; to describe transcriptional activation, use the term \"localization of LacZ transcript\"."^^ . "beta-galactosidase protein immunolocalization evidence"^^ . _:genid1071 . _:genid1071 . _:genid1071 . _:genid1071 "A type of immunolocalization evidence that was generated using LacZ protein as a marker."^^ . _:genid1071 "ECO:MCC"^^ . . _:genid1072 . _:genid1073 . _:genid1075 _:genid1074 . _:genid1073 _:genid1075 . _:genid1074 . _:genid1074 . _:genid1074 . _:genid1075 . _:genid1072 _:genid1073 . _:genid1072 . . . "A type of author statement that is used in a manual assertion."^^ . "mchibucos"^^ . "2011-01-20T02:26:47Z"^^ . "ECO:0007764" . "author inference used in manual assertion" . "eco"^^ . "ECO:0000302"^^ . "author statement used in manual assertion"^^ . _:genid1076 . _:genid1076 . _:genid1076 . _:genid1076 . _:genid1076 "true"^^ . _:genid1077 . _:genid1077 . _:genid1077 . _:genid1077 "A type of author statement that is used in a manual assertion."^^ . _:genid1077 "ECO:MCC"^^ . . _:genid1078 . _:genid1079 . _:genid1081 _:genid1080 . _:genid1079 _:genid1081 . _:genid1080 . _:genid1080 . _:genid1080 . _:genid1081 . _:genid1078 _:genid1079 . _:genid1078 . . . "NAS"^^ . "A type of author statement without traceable support that is used in a manual assertion."^^ . "mchibucos"^^ . "2011-01-20T02:29:50Z"^^ . "GOECO:NAS"^^ . "NAS"^^ . "eco"^^ . "non-traceable author statement"^^ . "ECO:0000303"^^ . "author statement without traceable support used in manual assertion"^^ . "http://geneontology.org/page/nas-non-traceable-author-statement"^^ . _:genid1082 . _:genid1082 . _:genid1082 . _:genid1082 . _:genid1082 "true"^^ . _:genid1083 . _:genid1083 . _:genid1083 . _:genid1083 "NAS"^^ . _:genid1083 "Default"^^ . _:genid1084 . _:genid1084 . _:genid1084 . _:genid1084 "A type of author statement without traceable support that is used in a manual assertion."^^ . _:genid1084 "ECO:MCC"^^ . _:genid1085 . _:genid1085 . _:genid1085 . _:genid1085 "GOECO:NAS"^^ . _:genid1085 "non-traceable author statement"^^ . _:genid1086 . _:genid1086 . _:genid1086 . _:genid1086 "NAS"^^ . _:genid1086 "GOECO:NAS"^^ . _:genid1087 . _:genid1087 . _:genid1087 . _:genid1087 "non-traceable author statement"^^ . _:genid1087 "GOECO:NAS"^^ . . _:genid1088 . _:genid1089 . _:genid1091 _:genid1090 . _:genid1089 _:genid1091 . _:genid1090 . _:genid1090 . _:genid1090 . _:genid1091 . _:genid1088 _:genid1089 . _:genid1088 . . . "TAS"^^ . "A type of author statement supported by traceable reference that is used in a manual assertion."^^ . "mchibucos"^^ . "2011-01-20T02:31:03Z"^^ . "GOECO:TAS"^^ . "TAS"^^ . "eco"^^ . "traceable author statement"^^ . "ECO:0000304"^^ . "author statement supported by traceable reference used in manual assertion"^^ . "http://geneontology.org/page/tas-traceable-author-statement"^^ . _:genid1092 . _:genid1092 . _:genid1092 . _:genid1092 . _:genid1092 "true"^^ . _:genid1093 . _:genid1093 . _:genid1093 . _:genid1093 "TAS"^^ . _:genid1093 "Default"^^ . _:genid1094 . _:genid1094 . _:genid1094 . _:genid1094 "A type of author statement supported by traceable reference that is used in a manual assertion."^^ . _:genid1094 "ECO:MCC"^^ . _:genid1095 . _:genid1095 . _:genid1095 . _:genid1095 "GOECO:TAS"^^ . _:genid1095 "traceable author statement"^^ . _:genid1096 . _:genid1096 . _:genid1096 . _:genid1096 "TAS"^^ . _:genid1096 "GOECO:TAS"^^ . _:genid1097 . _:genid1097 . _:genid1097 . _:genid1097 "traceable author statement"^^ . _:genid1097 "GOECO:TAS"^^ . . _:genid1098 . _:genid1099 . _:genid1101 _:genid1100 . _:genid1099 _:genid1101 . _:genid1100 . _:genid1100 . _:genid1100 . _:genid1101 . _:genid1098 _:genid1099 . _:genid1098 . . . "IC"^^ . "A type of curator inference that is used in a manual assertion."^^ . "mchibucos"^^ . "2011-01-20T02:33:32Z"^^ . "GOECO:IC"^^ . "IC"^^ . "inferred by curator"^^ . "eco"^^ . "ECO:0000305"^^ . . . . "curator inference used in manual assertion"^^ . "http://geneontology.org/page/ic-inferred-curator"^^ . _:genid1102 . _:genid1102 . _:genid1102 . _:genid1102 . _:genid1102 "true"^^ . _:genid1103 . _:genid1103 . _:genid1103 . _:genid1103 "IC"^^ . _:genid1103 "Default"^^ . _:genid1104 . _:genid1104 . _:genid1104 . _:genid1104 "A type of curator inference that is used in a manual assertion."^^ . _:genid1104 "ECO:MCC"^^ . _:genid1105 . _:genid1105 . _:genid1105 . _:genid1105 "GOECO:IC"^^ . _:genid1105 "inferred by curator"^^ . _:genid1106 . _:genid1106 . _:genid1106 . _:genid1106 "IC"^^ . _:genid1106 "GOECO:IC"^^ . _:genid1107 . _:genid1107 . _:genid1107 . _:genid1107 "inferred by curator"^^ . _:genid1107 "GOECO:IC"^^ . . _:genid1108 . _:genid1109 . _:genid1111 _:genid1110 . _:genid1109 _:genid1111 . _:genid1110 . _:genid1110 . _:genid1110 . _:genid1111 . _:genid1108 _:genid1109 . _:genid1108 . . . "IC"^^ . "A type of inference from background scientific knowledge that is used in a manual assertion."^^ . "mchibucos"^^ . "2011-01-20T02:35:11Z"^^ . "eco"^^ . "ECO:0000306"^^ . "inference from background scientific knowledge used in manual assertion"^^ . _:genid1112 . _:genid1112 . _:genid1112 . _:genid1112 . _:genid1112 "true"^^ . _:genid1113 . _:genid1113 . _:genid1113 . _:genid1113 "A type of inference from background scientific knowledge that is used in a manual assertion."^^ . _:genid1113 "ECO:MCC"^^ . . _:genid1114 . _:genid1115 . _:genid1117 _:genid1116 . _:genid1115 _:genid1117 . _:genid1116 . _:genid1116 . _:genid1116 . _:genid1117 . _:genid1114 _:genid1115 . _:genid1114 . . . "ND"^^ . "An inference that results when research finds no evidence information in the scientific literature, at reference databases, or from other resources that is used in an manual assertion."^^ . "mchibucos"^^ . "2011-01-20T02:43:18Z"^^ . "GOECO:ND"^^ . "ND"^^ . "no biological data available"^^ . "eco"^^ . "ECO:0000307"^^ . "no evidence data found used in manual assertion"^^ . "http://geneontology.org/page/nd-no-biological-data-available"^^ . _:genid1118 . _:genid1118 . _:genid1118 . _:genid1118 . _:genid1118 "true"^^ . _:genid1119 . _:genid1119 . _:genid1119 . _:genid1119 "ND"^^ . _:genid1119 "Default"^^ . _:genid1120 . _:genid1120 . _:genid1120 . _:genid1120 "An inference that results when research finds no evidence information in the scientific literature, at reference databases, or from other resources that is used in an manual assertion."^^ . _:genid1120 "ECO:MCC"^^ . _:genid1121 . _:genid1121 . _:genid1121 . _:genid1121 "GOECO:ND"^^ . _:genid1121 "no biological data available"^^ . _:genid1122 . _:genid1122 . _:genid1122 . _:genid1122 "ND"^^ . _:genid1122 "GOECO:ND"^^ . _:genid1123 . _:genid1123 . _:genid1123 . _:genid1123 "no biological data available"^^ . _:genid1123 "GOECO:ND"^^ . . . "A type of phylogenetic evidence whereby an aspect of a descendant gene is inferred through the characterization of an aspect of an ancestral gene."^^ . "mchibucos"^^ . "2011-02-04T05:41:26Z"^^ . "eco"^^ . "ECO:0000308"^^ . "First, a characteristic of the most recent common ancestor (MRCA) is inferred from experimental evidence in descendants; this is followed by inferring a characteristic of a descendant of the MRCA. This type of evidence can be used in support of both positive and \"not\" GO annotations."^^ . "biological aspect of ancestor evidence"^^ . _:genid1124 . _:genid1124 . _:genid1124 . _:genid1124 "A type of phylogenetic evidence whereby an aspect of a descendant gene is inferred through the characterization of an aspect of an ancestral gene."^^ . _:genid1124 "ECO:MCC"^^ . . . _:genid1125 . _:genid1125 . _:genid1125 . _:genid1125 . "A type of transcript expression evidence based on high-throughput (HT) sequencing of the 5' ends of cDNA molecules that are selected by a cap-trapper system."^^ . "mchibucos"^^ . "2011-02-17T01:33:09Z"^^ . "CAGE"^^ . "eco"^^ . "ECO:0000309"^^ . "Complementary DNA (cDNA) is synthesized from microgram quantities of mRNA using first-strand cDNA primer (oligo dT12-18) and reverse transcriptase in the presence of trehalose and sorbitol, followed by selection of full-length cDNA with biotinylated cap-trapper. Linkers are attached to the 5' ends of full-length enriched cDNAs to introduce a recognition site for the restriction endonuclease MmeI, which creates a two base overhang. After amplification, sequencing tags are concatenated for high-throughput sequencing. Resulting sort reads are aligned against a reference genome, and downstream analysis is performed."^^ . "cap analysis of gene expression evidence"^^ . _:genid1126 . _:genid1126 . _:genid1126 . _:genid1126 "A type of transcript expression evidence based on high-throughput (HT) sequencing of the 5' ends of cDNA molecules that are selected by a cap-trapper system."^^ . _:genid1126 "ECO:MCC"^^ . _:genid1127 . _:genid1127 . _:genid1127 . _:genid1127 "CAGE"^^ . _:genid1127 "PMID:16489339"^^ . . . _:genid1128 . _:genid1128 . _:genid1128 . _:genid1128 . "A type of transcript expression evidence based on high-throughput (HT) sequencing of the 5' ends of cDNA molecules that are selected by reverse transcriptase template switching."^^ . "mchibucos"^^ . "2011-02-17T01:33:34Z"^^ . "eco"^^ . "nanoCAGE"^^ . "ECO:0000310"^^ . "NanoCAGE captures the 5' ends of molecules by template switching. When polymerizing the cDNA of a capped mRNA, the reverse transcriptase adds extra cytosines that are complementary to the cap. Each 5' full length cDNAs is extended upon hybridization of the riboguanosine-tailed template switching oligonucleotides to these extra cytosines. In semisuppressive PCR, the short templates fold intramolecularly and prevent the binding of primers, which precludes amplification; longer molecules are less likely to fold and are thus amplified. Templates derived from reaction artifacts form stable homoduplexes, also precluding amplification. After template switching, semisuppressive PCR, and EcoP151 cleavage, 25-bp tags are ligated to bar code-containing oligonucleotide adaptors. After PCR amplification, the nanoCAGE tags are sequenced by synthesis. NanoCAGE requires as little as 10 nanograms of total RNA."^^ . "nano-cap analysis of gene expression evidence"^^ . _:genid1129 . _:genid1129 . _:genid1129 . _:genid1129 "A type of transcript expression evidence based on high-throughput (HT) sequencing of the 5' ends of cDNA molecules that are selected by reverse transcriptase template switching."^^ . _:genid1129 "ECO:MCC"^^ . _:genid1130 . _:genid1130 . _:genid1130 . _:genid1130 "nanoCAGE"^^ . _:genid1130 "PMID:20543846"^^ . . . "A type of documented statement evidence that is based on work performed by a person or group prior to a use by a different person or group."^^ . "mchibucos"^^ . "2011-03-02T05:24:13Z"^^ . "eco"^^ . "ECO:0000311"^^ . "imported information"^^ . _:genid1131 . _:genid1131 . _:genid1131 . _:genid1131 "A type of documented statement evidence that is based on work performed by a person or group prior to a use by a different person or group."^^ . _:genid1131 "ECO:MCC"^^ . . _:genid1132 . _:genid1133 . _:genid1135 _:genid1134 . _:genid1133 _:genid1135 . _:genid1134 . _:genid1134 . _:genid1134 . _:genid1135 . _:genid1132 _:genid1133 . _:genid1132 . . . "A type of imported information that is used in a manual assertion."^^ . "mchibucos"^^ . "2011-03-02T05:29:44Z"^^ . "eco"^^ . "ECO:0000312"^^ . "imported information used in manual assertion"^^ . _:genid1136 . _:genid1136 . _:genid1136 . _:genid1136 . _:genid1136 "true"^^ . _:genid1137 . _:genid1137 . _:genid1137 . _:genid1137 "A type of imported information that is used in a manual assertion."^^ . _:genid1137 "ECO:MCC"^^ . . _:genid1138 . _:genid1139 . _:genid1141 _:genid1140 . _:genid1139 _:genid1141 . _:genid1140 . _:genid1140 . _:genid1140 . _:genid1141 . _:genid1138 _:genid1139 . _:genid1138 . . . "IEA"^^ . "A type of imported information that is used in an automatic assertion."^^ . "mchibucos"^^ . "2011-03-02T05:33:43Z"^^ . "eco"^^ . "ECO:0000313"^^ . "imported information used in automatic assertion"^^ . _:genid1142 . _:genid1142 . _:genid1142 . _:genid1142 . _:genid1142 "true"^^ . _:genid1143 . _:genid1143 . _:genid1143 . _:genid1143 "A type of imported information that is used in an automatic assertion."^^ . _:genid1143 "ECO:MCC"^^ . . _:genid1144 . _:genid1145 . _:genid1147 _:genid1146 . _:genid1145 _:genid1147 . _:genid1146 . _:genid1146 . _:genid1146 . _:genid1147 . _:genid1144 _:genid1145 . _:genid1144 . . . "IDA"^^ . "A type of direct assay evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2011-10-28T04:59:31Z"^^ . "GOECO:IDA"^^ . "IDA"^^ . "inferred from direct assay"^^ . "eco"^^ . "ECO:0000314"^^ . . "direct assay evidence used in manual assertion"^^ . "http://geneontology.org/page/ida-inferred-direct-assay"^^ . _:genid1148 . _:genid1148 . _:genid1148 . _:genid1148 . _:genid1148 "true"^^ . _:genid1149 . _:genid1149 . _:genid1149 . _:genid1149 "IDA"^^ . _:genid1149 "Default"^^ . _:genid1150 . _:genid1150 . _:genid1150 . _:genid1150 "A type of direct assay evidence that is used in a manual assertion."^^ . _:genid1150 "ECO:MCC"^^ . _:genid1151 . _:genid1151 . _:genid1151 . _:genid1151 "GOECO:IDA"^^ . _:genid1151 "inferred from direct assay"^^ . _:genid1152 . _:genid1152 . _:genid1152 . _:genid1152 "IDA"^^ . _:genid1152 "GOECO:IDA"^^ . _:genid1153 . _:genid1153 . _:genid1153 . _:genid1153 "inferred from direct assay"^^ . _:genid1153 "GOECO:IDA"^^ . . _:genid1154 . _:genid1155 . _:genid1157 _:genid1156 . _:genid1155 _:genid1157 . _:genid1156 . _:genid1156 . _:genid1156 . _:genid1157 . _:genid1154 _:genid1155 . _:genid1154 . . . "IMP"^^ . "A type of mutant phenotype evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2011-10-28T05:12:49Z"^^ . "GOECO:IMP"^^ . "IMP"^^ . "inferred from mutant phenotype"^^ . "eco"^^ . "ECO:0000315"^^ . . . . . "mutant phenotype evidence used in manual assertion"^^ . "http://geneontology.org/page/imp-inferred-mutant-phenotype"^^ . _:genid1158 . _:genid1158 . _:genid1158 . _:genid1158 . _:genid1158 "true"^^ . _:genid1159 . _:genid1159 . _:genid1159 . _:genid1159 "IMP"^^ . _:genid1159 "Default"^^ . _:genid1160 . _:genid1160 . _:genid1160 . _:genid1160 "A type of mutant phenotype evidence that is used in a manual assertion."^^ . _:genid1160 "ECO:MCC"^^ . _:genid1161 . _:genid1161 . _:genid1161 . _:genid1161 "GOECO:IMP"^^ . _:genid1161 "inferred from mutant phenotype"^^ . _:genid1162 . _:genid1162 . _:genid1162 . _:genid1162 "IMP"^^ . _:genid1162 "GOECO:IMP"^^ . _:genid1163 . _:genid1163 . _:genid1163 . _:genid1163 "inferred from mutant phenotype"^^ . _:genid1163 "GOECO:IMP"^^ . . _:genid1164 . _:genid1165 . _:genid1167 _:genid1166 . _:genid1165 _:genid1167 . _:genid1166 . _:genid1166 . _:genid1166 . _:genid1167 . _:genid1164 _:genid1165 . _:genid1164 . . . "IGI"^^ . "A type of genetic interaction experiment evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2011-10-28T05:14:42Z"^^ . "GOECO:IGI"^^ . "IGI"^^ . "inferred from genetic interaction"^^ . "eco"^^ . "ECO:0000316"^^ . . . . "genetic interaction evidence used in manual assertion"^^ . "http://geneontology.org/page/igi-inferred-genetic-interaction"^^ . _:genid1168 . _:genid1168 . _:genid1168 . _:genid1168 . _:genid1168 "true"^^ . _:genid1169 . _:genid1169 . _:genid1169 . _:genid1169 "IGI"^^ . _:genid1169 "Default"^^ . _:genid1170 . _:genid1170 . _:genid1170 . _:genid1170 "A type of genetic interaction experiment evidence that is used in a manual assertion."^^ . _:genid1170 "ECO:MCC"^^ . _:genid1171 . _:genid1171 . _:genid1171 . _:genid1171 "GOECO:IGI"^^ . _:genid1171 "inferred from genetic interaction"^^ . _:genid1172 . _:genid1172 . _:genid1172 . _:genid1172 "IGI"^^ . _:genid1172 "GOECO:IGI"^^ . _:genid1173 . _:genid1173 . _:genid1173 . _:genid1173 "inferred from genetic interaction"^^ . _:genid1173 "GOECO:IGI"^^ . . _:genid1174 . _:genid1175 . _:genid1177 _:genid1176 . _:genid1175 _:genid1177 . _:genid1176 . _:genid1176 . _:genid1176 . _:genid1177 . _:genid1174 _:genid1175 . _:genid1174 . . . "IGC"^^ . "A type of genomic context evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2011-10-28T05:22:53Z"^^ . "GOECO:IGC"^^ . "IGC"^^ . "inferred from genomic context"^^ . "eco"^^ . "ECO:0000317"^^ . . . "genomic context evidence used in manual assertion"^^ . "http://geneontology.org/page/igc-inferred-genomic-context"^^ . _:genid1178 . _:genid1178 . _:genid1178 . _:genid1178 . _:genid1178 "true"^^ . _:genid1179 . _:genid1179 . _:genid1179 . _:genid1179 "IGC"^^ . _:genid1179 "Default"^^ . _:genid1180 . _:genid1180 . _:genid1180 . _:genid1180 "A type of genomic context evidence that is used in a manual assertion."^^ . _:genid1180 "ECO:MCC"^^ . _:genid1181 . _:genid1181 . _:genid1181 . _:genid1181 "GOECO:IGC"^^ . _:genid1181 "inferred from genomic context"^^ . _:genid1182 . _:genid1182 . _:genid1182 . _:genid1182 "IGC"^^ . _:genid1182 "GOECO:IGC"^^ . _:genid1183 . _:genid1183 . _:genid1183 . _:genid1183 "inferred from genomic context"^^ . _:genid1183 "GOECO:IGC"^^ . . _:genid1184 . _:genid1185 . _:genid1187 _:genid1186 . _:genid1185 _:genid1187 . _:genid1186 . _:genid1186 . _:genid1186 . _:genid1187 . _:genid1184 _:genid1185 . _:genid1184 . . . "IBA"^^ . "A type of biological aspect of ancestor evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2011-10-28T05:23:51Z"^^ . "GOECO:IBA"^^ . "IBA"^^ . "inferred from biological aspect of ancestor"^^ . "eco"^^ . "ECO:0000318"^^ . . . "biological aspect of ancestor evidence used in manual assertion"^^ . "http://geneontology.org/page/iba-inferred-biological-aspect-ancestor"^^ . _:genid1188 . _:genid1188 . _:genid1188 . _:genid1188 . _:genid1188 "true"^^ . _:genid1189 . _:genid1189 . _:genid1189 . _:genid1189 "IBA"^^ . _:genid1189 "Default"^^ . _:genid1190 . _:genid1190 . _:genid1190 . _:genid1190 "A type of biological aspect of ancestor evidence that is used in a manual assertion."^^ . _:genid1190 "ECO:MCC"^^ . _:genid1191 . _:genid1191 . _:genid1191 . _:genid1191 "GOECO:IBA"^^ . _:genid1191 "inferred from biological aspect of ancestor"^^ . _:genid1192 . _:genid1192 . _:genid1192 . _:genid1192 "IBA"^^ . _:genid1192 "GOECO:IBA"^^ . _:genid1193 . _:genid1193 . _:genid1193 . _:genid1193 "inferred from biological aspect of ancestor"^^ . _:genid1193 "GOECO:IBA"^^ . . _:genid1194 . _:genid1195 . _:genid1197 _:genid1196 . _:genid1195 _:genid1197 . _:genid1196 . _:genid1196 . _:genid1196 . _:genid1197 . _:genid1194 _:genid1195 . _:genid1194 . . . "IBD"^^ . "A type of biological aspect of descendant evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2011-10-28T05:25:09Z"^^ . "GOECO:IBD"^^ . "IBD"^^ . "inferred from biological aspect of descendant"^^ . "eco"^^ . "ECO:0000319"^^ . . . "biological aspect of descendant evidence used in manual assertion"^^ . "http://geneontology.org/page/ibd-inferred-biological-aspect-descendent"^^ . _:genid1198 . _:genid1198 . _:genid1198 . _:genid1198 . _:genid1198 "true"^^ . _:genid1199 . _:genid1199 . _:genid1199 . _:genid1199 "IBD"^^ . _:genid1199 "Default"^^ . _:genid1200 . _:genid1200 . _:genid1200 . _:genid1200 "A type of biological aspect of descendant evidence that is used in a manual assertion."^^ . _:genid1200 "ECO:MCC"^^ . _:genid1201 . _:genid1201 . _:genid1201 . _:genid1201 "GOECO:IBD"^^ . _:genid1201 "inferred from biological aspect of descendant"^^ . _:genid1202 . _:genid1202 . _:genid1202 . _:genid1202 "IBD"^^ . _:genid1202 "GOECO:IBD"^^ . _:genid1203 . _:genid1203 . _:genid1203 . _:genid1203 "inferred from biological aspect of descendant"^^ . _:genid1203 "GOECO:IBD"^^ . . _:genid1204 . _:genid1205 . _:genid1207 _:genid1206 . _:genid1205 _:genid1207 . _:genid1206 . _:genid1206 . _:genid1206 . _:genid1207 . _:genid1204 _:genid1205 . _:genid1204 . . . "IKR"^^ . "A type of phylogenetic determination of loss of key residues evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2011-10-28T05:25:48Z"^^ . "GOECO:IKR"^^ . "GOECO:IMR"^^ . "IKR"^^ . "IMR"^^ . "inferred from key residues"^^ . "inferred from missing residues"^^ . "eco"^^ . "ECO:0000320"^^ . "phylogenetic determination of loss of key residues evidence used in manual assertion"^^ . "http://geneontology.org/page/ikr-inferred-key-residues"^^ . _:genid1208 . _:genid1208 . _:genid1208 . _:genid1208 . _:genid1208 "true"^^ . _:genid1209 . _:genid1209 . _:genid1209 . _:genid1209 "IKR"^^ . _:genid1209 "Default"^^ . _:genid1210 . _:genid1210 . _:genid1210 . _:genid1210 "A type of phylogenetic determination of loss of key residues evidence that is used in a manual assertion."^^ . _:genid1210 "ECO:MCC"^^ . _:genid1211 . _:genid1211 . _:genid1211 . _:genid1211 "GOECO:IKR"^^ . _:genid1211 "inferred from key residues"^^ . _:genid1212 . _:genid1212 . _:genid1212 . _:genid1212 "GOECO:IMR"^^ . _:genid1212 "inferred from missing residues"^^ . _:genid1213 . _:genid1213 . _:genid1213 . _:genid1213 "IKR"^^ . _:genid1213 "GOECO:IKR"^^ . _:genid1214 . _:genid1214 . _:genid1214 . _:genid1214 "IMR"^^ . _:genid1214 "GOECO:IKR"^^ . _:genid1215 . _:genid1215 . _:genid1215 . _:genid1215 "inferred from key residues"^^ . _:genid1215 "GOECO:IKR"^^ . _:genid1216 . _:genid1216 . _:genid1216 . _:genid1216 "inferred from missing residues"^^ . _:genid1216 "GOECO:IKR"^^ . . _:genid1217 . _:genid1218 . _:genid1220 _:genid1219 . _:genid1218 _:genid1220 . _:genid1219 . _:genid1219 . _:genid1219 . _:genid1220 . _:genid1217 _:genid1218 . _:genid1217 . . . "IRD"^^ . "A type of rapid divergence from ancestral sequence evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2011-10-28T05:26:42Z"^^ . "GOECO:IRD"^^ . "IRD"^^ . "inferred from rapid divergence"^^ . "eco"^^ . "ECO:0000321"^^ . . . "rapid divergence from ancestral sequence evidence used in manual assertion"^^ . "http://geneontology.org/page/ird-inferred-rapid-divergence"^^ . _:genid1221 . _:genid1221 . _:genid1221 . _:genid1221 . _:genid1221 "true"^^ . _:genid1222 . _:genid1222 . _:genid1222 . _:genid1222 "IRD"^^ . _:genid1222 "Default"^^ . _:genid1223 . _:genid1223 . _:genid1223 . _:genid1223 "A type of rapid divergence from ancestral sequence evidence that is used in a manual assertion."^^ . _:genid1223 "ECO:MCC"^^ . _:genid1224 . _:genid1224 . _:genid1224 . _:genid1224 "GOECO:IRD"^^ . _:genid1224 "inferred from rapid divergence"^^ . _:genid1225 . _:genid1225 . _:genid1225 . _:genid1225 "IRD"^^ . _:genid1225 "GOECO:IRD"^^ . _:genid1226 . _:genid1226 . _:genid1226 . _:genid1226 "inferred from rapid divergence"^^ . _:genid1226 "GOECO:IRD"^^ . . . "IEA"^^ . "Evidence that was initially used in manual assertion by one person or group, which is imported by a second person or group and used in automatic assertion."^^ . "mchibucos"^^ . "2011-12-13T12:04:48Z"^^ . "eco"^^ . "ECO:0000322"^^ . "imported manually asserted information used in automatic assertion"^^ . _:genid1227 . _:genid1227 . _:genid1227 . _:genid1227 "Evidence that was initially used in manual assertion by one person or group, which is imported by a second person or group and used in automatic assertion."^^ . _:genid1227 "ECO:MCC"^^ . . . "IEA"^^ . "A type of imported information used in automatic assertion that was initially used in automatic assertion by one person or group, which is imported by a second person or group and used in automatic assertion."^^ . "mchibucos"^^ . "2011-12-13T02:06:25Z"^^ . "eco"^^ . "ECO:0000323"^^ . "imported automatically asserted information used in automatic assertion"^^ . _:genid1228 . _:genid1228 . _:genid1228 . _:genid1228 "A type of imported information used in automatic assertion that was initially used in automatic assertion by one person or group, which is imported by a second person or group and used in automatic assertion."^^ . _:genid1228 "ECO:MCC"^^ . . . _:genid1229 . _:genid1229 . _:genid1229 . _:genid1229 . "In the images shown in Figure 9, the MelR focus is 15 x 33 nm across the shortest and longest axes of the oval in the complex with the shortened arm (right hand panel), compared to 9 x 12 nm in the other complex (centre panel). The simplest explanation for these observations, that is consistent with the location of sites in the DNA fragment (Figure 9), is that one type of complex contains 3 MelR molecules bound at sites 2, 1 and 1' (centre panel), whilst the other contains 4 MelR molecules bound at sites 2, 1, 1' and R (right panel)."^^ . "A type of direct assay evidence in which an image is created and analyzed."^^ . "mchibucos"^^ . "2012-02-23T12:01:43Z"^^ . "ECO:0001122"^^ . "ECO:0005024"^^ . "ECO:MCC"^^ . "radiologic test evidence"^^ . "eco"^^ . "ECO:0000324"^^ . "imaging assay evidence"^^ . _:genid1230 . _:genid1230 . _:genid1230 . _:genid1230 "In the images shown in Figure 9, the MelR focus is 15 x 33 nm across the shortest and longest axes of the oval in the complex with the shortened arm (right hand panel), compared to 9 x 12 nm in the other complex (centre panel). The simplest explanation for these observations, that is consistent with the location of sites in the DNA fragment (Figure 9), is that one type of complex contains 3 MelR molecules bound at sites 2, 1 and 1' (centre panel), whilst the other contains 4 MelR molecules bound at sites 2, 1, 1' and R (right panel)."^^ . _:genid1230 "PMID:18346968"^^ . . . _:genid1231 . _:genid1231 . _:genid1231 . _:genid1231 . _:genid1232 . _:genid1232 . _:genid1233 . _:genid1234 . _:genid1236 _:genid1235 . _:genid1234 _:genid1236 . _:genid1235 . _:genid1235 . _:genid1235 . _:genid1236 . _:genid1233 _:genid1234 . _:genid1232 _:genid1233 . _:genid1232 . "A type of experimental evidence that is based on separation of constituent parts of a mixture (the mobile phase) as they pass differentially through a stationary phase due to differences in partition coefficient and retention on the stationary phase."^^ . "mchibucos"^^ . "2012-05-16T11:46:27Z"^^ . "chromatographic evidence"^^ . "eco"^^ . "ECO:0000325"^^ . "chromatography evidence"^^ . _:genid1237 . _:genid1237 . _:genid1237 . _:genid1237 "A type of experimental evidence that is based on separation of constituent parts of a mixture (the mobile phase) as they pass differentially through a stationary phase due to differences in partition coefficient and retention on the stationary phase."^^ . _:genid1237 "ECO:MCC"^^ . . . "A type of sequence alignment evidence that is based on comparing the position of exon junctions, relative to a reference genome, for a transcript annotation and a supporting transcript."^^ . "mchibucos"^^ . "2012-06-08T11:03:59Z"^^ . "eco"^^ . "ECO:0000326"^^ . "transcript splice pattern evidence"^^ . _:genid1238 . _:genid1238 . _:genid1238 . _:genid1238 "A type of sequence alignment evidence that is based on comparing the position of exon junctions, relative to a reference genome, for a transcript annotation and a supporting transcript."^^ . _:genid1238 "ECO:MCC"^^ . . . "A type of transcript splice pattern evidence that is based on the exon combination of a whole transcript, rather than its constituent features."^^ . "mchibucos"^^ . "2012-06-08T11:11:24Z"^^ . "eco"^^ . "ECO:0000327"^^ . "This term is used by the NCBI Reference Sequences (RefSeq) in support of sequences that have the same splice pattern as a RefSeq transcript. If such full transcript information is not available, RefSeq reports sequences that match the splice pattern of a coding sequence (CDS) annotated on a RefSeq, supported by the evidence term ECO:0000328 or a child."^^ . "whole transcript splice pattern evidence"^^ . _:genid1239 . _:genid1239 . _:genid1239 . _:genid1239 "A type of transcript splice pattern evidence that is based on the exon combination of a whole transcript, rather than its constituent features."^^ . _:genid1239 "ECO:MCC"^^ . . . "A type of transcript splice pattern evidence that is based on the exon combination of a coding sequence (CDS), a sub-feature of a whole transcript."^^ . "mchibucos"^^ . "2012-06-08T11:21:57Z"^^ . "eco"^^ . "ECO:0000328"^^ . "This term is used by the NCBI Reference Sequences (RefSeq) in support of sequences that match the splice pattern of a coding sequence (CDS) annotated on a RefSeq, but for which full transcript information is unavailable. For sequences that have the same splice pattern as a whole RefSeq transcript, use the evidence term ECO:0000327 or a child."^^ . "coding sequence splice pattern evidence"^^ . _:genid1240 . _:genid1240 . _:genid1240 . _:genid1240 "A type of transcript splice pattern evidence that is based on the exon combination of a coding sequence (CDS), a sub-feature of a whole transcript."^^ . _:genid1240 "ECO:MCC"^^ . . _:genid1241 . _:genid1242 . _:genid1244 _:genid1243 . _:genid1242 _:genid1244 . _:genid1243 . _:genid1243 . _:genid1243 . _:genid1244 . _:genid1241 _:genid1242 . _:genid1241 . . . "ISA"^^ . "A type of transcript splice pattern evidence that is based on the exon combination of a whole transcript, rather than its constituent features, and is used in manual assertion."^^ . "mchibucos"^^ . "2012-06-08T11:40:03Z"^^ . "eco"^^ . "ECO:0000329"^^ . "This term is used by the NCBI Reference Sequences (RefSeq) in support of sequences that have the same splice pattern as a RefSeq transcript. If such full transcript information is not available, RefSeq reports sequences that match the splice pattern of a coding sequence (CDS) annotated on a RefSeq, supported by the evidence term ECO:0000328 or a child."^^ . "whole transcript splice pattern evidence used in manual assertion"^^ . _:genid1245 . _:genid1245 . _:genid1245 . _:genid1245 . _:genid1245 "true"^^ . _:genid1246 . _:genid1246 . _:genid1246 . _:genid1246 "A type of transcript splice pattern evidence that is based on the exon combination of a whole transcript, rather than its constituent features, and is used in manual assertion."^^ . _:genid1246 "ECO:MCC"^^ . . _:genid1247 . _:genid1248 . _:genid1250 _:genid1249 . _:genid1248 _:genid1250 . _:genid1249 . _:genid1249 . _:genid1249 . _:genid1250 . _:genid1247 _:genid1248 . _:genid1247 . . . "ISA"^^ . "A type of transcript splice pattern evidence that is based on the exon combination of a coding sequence (CDS), a sub-feature of a whole transcript, and is used in manual assertion."^^ . "mchibucos"^^ . "2012-06-08T11:43:47Z"^^ . "eco"^^ . "ECO:0000330"^^ . "This term is used by the NCBI Reference Sequences (RefSeq) in support of sequences that match the splice pattern of a coding sequence (CDS) annotated on a RefSeq, but for which full transcript information is unavailable. For sequences that have the same splice pattern as a whole RefSeq transcript, use the evidence term ECO:0000327 or a child."^^ . "coding sequence splice pattern evidence used in manual assertion"^^ . _:genid1251 . _:genid1251 . _:genid1251 . _:genid1251 . _:genid1251 "true"^^ . _:genid1252 . _:genid1252 . _:genid1252 . _:genid1252 "A type of transcript splice pattern evidence that is based on the exon combination of a coding sequence (CDS), a sub-feature of a whole transcript, and is used in manual assertion."^^ . _:genid1252 "ECO:MCC"^^ . . _:genid1253 . _:genid1254 . _:genid1256 _:genid1255 . _:genid1254 _:genid1256 . _:genid1255 . _:genid1255 . _:genid1255 . _:genid1256 . _:genid1253 _:genid1254 . _:genid1253 . . . "IEA"^^ . "A type of transcript splice pattern evidence that is based on the exon combination of a coding sequence (CDS), a sub-feature of a whole transcript, and is used in automatic assertion."^^ . "mchibucos"^^ . "2012-06-08T11:48:09Z"^^ . "eco"^^ . "ECO:0000331"^^ . "This term is used by the NCBI Reference Sequences (RefSeq) in support of sequences that match the splice pattern of a coding sequence (CDS) annotated on a RefSeq, but for which full transcript information is unavailable. For sequences that have the same splice pattern as a whole RefSeq transcript, use the evidence term ECO:0000327 or a child."^^ . "coding sequence splice pattern evidence used in automatic assertion"^^ . _:genid1257 . _:genid1257 . _:genid1257 . _:genid1257 . _:genid1257 "true"^^ . _:genid1258 . _:genid1258 . _:genid1258 . _:genid1258 "A type of transcript splice pattern evidence that is based on the exon combination of a coding sequence (CDS), a sub-feature of a whole transcript, and is used in automatic assertion."^^ . _:genid1258 "ECO:MCC"^^ . . _:genid1259 . _:genid1260 . _:genid1262 _:genid1261 . _:genid1260 _:genid1262 . _:genid1261 . _:genid1261 . _:genid1261 . _:genid1262 . _:genid1259 _:genid1260 . _:genid1259 . . . "IEA"^^ . "A type of transcript splice pattern evidence that is based on the exon combination of a whole transcript, rather than its constituent features, and is used in automatic assertion."^^ . "mchibucos"^^ . "2012-06-08T11:49:17Z"^^ . "eco"^^ . "ECO:0000332"^^ . "This term is used by the NCBI Reference Sequences (RefSeq) in support of sequences that have the same splice pattern as a RefSeq transcript. If such full transcript information is not available, RefSeq reports sequences that match the splice pattern of a coding sequence (CDS) annotated on a RefSeq, supported by the evidence term ECO:0000328 or a child."^^ . "whole transcript splice pattern evidence used in automatic assertion"^^ . _:genid1263 . _:genid1263 . _:genid1263 . _:genid1263 . _:genid1263 "true"^^ . _:genid1264 . _:genid1264 . _:genid1264 . _:genid1264 "A type of transcript splice pattern evidence that is based on the exon combination of a whole transcript, rather than its constituent features, and is used in automatic assertion."^^ . _:genid1264 "ECO:MCC"^^ . . . "A type of gel electrophoresis evidence where proteins are separated according to their electrophoretic mobility."^^ . "mchibucos"^^ . "2012-07-31T02:56:43Z"^^ . "SDS-PAGE evidence"^^ . "eco"^^ . "ECO:0000333"^^ . "Electrophoretic mobility is a function of both the length and charge of a protein. The protein sample is linearized with sodium dodecyl sulfate (SDS), an anionic detergent. Typically, polypeptides bound with SDS possess an even distribution of charge per unit mass, and subsequent fractionation is by size."^^ . "sodium dodecyl sulfate polyacrylamide gel electrophoresis evidence"^^ . _:genid1265 . _:genid1265 . _:genid1265 . _:genid1265 "A type of gel electrophoresis evidence where proteins are separated according to their electrophoretic mobility."^^ . _:genid1265 "ECO:MCC"^^ . _:genid1265 "PubMed:4861258"^^ . _:genid1265 "url:http://www.nature.com/nmeth/journal/v2/n1/full/nmeth0105-83.html"^^ . _:genid1265 "url:http://www.ncbi.nlm.nih.gov/Class/NAWBIS/Modules/Protein/protein18.html"^^ . . . "A type of direct assay evidence resulting from an assay where both the size of and number of particles in a sample are determined."^^ . "mchibucos"^^ . "2012-07-31T03:19:32Z"^^ . "eco"^^ . "ECO:0000334"^^ . "An example of an instrument used to analyze particle sizes and counts is the Beckman Coulter\u00C2\u00AE Z Series system."^^ . "particle size and count assay evidence"^^ . _:genid1266 . _:genid1266 . _:genid1266 . _:genid1266 "A type of direct assay evidence resulting from an assay where both the size of and number of particles in a sample are determined."^^ . _:genid1266 "ECO:MCC"^^ . . . "A type of direct assay evidence where the quantity of a substance used as part of an assay is measured."^^ . "mchibucos"^^ . "2012-07-31T03:52:46Z"^^ . "eco"^^ . "ECO:0000335"^^ . "Two examples of substance quantification assay are (i) measuring how much of a radiolabelled compound is taken up by a cell and (ii) measuring how much of a substrate is turned over by a given enzyme."^^ . "substance quantification evidence"^^ . _:genid1267 . _:genid1267 . _:genid1267 . _:genid1267 "A type of direct assay evidence where the quantity of a substance used as part of an assay is measured."^^ . _:genid1267 "ECO:MCC"^^ . . . _:genid1268 . _:genid1268 . _:genid1268 . _:genid1268 . _:genid1269 . _:genid1269 . _:genid1270 . _:genid1271 . _:genid1273 _:genid1272 . _:genid1271 _:genid1273 . _:genid1272 . _:genid1272 . _:genid1272 . _:genid1273 . _:genid1270 _:genid1271 . _:genid1269 _:genid1270 . _:genid1269 . _:genid1274 . _:genid1274 . _:genid1275 . _:genid1276 . _:genid1278 _:genid1277 . _:genid1276 _:genid1278 . _:genid1277 . _:genid1277 . _:genid1279 . _:genid1279 . _:genid1279 . _:genid1277 _:genid1279 . _:genid1278 . _:genid1275 _:genid1276 . _:genid1274 _:genid1275 . _:genid1274 . "A type of cell proliferation assay evidence in which a mutated strain of a microorganism, such as a yeast or bacterium, is grown competitively with wild-type cells and the relative fitness of the strains is assessed usually by means of a fluorescent marker and flow cytometric analysis."^^ . "mchibucos"^^ . "2012-08-24T12:03:58Z"^^ . "fitness profiling"^^ . "eco"^^ . "ECO:0000336"^^ . "competitive growth assay evidence"^^ . _:genid1280 . _:genid1280 . _:genid1280 . _:genid1280 "A type of cell proliferation assay evidence in which a mutated strain of a microorganism, such as a yeast or bacterium, is grown competitively with wild-type cells and the relative fitness of the strains is assessed usually by means of a fluorescent marker and flow cytometric analysis."^^ . _:genid1280 "GOC:MAH"^^ . _:genid1280 "PMID:14718172"^^ . _:genid1280 "PMID:20537132"^^ . _:genid1281 . _:genid1281 . _:genid1281 . _:genid1281 "fitness profiling"^^ . _:genid1281 "GOC:MAH"^^ . _:genid1281 "PMID:20537132"^^ . . . _:genid1282 . _:genid1282 . _:genid1282 . _:genid1282 . _:genid1283 . _:genid1283 . _:genid1284 . _:genid1285 . _:genid1287 _:genid1286 . _:genid1285 _:genid1287 . _:genid1286 . _:genid1286 . _:genid1286 . _:genid1287 . _:genid1284 _:genid1285 . _:genid1283 _:genid1284 . _:genid1283 . _:genid1288 . _:genid1288 . _:genid1289 . _:genid1290 . _:genid1292 _:genid1291 . _:genid1290 _:genid1292 . _:genid1291 . _:genid1291 . _:genid1291 . _:genid1292 . _:genid1289 _:genid1290 . _:genid1288 _:genid1289 . _:genid1288 . "We analyzed the electrophoretic pattern of cytosolic proteins extracted from LM3 and LM3-2 cells, grown under standard conditions up to mid-exponential phase (Fig. 1). The presence of differentially expressed proteins in the two strains, together with results of previous studies [28,29] demonstrated the role of CcpA as global regulator in L. plantarum."^^ . "A type of direct assay evidence where molecules have been sorted according to their size and charge by moving through a gel in the presence of an electric field."^^ . "mchibucos"^^ . "2012-08-24T12:11:51Z"^^ . "ECO:0005026"^^ . "eco"^^ . "ECO:0000337"^^ . "Molecules typically separated include DNA, RNA, or protein. The gel is typically made of agarose, polyacrylamide, or starch."^^ . "gel electrophoresis evidence"^^ . _:genid1293 . _:genid1293 . _:genid1293 . _:genid1293 "We analyzed the electrophoretic pattern of cytosolic proteins extracted from LM3 and LM3-2 cells, grown under standard conditions up to mid-exponential phase (Fig. 1). The presence of differentially expressed proteins in the two strains, together with results of previous studies [28,29] demonstrated the role of CcpA as global regulator in L. plantarum."^^ . _:genid1293 "PMID:17129387"^^ . _:genid1294 . _:genid1294 . _:genid1294 . _:genid1294 "A type of direct assay evidence where molecules have been sorted according to their size and charge by moving through a gel in the presence of an electric field."^^ . _:genid1294 "ECO:MCC"^^ . _:genid1294 "wikipedia:Gel_electrophoresis"^^ . . . "A type of gel electrophoresis evidence in which large DNA molecules are separated on agarose gel by alternately pulsed, perpendicularly oriented electrical fields, at least one of which is inhomogeneous."^^ . "mchibucos"^^ . "2012-08-24T12:34:01Z"^^ . "PFGE"^^ . "eco"^^ . "ECO:0000338"^^ . "pulsed-field gel electrophoresis evidence"^^ . _:genid1295 . _:genid1295 . _:genid1295 . _:genid1295 "A type of gel electrophoresis evidence in which large DNA molecules are separated on agarose gel by alternately pulsed, perpendicularly oriented electrical fields, at least one of which is inhomogeneous."^^ . _:genid1295 "PMID:6373014"^^ . . . "A type of gel electrophoresis evidence where DNA molecules are electrophoresed on a low percentage agarose gel followed by high voltage electrophoresis on a higher percentage agarose gel in the presence of ethidium bromide."^^ . "mchibucos"^^ . "2012-08-24T12:42:37Z"^^ . "2-D agarose gel electrophoresis"^^ . "eco"^^ . "ECO:0000339"^^ . "The first dimension gel is intentionally run at low voltage in low percentage agarose to separate DNA molecules in proportion to their mass. The second dimension is run at high voltage in a gel of higher agarose concentration in the presence of ethidium bromide so that the mobility of a non-linear molecule is drastically influenced by its shape."^^ . "two-dimensional agarose gel electrophoresis evidence"^^ . _:genid1296 . _:genid1296 . _:genid1296 . _:genid1296 "A type of gel electrophoresis evidence where DNA molecules are electrophoresed on a low percentage agarose gel followed by high voltage electrophoresis on a higher percentage agarose gel in the presence of ethidium bromide."^^ . _:genid1296 "PMID:16118435"^^ . _:genid1296 "PMID:8594382"^^ . . . _:genid1297 . _:genid1297 . _:genid1297 . _:genid1297 . _:genid1298 . _:genid1298 . _:genid1298 . _:genid1298 . _:genid1299 . _:genid1299 . _:genid1300 . _:genid1301 . _:genid1303 _:genid1302 . _:genid1301 _:genid1303 . _:genid1302 . _:genid1302 . _:genid1302 . _:genid1303 . _:genid1300 _:genid1301 . _:genid1299 _:genid1300 . _:genid1299 . _:genid1304 . _:genid1304 . _:genid1305 . _:genid1306 . _:genid1308 _:genid1307 . _:genid1306 _:genid1308 . _:genid1307 . _:genid1307 . _:genid1309 . _:genid1309 . _:genid1309 . _:genid1307 _:genid1309 . _:genid1308 . _:genid1305 _:genid1306 . _:genid1304 _:genid1305 . _:genid1304 . "A type of experimental evidence in which a plasmid that is capable of being replicated is introduced into cells, cells are grown without selection for several generations, and retention of the plasmid is determined."^^ . "mchibucos"^^ . "2012-08-24T01:27:58Z"^^ . "minichromosome maintenance assay evidence"^^ . "eco"^^ . "ECO:0000340"^^ . "Loss per generation is determined by comparing colony numbers on selective and non-selective media."^^ . "plasmid maintenance assay evidence"^^ . _:genid1310 . _:genid1310 . _:genid1310 . _:genid1310 "A type of experimental evidence in which a plasmid that is capable of being replicated is introduced into cells, cells are grown without selection for several generations, and retention of the plasmid is determined."^^ . _:genid1310 "ECO:MCC"^^ . _:genid1310 "PMID:6323245"^^ . _:genid1311 . _:genid1311 . _:genid1311 . _:genid1311 "minichromosome maintenance assay evidence"^^ . _:genid1311 "PMID:6323245"^^ . . . "A type of specific protein inhibition evidence where the molecular function of a protein is inhibited by an antibody."^^ . "mchibucos"^^ . "2012-08-24T01:48:24Z"^^ . "eco"^^ . "ECO:0000341"^^ . "specific protein inhibition by antibody evidence"^^ . _:genid1312 . _:genid1312 . _:genid1312 . _:genid1312 "A type of specific protein inhibition evidence where the molecular function of a protein is inhibited by an antibody."^^ . _:genid1312 "ECO:MCC"^^ . . . "A type of RNA-seq evidence where intron locations in predicted transcripts are compared to intron locations supported by RNA-seq evidence."^^ . "mchibucos"^^ . "2013-04-03T04:22:05Z"^^ . "Support of intron positions by RNA-seq alignment evidence"^^ . "eco"^^ . "ECO:0000342"^^ . "RNA-seq alignment intron location evidence is used by NCBI RefSeq (http://www.ncbi.nlm.nih.gov/refseq). Exon-exon boundaries (or intron locations) of a RefSeq transcript, as determined by aligning the transcript to a reference chromosome, are compared to intron locations supported by RNAseq data."^^ . "support of intron positions by RNA-sequencing alignment evidence"^^ . _:genid1313 . _:genid1313 . _:genid1313 . _:genid1313 "A type of RNA-seq evidence where intron locations in predicted transcripts are compared to intron locations supported by RNA-seq evidence."^^ . _:genid1313 "ECO:MCC"^^ . . . "A type of support of intron positions by RNA-sequencing alignment evidence where RNA-seq alignment from a single sample supports all of the intron positions (exon pairs) predicted for a transcript."^^ . "mchibucos"^^ . "2013-04-03T04:41:48Z"^^ . "Full support of intron positions by RNA-seq alignment evidence"^^ . "eco"^^ . "ECO:0000343"^^ . "Full support entails that all exon pairs represented in the transcript are supported. For example, for a transcript containing five exons, if liver RNA-seq reads support all four introns but brain RNA-seq supports only three introns, then the liver data fully support the transcript exons whereas the brain data do not."^^ . "full support of intron positions by RNA-sequencing alignment evidence"^^ . _:genid1314 . _:genid1314 . _:genid1314 . _:genid1314 "A type of support of intron positions by RNA-sequencing alignment evidence where RNA-seq alignment from a single sample supports all of the intron positions (exon pairs) predicted for a transcript."^^ . _:genid1314 "ECO:MCC"^^ . . . "A type of support of intron positions by RNA-sequencing alignment evidence where RNA-seq alignment to a genome supports only some of the intron positions (exon pairs) predicted for a transcript."^^ . "mchibucos"^^ . "2013-04-03T04:50:46Z"^^ . "Partial support of intron positions by RNA-seq alignment evidence"^^ . "eco"^^ . "ECO:0000344"^^ . "Partial support can occur in two ways. First, one or more exon-exon pair (intron) is not supported by any RNA-seq sample included in the analysis. Second, no single RNA-seq sample provides support for all exon-exon pairs (introns) represented in a transcript, but all represented exons are supported by at least one sample."^^ . "partial support of intron positions by RNA-sequencing alignment evidence"^^ . _:genid1315 . _:genid1315 . _:genid1315 . _:genid1315 "A type of support of intron positions by RNA-sequencing alignment evidence where RNA-seq alignment to a genome supports only some of the intron positions (exon pairs) predicted for a transcript."^^ . _:genid1315 "ECO:MCC"^^ . . . "A type of sequence alignment evidence resulting from the comparison of a single exon transcript to a collection / database of known single exon genes."^^ . "mchibucos"^^ . "2013-04-03T05:10:34Z"^^ . "eco"^^ . "ECO:0000345"^^ . "single exon transcript confirmation via alignment evidence"^^ . _:genid1316 . _:genid1316 . _:genid1316 . _:genid1316 "A type of sequence alignment evidence resulting from the comparison of a single exon transcript to a collection / database of known single exon genes."^^ . _:genid1316 "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4897596/"^^ . . _:genid1317 . _:genid1318 . _:genid1320 _:genid1319 . _:genid1318 _:genid1320 . _:genid1319 . _:genid1319 . _:genid1319 . _:genid1320 . _:genid1317 _:genid1318 . _:genid1317 . . . "IEP"^^ . "A type of support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2013-04-04T04:37:35Z"^^ . "Support of intron positions by RNA-seq alignment evidence used in manual assertion"^^ . "eco"^^ . "ECO:0000346"^^ . "support of intron positions by RNA-sequencing alignment evidence used in manual assertion"^^ . _:genid1321 . _:genid1321 . _:genid1321 . _:genid1321 . _:genid1321 "true"^^ . _:genid1322 . _:genid1322 . _:genid1322 . _:genid1322 "A type of support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion."^^ . _:genid1322 "ECO:MCC"^^ . . _:genid1323 . _:genid1324 . _:genid1326 _:genid1325 . _:genid1324 _:genid1326 . _:genid1325 . _:genid1325 . _:genid1325 . _:genid1326 . _:genid1323 _:genid1324 . _:genid1323 . . . "IEA"^^ . "A type of support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion."^^ . "mchibucos"^^ . "2013-04-04T04:38:45Z"^^ . "Support of intron positions by RNA-seq alignment evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0000347"^^ . "support of intron positions by RNA-sequencing alignment evidence used in automatic assertion"^^ . _:genid1327 . _:genid1327 . _:genid1327 . _:genid1327 . _:genid1327 "true"^^ . _:genid1328 . _:genid1328 . _:genid1328 . _:genid1328 "A type of support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion."^^ . _:genid1328 "ECO:MCC"^^ . . _:genid1329 . _:genid1330 . _:genid1332 _:genid1331 . _:genid1330 _:genid1332 . _:genid1331 . _:genid1331 . _:genid1331 . _:genid1332 . _:genid1329 _:genid1330 . _:genid1329 . . . "IEA"^^ . "A type of full support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion."^^ . "mchibucos"^^ . "2013-04-04T04:40:19Z"^^ . "Full support of intron positions by RNA-seq alignment evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0000348"^^ . "full support of intron positions by RNA-sequencing alignment evidence used in automatic assertion"^^ . _:genid1333 . _:genid1333 . _:genid1333 . _:genid1333 . _:genid1333 "true"^^ . _:genid1334 . _:genid1334 . _:genid1334 . _:genid1334 "A type of full support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion."^^ . _:genid1334 "ECO:MCC"^^ . . _:genid1335 . _:genid1336 . _:genid1338 _:genid1337 . _:genid1336 _:genid1338 . _:genid1337 . _:genid1337 . _:genid1337 . _:genid1338 . _:genid1335 _:genid1336 . _:genid1335 . . . "IEP"^^ . "A type of full support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2013-04-04T04:41:34Z"^^ . "Full support of intron positions by RNA-seq alignment evidence used in manual assertion"^^ . "eco"^^ . "ECO:0000349"^^ . "full support of intron positions by RNA-sequencing alignment evidence used in manual assertion"^^ . _:genid1339 . _:genid1339 . _:genid1339 . _:genid1339 . _:genid1339 "true"^^ . _:genid1340 . _:genid1340 . _:genid1340 . _:genid1340 "A type of full support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion."^^ . _:genid1340 "ECO:MCC"^^ . . _:genid1341 . _:genid1342 . _:genid1344 _:genid1343 . _:genid1342 _:genid1344 . _:genid1343 . _:genid1343 . _:genid1343 . _:genid1344 . _:genid1341 _:genid1342 . _:genid1341 . . . "IEA"^^ . "A type of partial support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion."^^ . "mchibucos"^^ . "2013-04-04T04:42:53Z"^^ . "Partial support of intron positions by RNA-seq alignment evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0000350"^^ . "partial support of intron positions by RNA-sequencing alignment evidence used in automatic assertion"^^ . _:genid1345 . _:genid1345 . _:genid1345 . _:genid1345 . _:genid1345 "true"^^ . _:genid1346 . _:genid1346 . _:genid1346 . _:genid1346 "A type of partial support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion."^^ . _:genid1346 "ECO:MCC"^^ . . _:genid1347 . _:genid1348 . _:genid1350 _:genid1349 . _:genid1348 _:genid1350 . _:genid1349 . _:genid1349 . _:genid1349 . _:genid1350 . _:genid1347 _:genid1348 . _:genid1347 . . . "IEP"^^ . "A type of partial support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2013-04-04T04:43:56Z"^^ . "Partial support of intron positions by RNA-seq alignment evidence used in manual assertion"^^ . "eco"^^ . "ECO:0000351"^^ . "partial support of intron positions by RNA-sequencing alignment evidence used in manual assertion"^^ . _:genid1351 . _:genid1351 . _:genid1351 . _:genid1351 . _:genid1351 "true"^^ . _:genid1352 . _:genid1352 . _:genid1352 . _:genid1352 "A type of partial support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion."^^ . _:genid1352 "ECO:MCC"^^ . . _:genid1353 . _:genid1354 . _:genid1356 _:genid1355 . _:genid1354 _:genid1356 . _:genid1355 . _:genid1355 . _:genid1355 . _:genid1356 . _:genid1353 _:genid1354 . _:genid1353 . . _:genid1357 . _:genid1357 . _:genid1357 . _:genid1357 . "A type of evidence that is used in an manual assertion."^^ . "mchibucos"^^ . "eco"^^ . "ECO:0000352"^^ . "evidence used in manual assertion"^^ . _:genid1358 . _:genid1358 . _:genid1358 . _:genid1358 . _:genid1358 "true"^^ . _:genid1359 . _:genid1359 . _:genid1359 . _:genid1360 . _:genid1360 . _:genid1360 . _:genid1359 _:genid1360 . _:genid1359 "true"^^ . _:genid1361 . _:genid1361 . _:genid1361 . _:genid1361 "A type of evidence that is used in an manual assertion."^^ . _:genid1361 "ECO:MCC"^^ . . _:genid1362 . _:genid1363 . _:genid1365 _:genid1364 . _:genid1363 _:genid1365 . _:genid1364 . _:genid1364 . _:genid1364 . _:genid1365 . _:genid1362 _:genid1363 . _:genid1362 . . . "IPI"^^ . "A type of physical interaction evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2013-10-31T21:01:27Z"^^ . "GOECO:IPI"^^ . "IPI"^^ . "inferred from physical interaction"^^ . "eco"^^ . "ECO:0000353"^^ . . . . . "physical interaction evidence used in manual assertion"^^ . "http://geneontology.org/page/ipi-inferred-physical-interaction"^^ . _:genid1366 . _:genid1366 . _:genid1366 . _:genid1366 . _:genid1366 "true"^^ . _:genid1367 . _:genid1367 . _:genid1367 . _:genid1367 "IPI"^^ . _:genid1367 "Default"^^ . _:genid1368 . _:genid1368 . _:genid1368 . _:genid1368 "A type of physical interaction evidence that is used in a manual assertion."^^ . _:genid1368 "ECO:MCC"^^ . _:genid1369 . _:genid1369 . _:genid1369 . _:genid1369 "GOECO:IPI"^^ . _:genid1369 "inferred from physical interaction"^^ . _:genid1370 . _:genid1370 . _:genid1370 . _:genid1370 "IPI"^^ . _:genid1370 "GOECO:IPI"^^ . _:genid1371 . _:genid1371 . _:genid1371 . _:genid1371 "inferred from physical interaction"^^ . _:genid1371 "GOECO:IPI"^^ . . _:genid1372 . _:genid1373 . _:genid1375 _:genid1374 . _:genid1373 _:genid1375 . _:genid1374 . _:genid1374 . _:genid1374 . _:genid1375 . _:genid1372 _:genid1373 . _:genid1372 . . . "IGC"^^ . "A type of gene neighbors evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2013-11-19T13:37:24Z"^^ . "inferred from genome cluster"^^ . "GO_REF:0000025"^^ . "eco"^^ . "ICL"^^ . "ECO:0000354"^^ . "gene neighbors evidence used in manual assertion"^^ . _:genid1376 . _:genid1376 . _:genid1376 . _:genid1376 . _:genid1376 "true"^^ . _:genid1377 . _:genid1377 . _:genid1377 . _:genid1377 "A type of gene neighbors evidence that is used in a manual assertion."^^ . _:genid1377 "ECO:MCC"^^ . _:genid1378 . _:genid1378 . _:genid1378 . _:genid1378 "GO_REF:0000025"^^ . _:genid1378 "operon structure as IGC evidence"^^ . . . "A type of phylogenetic evidence characterized by the mapping of the character states of living organisms onto phylogenies using the method of maximum parsimony."^^ . "mchibucos"^^ . "2014-04-22T17:02:31Z"^^ . "eco"^^ . "ECO:0000355"^^ . "Example of use: \"The presence of paired evaginated hemispheres and olfactory bulbs in both agnathan and gnathostome radiations suggests that such hemispheres were also present in the common ancestor.\" PMID: 7013637. Northcutt RG. (1981) Evolution of the telencephalon in nonmammals. Ann. Rev. Neurosci."^^ . "phylogenetic distribution evidence"^^ . _:genid1379 . _:genid1379 . _:genid1379 . _:genid1379 "A type of phylogenetic evidence characterized by the mapping of the character states of living organisms onto phylogenies using the method of maximum parsimony."^^ . _:genid1379 "ECO:MCC"^^ . _:genid1379 "PMID:21238344"^^ . . . "A type of transcript expression evidence resulting from a microarray analysis with the use of the Gene Set Enrichment Analysis (GSEA) method or the Fisher's-Exact (FE) method to assess the differential expression."^^ . "mchibucos"^^ . "2014-09-26T16:25:47Z"^^ . "eco"^^ . "ECO:0000358"^^ . "differential geneset expression evidence from microarray experiment (GSEA, Fisher-exact)"^^ . _:genid1380 . _:genid1380 . _:genid1380 . _:genid1380 "A type of transcript expression evidence resulting from a microarray analysis with the use of the Gene Set Enrichment Analysis (GSEA) method or the Fisher's-Exact (FE) method to assess the differential expression."^^ . _:genid1380 "PMID:19725948"^^ . . . "A type of transcript expression evidence resulting from the use of the Gene Set Enrichment Analysis (GSEA) method or Fisher's-Exact (FE) method to assess an RNA-seq dataset for differential gene expression."^^ . "mchibucos"^^ . "2014-09-26T16:26:48Z"^^ . "eco"^^ . "ECO:0000359"^^ . "differential geneset expression evidence from RNA-seq experiment (GSEA, Fisher-exact)"^^ . _:genid1381 . _:genid1381 . _:genid1381 . _:genid1381 "A type of transcript expression evidence resulting from the use of the Gene Set Enrichment Analysis (GSEA) method or Fisher's-Exact (FE) method to assess an RNA-seq dataset for differential gene expression."^^ . _:genid1381 "PMC:2881125"^^ . . . "A type of experimental evidence resulting from the prediction of drug-target interactions by computational means."^^ . "mchibucos"^^ . "2014-09-26T16:39:11Z"^^ . "eco"^^ . "ECO:0000360"^^ . "biological target-disease association via drug evidence"^^ . _:genid1382 . _:genid1382 . _:genid1382 . _:genid1382 "A type of experimental evidence resulting from the prediction of drug-target interactions by computational means."^^ . _:genid1382 "https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2199-x"^^ . . . "A type of evidence where an assertion is derived from another assertion via logical inference or some non-logical but rational means."^^ . "mchibucos"^^ . "2015-07-14T11:19:37Z"^^ . "eco"^^ . "ECO:0000361"^^ . "Inference is the process of deriving logical conclusions from premises known or assumed to be true, or alternatively, arriving at conclusions via some non-logical means of observation of patterns of facts, which can result in identifying new meanings and contexts for understanding. Given the evidence provided by a set of premises, deductive reasoning involves drawing conclusions that necessarily follow, i.e. are certain, whereas inductive reasoning generates conclusions that are likely to be, but are not necessarily, true."^^ . "inferential evidence"^^ . _:genid1383 . _:genid1383 . _:genid1383 . _:genid1383 "A type of evidence where an assertion is derived from another assertion via logical inference or some non-logical but rational means."^^ . _:genid1383 "ECO:MCC"^^ . . . . "A type of inferential evidence based on a computationally derived unary inference or an inference chain in which at least one step is \ncomputationally derived."^^ . "mchibucos"^^ . "2015-07-14T11:24:27Z"^^ . "evidence based on computational logical inference" . "eco"^^ . "ECO:0000362"^^ . "computational inference"^^ . _:genid1384 . _:genid1384 . _:genid1384 . _:genid1384 "A type of inferential evidence based on a computationally derived unary inference or an inference chain in which at least one step is \ncomputationally derived."^^ . _:genid1384 "ECO:MCC"^^ . _:genid1384 "GOC:MC"^^ . . _:genid1385 . _:genid1386 . _:genid1388 _:genid1387 . _:genid1386 _:genid1388 . _:genid1387 . _:genid1387 . _:genid1387 . _:genid1388 . _:genid1385 _:genid1386 . _:genid1385 . . . . "IEA"^^ . "A type of evidence based on computational logical inference that is used in automatic assertion."^^ . "mchibucos"^^ . "2015-07-14T11:35:08Z"^^ . "GO_REF:0000108"^^ . "evidence based on computational logical inference used in automatic assertion" . "eco"^^ . "ECO:0000363"^^ . "computational inference used in automatic assertion"^^ . _:genid1389 . _:genid1389 . _:genid1389 . _:genid1389 . _:genid1389 "true"^^ . _:genid1390 . _:genid1390 . _:genid1390 . _:genid1390 . _:genid1390 "true"^^ . _:genid1391 . _:genid1391 . _:genid1391 . _:genid1391 "A type of evidence based on computational logical inference that is used in automatic assertion."^^ . _:genid1391 "ECO:MCC"^^ . _:genid1392 . _:genid1392 . _:genid1392 . _:genid1392 "GO_REF:0000108"^^ . _:genid1392 "Automatic assignment of GO terms using logical inference, based on on inter-ontology links"^^ . . . "IEA"^^ . "A type of evidence based on logical inference from a manually curated annotation that is used in an automatic assertion."^^ . "mchibucos"^^ . "2015-07-14T11:44:19Z"^^ . "eco"^^ . "ECO:0000364"^^ . "evidence based on logical inference from manual annotation used in automatic assertion"^^ . _:genid1393 . _:genid1393 . _:genid1393 . _:genid1393 "A type of evidence based on logical inference from a manually curated annotation that is used in an automatic assertion."^^ . _:genid1393 "ECO:MCC"^^ . . . "IEA"^^ . "A type of evidence based on logical inference from an automatically curated annotation that is used in an automatic assertion."^^ . "mchibucos"^^ . "2015-07-14T11:45:25Z"^^ . "eco"^^ . "ECO:0000366"^^ . "evidence based on logical inference from automatic annotation used in automatic assertion"^^ . _:genid1394 . _:genid1394 . _:genid1394 . _:genid1394 "A type of evidence based on logical inference from an automatically curated annotation that is used in an automatic assertion."^^ . _:genid1394 "ECO:MCC"^^ . . _:genid1395 . _:genid1396 . _:genid1398 _:genid1397 . _:genid1396 _:genid1398 . _:genid1397 . _:genid1397 . _:genid1397 . _:genid1398 . _:genid1395 _:genid1396 . _:genid1395 . . _:genid1399 . _:genid1399 . _:genid1399 . _:genid1399 . "IEA"^^ . "A type of evidence that is used in an automatic assertion."^^ . "cjm"^^ . "GOECO:IEA"^^ . "GO_REF:0000003"^^ . "GO_REF:0000004"^^ . "GO_REF:0000020"^^ . "GO_REF:0000041"^^ . "GO_REF:0000043"^^ . "GO_REF:0000044"^^ . "GO_REF:0000116"^^ . "IEA"^^ . "inferred from electronic annotation"^^ . "eco"^^ . "ECO:0000501"^^ . . . . "evidence used in automatic assertion"^^ . "http://geneontology.org/page/automatically-assigned-evidence-codes"^^ . _:genid1400 . _:genid1400 . _:genid1400 . _:genid1400 . _:genid1400 "true"^^ . _:genid1401 . _:genid1401 . _:genid1401 . _:genid1402 . _:genid1402 . _:genid1402 . _:genid1401 _:genid1402 . _:genid1401 "true"^^ . _:genid1403 . _:genid1403 . _:genid1403 . _:genid1403 "IEA"^^ . _:genid1403 "Default"^^ . _:genid1404 . _:genid1404 . _:genid1404 . _:genid1404 "A type of evidence that is used in an automatic assertion."^^ . _:genid1404 "ECO:cjm"^^ . _:genid1405 . _:genid1405 . _:genid1405 . _:genid1405 "GOECO:IEA"^^ . _:genid1405 "inferred from electronic annotation"^^ . _:genid1406 . _:genid1406 . _:genid1406 . _:genid1406 "GO_REF:0000003"^^ . _:genid1406 "Gene Ontology annotation based on Enzyme Commission mapping."^^ . _:genid1407 . _:genid1407 . _:genid1407 . _:genid1407 "GO_REF:0000004"^^ . _:genid1407 "Gene Ontology annotation based on Swiss-Prot keyword mapping."^^ . _:genid1408 . _:genid1408 . _:genid1408 . _:genid1408 "GO_REF:0000020"^^ . _:genid1408 "Electronic Gene Ontology annotations created by transferring manual GO annotations between orthologous microbial proteins."^^ . _:genid1409 . _:genid1409 . _:genid1409 . _:genid1409 "GO_REF:0000041"^^ . _:genid1409 "IEA (UniProt UniPathway)"^^ . _:genid1410 . _:genid1410 . _:genid1410 . _:genid1410 "GO_REF:0000043"^^ . _:genid1410 "Gene Ontology annotation based on UniProtKB/Swiss-Prot keyword mapping."^^ . _:genid1411 . _:genid1411 . _:genid1411 . _:genid1411 "GO_REF:0000044"^^ . _:genid1411 "Gene Ontology annotation based on UniProtKB/Swiss-Prot Subcellular Location vocabulary mapping, accompanied by conservative changes to GO terms applied by UniProt."^^ . _:genid1412 . _:genid1412 . _:genid1412 . _:genid1412 "GO_REF:0000116"^^ . _:genid1412 "Automatic Gene Ontology annotation based on Rhea mapping."^^ . _:genid1413 . _:genid1413 . _:genid1413 . _:genid1413 "IEA"^^ . _:genid1413 "GOECO:IEA"^^ . _:genid1414 . _:genid1414 . _:genid1414 . _:genid1414 "inferred from electronic annotation"^^ . _:genid1414 "GOECO:IEA"^^ . . . _:genid1415 . _:genid1415 . _:genid1416 . _:genid1417 . _:genid1419 _:genid1418 . _:genid1417 _:genid1419 . _:genid1418 . _:genid1418 . _:genid1418 . _:genid1419 . _:genid1416 _:genid1417 . _:genid1415 _:genid1416 . _:genid1415 . _:genid1420 . _:genid1420 . _:genid1421 . _:genid1422 . _:genid1424 _:genid1423 . _:genid1422 _:genid1424 . _:genid1423 . _:genid1423 . _:genid1425 . _:genid1425 . _:genid1425 . _:genid1423 _:genid1425 . _:genid1424 . _:genid1421 _:genid1422 . _:genid1420 _:genid1421 . _:genid1420 . "A type of cell proliferation assay evidence resulting from the growth of cells in a micro-environment that mimics real tissue and establishes physiological cell-cell and cell-substrate interactions that regulate proliferation and differentiation."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001001"^^ . "3D cell culture evidence"^^ . _:genid1426 . _:genid1426 . _:genid1426 . _:genid1426 "A type of cell proliferation assay evidence resulting from the growth of cells in a micro-environment that mimics real tissue and establishes physiological cell-cell and cell-substrate interactions that regulate proliferation and differentiation."^^ . _:genid1426 "PMID:21042962"^^ . _:genid1426 "url:http://volttecnologia.com.br/wp-content/uploads/2016/03/Drug-discovery.pdf"^^ . . . _:genid1427 . _:genid1427 . _:genid1427 . _:genid1427 . _:genid1428 . _:genid1428 . _:genid1428 . _:genid1428 . _:genid1429 . _:genid1429 . _:genid1430 . _:genid1431 . _:genid1433 _:genid1432 . _:genid1431 _:genid1433 . _:genid1432 . _:genid1432 . _:genid1434 . _:genid1434 . _:genid1434 . _:genid1432 _:genid1434 . _:genid1433 . _:genid1430 _:genid1431 . _:genid1429 _:genid1430 . _:genid1429 . "A type of cell-based assay evidence resulting from labeling cells with [3H]arachidonic acid and subsequently determining the release of the arachidonic acid by the cells."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001002"^^ . "[3H]arachidonic acid release assay evidence"^^ . _:genid1435 . _:genid1435 . _:genid1435 . _:genid1435 "A type of cell-based assay evidence resulting from labeling cells with [3H]arachidonic acid and subsequently determining the release of the arachidonic acid by the cells."^^ . _:genid1435 "ISBN:0323152295"^^ . _:genid1435 "PMID:20693009"^^ . . . _:genid1436 . _:genid1436 . _:genid1436 . _:genid1436 . "A type of DNA synthesis cell proliferation assay evidence resulting from the measurement of cell proliferation rate by determining the incorporation of [3H]-thymidine into cellular nucleic acids."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001003"^^ . "[3H]-thymidine incorporation assay evidence"^^ . _:genid1437 . _:genid1437 . _:genid1437 . _:genid1437 "A type of DNA synthesis cell proliferation assay evidence resulting from the measurement of cell proliferation rate by determining the incorporation of [3H]-thymidine into cellular nucleic acids."^^ . _:genid1437 "OBI:0000669"^^ . _:genid1437 "url:http://www.scientistsolutions.com/forum/cell-culture-and-tissue-culture-proliferationapoptosis/3h-thymidine-incorporation-assay-rat-1a"^^ . . . _:genid1438 . _:genid1438 . _:genid1438 . _:genid1438 . _:genid1439 . _:genid1439 . _:genid1439 . _:genid1439 . "A type of cytotoxicity assay evidence resulting from the measurement of the amount of radioactive 51Cr released in the supernatant of a sample of 51Cr pre-labeled cells via cytolysis by effector cells (cytotoxic T-cells)."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001004"^^ . "51Cr release assay evidence"^^ . _:genid1440 . _:genid1440 . _:genid1440 . _:genid1440 "A type of cytotoxicity assay evidence resulting from the measurement of the amount of radioactive 51Cr released in the supernatant of a sample of 51Cr pre-labeled cells via cytolysis by effector cells (cytotoxic T-cells)."^^ . _:genid1440 "PMC:3929704"^^ . _:genid1440 "url:http://www4.mpbio.com/ecom/docs/proddata.nsf/5f64ffd4f38c2fda8525645d00769d68/53d2a75653615bab852568cb00572ff3?OpenDocument"^^ . . . "A type of apoptotic assay evidence resulting from the use of 7-aminoactinomycin D (7-AAD) to distinguish viable, apoptotic, and dead cells, using the fact that permeability of the cell membrane, and fluorescence intensity, is low in early apoptotic cells and high in late apoptotic and dead cells."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "7-AAD staining evidence"^^ . "7-amino-actinomycin D staining evidence"^^ . "eco"^^ . "ECO:0001005"^^ . "7-aminoactinomycin staining evidence"^^ . _:genid1441 . _:genid1441 . _:genid1441 . _:genid1441 "A type of apoptotic assay evidence resulting from the use of 7-aminoactinomycin D (7-AAD) to distinguish viable, apoptotic, and dead cells, using the fact that permeability of the cell membrane, and fluorescence intensity, is low in early apoptotic cells and high in late apoptotic and dead cells."^^ . _:genid1441 "ECO:RCT"^^ . . . _:genid1442 . _:genid1442 . _:genid1442 . _:genid1442 . _:genid1443 . _:genid1443 . _:genid1443 . _:genid1443 . _:genid1444 . _:genid1444 . _:genid1445 . _:genid1446 . _:genid1448 _:genid1447 . _:genid1446 _:genid1448 . _:genid1447 . _:genid1447 . _:genid1449 . _:genid1449 . _:genid1449 . _:genid1447 _:genid1449 . _:genid1448 . _:genid1445 _:genid1446 . _:genid1444 _:genid1445 . _:genid1444 . "A type of cell-based assay evidence resulting from the analysis of cell binding either to extracellular matrix proteins or other cells."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001006"^^ . "adhesion assay evidence"^^ . _:genid1450 . _:genid1450 . _:genid1450 . _:genid1450 "A type of cell-based assay evidence resulting from the analysis of cell binding either to extracellular matrix proteins or other cells."^^ . _:genid1450 "PMID:15576904"^^ . _:genid1450 "PMID:21909903"^^ . . . _:genid1451 . _:genid1451 . _:genid1452 . _:genid1453 . _:genid1455 _:genid1454 . _:genid1453 _:genid1455 . _:genid1454 . _:genid1454 . _:genid1454 . _:genid1455 . _:genid1452 _:genid1453 . _:genid1451 _:genid1452 . _:genid1451 . _:genid1456 . _:genid1456 . _:genid1456 . _:genid1456 . _:genid1457 . _:genid1457 . _:genid1458 . _:genid1459 . _:genid1461 _:genid1460 . _:genid1459 _:genid1461 . _:genid1460 . _:genid1460 . _:genid1460 . _:genid1461 . _:genid1458 _:genid1459 . _:genid1457 _:genid1458 . _:genid1457 . "A type of ex vivo assay evidence derived by ex vivo selection of tumor-reactive lymphocytes, and their activation and numerical expansion before re-infusion to the autologous tumor-bearing host."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "Adoptive immunotherapy"^^ . "passive immunization"^^ . "eco"^^ . "ECO:0001007"^^ . "adoptive cell transfer evidence"^^ . _:genid1462 . _:genid1462 . _:genid1462 . _:genid1462 "A type of ex vivo assay evidence derived by ex vivo selection of tumor-reactive lymphocytes, and their activation and numerical expansion before re-infusion to the autologous tumor-bearing host."^^ . _:genid1462 "ECO:SN"^^ . _:genid1462 "url:http://jco.ascopubs.org/content/23/10/2346.full.pdf+html"^^ . _:genid1462 "url:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2305722/pdf/nihms42807.pdf"^^ . . . _:genid1463 . _:genid1463 . _:genid1463 . _:genid1463 . _:genid1464 . _:genid1464 . _:genid1465 . _:genid1466 . _:genid1468 _:genid1467 . _:genid1466 _:genid1468 . _:genid1467 . _:genid1467 . _:genid1467 . _:genid1468 . _:genid1465 _:genid1466 . _:genid1464 _:genid1465 . _:genid1464 . "A type of cell viability assay evidence resulting from the continuous measurement of fluorescence intensity from the viable cells, where a cell permeable compound, resazurin (the active ingredient of alamarBlue), is reduced to fluorescent resorufin."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001008"^^ . "alamarBlue assay evidence"^^ . _:genid1469 . _:genid1469 . _:genid1469 . _:genid1469 "A type of cell viability assay evidence resulting from the continuous measurement of fluorescence intensity from the viable cells, where a cell permeable compound, resazurin (the active ingredient of alamarBlue), is reduced to fluorescent resorufin."^^ . _:genid1469 "PMC:3478843"^^ . _:genid1469 "url:https://www.thermofisher.com/us/en/home/references/protocols/cell-and-tissue-analysis/cell-profilteration-assay-protocols/cell-viability-with-alamarblue.html"^^ . . . _:genid1470 . _:genid1470 . _:genid1471 . _:genid1472 . _:genid1474 _:genid1473 . _:genid1472 _:genid1474 . _:genid1473 . _:genid1473 . _:genid1473 . _:genid1474 . _:genid1471 _:genid1472 . _:genid1470 _:genid1471 . _:genid1470 . "A type of anatomical perturbation phenotypic evidence resulting from the transplantation of an organ or tissue from one individual of the same species with a different genotype."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "Allotransplantation"^^ . "allograft transplantation experiment evidence"^^ . "allografting"^^ . "tissue grafting"^^ . "eco"^^ . "ECO:0001009"^^ . "allograft transplantation phenotypic evidence"^^ . _:genid1475 . _:genid1475 . _:genid1475 . _:genid1475 "A type of anatomical perturbation phenotypic evidence resulting from the transplantation of an organ or tissue from one individual of the same species with a different genotype."^^ . _:genid1475 "ECO:SN"^^ . _:genid1475 "url:http://www.nature.com/subjects/allograft"^^ . _:genid1475 "url:http://www.organdonor.gov/about/terms_and_topics/"^^ . . . "A type of chromatography evidence where a positively charged ion exchange resin with an affinity for molecules having net negative surface charges is used to separate the molecules."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001010"^^ . "anion-exchange chromatography evidence"^^ . _:genid1476 . _:genid1476 . _:genid1476 . _:genid1476 "A type of chromatography evidence where a positively charged ion exchange resin with an affinity for molecules having net negative surface charges is used to separate the molecules."^^ . _:genid1476 "ECO:SN"^^ . _:genid1476 "PMID:20978968"^^ . _:genid1476 "url:http://www.bio-rad.com/en-us/applications-technologies/anion-exchange-chromatography"^^ . _:genid1476 "url:http://www.uta.edu/faculty/sawasthi/Enzymology-4351-5324/Class%20Syllabus%20Enzymology/Ion%20Exchange%20Chromatography-1.pdf"^^ . . . "A type of apoptotic assay evidence resulting from the addition and subsequent binding of Annexin V to phosphatidylserine in cells to detect if they are viable, apoptotic, or necrotic."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001011"^^ . "annexin-V staining evidence"^^ . _:genid1477 . _:genid1477 . _:genid1477 . _:genid1477 "A type of apoptotic assay evidence resulting from the addition and subsequent binding of Annexin V to phosphatidylserine in cells to detect if they are viable, apoptotic, or necrotic."^^ . _:genid1477 "PMC:3169266"^^ . . . "A type of experimental phenotypic evidence resulting from behavioral phenotyping and analysis to assess cognitive functioning."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "behavioral assay evidence"^^ . "eco"^^ . "ECO:0001012"^^ . "cognitive assay phenotypic evidence"^^ . _:genid1478 . _:genid1478 . _:genid1478 . _:genid1478 "A type of experimental phenotypic evidence resulting from behavioral phenotyping and analysis to assess cognitive functioning."^^ . _:genid1478 "PMID:24462904"^^ . . . _:genid1479 . _:genid1479 . _:genid1479 . _:genid1479 . _:genid1480 . _:genid1480 . _:genid1480 . _:genid1480 . "A type of immunological assay evidence resulting from inhibitory effect of monoclonal antibody combining with an antigen over other antibodies."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001013"^^ . "blocking monoclonal antibody evidence"^^ . _:genid1481 . _:genid1481 . _:genid1481 . _:genid1481 "A type of immunological assay evidence resulting from inhibitory effect of monoclonal antibody combining with an antigen over other antibodies."^^ . _:genid1481 "PMID:11292349"^^ . _:genid1481 "url:http://www.sciencedirect.com/science/article/pii/S0140673600034966"^^ . . . _:genid1482 . _:genid1482 . _:genid1482 . _:genid1482 . _:genid1483 . _:genid1483 . _:genid1483 . _:genid1483 . "A type of immunological assay evidence resulting from the use of peptides to block antibodies from binding to their targets."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001014"^^ . "blocking peptide evidence"^^ . _:genid1484 . _:genid1484 . _:genid1484 . _:genid1484 "A type of immunological assay evidence resulting from the use of peptides to block antibodies from binding to their targets."^^ . _:genid1484 "ECO:RCT"^^ . . . "A type of immunological assay evidence resulting from the inhibitory effect of polyclonal antibodies (antibodies secreted by different B cell lineages), which while not reacting with a specific antigen, serve to prevent other antibodies from doing so."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001015"^^ . "blocking polyclonal antibody evidence"^^ . . . _:genid1485 . _:genid1485 . _:genid1486 . _:genid1487 . _:genid1489 _:genid1488 . _:genid1487 _:genid1489 . _:genid1488 . _:genid1488 . _:genid1490 . _:genid1491 . _:genid1493 _:genid1492 . _:genid1491 _:genid1493 . _:genid1492 . _:genid1492 . _:genid1492 . _:genid1493 . _:genid1490 _:genid1491 . _:genid1488 _:genid1490 . _:genid1489 . _:genid1486 _:genid1487 . _:genid1485 _:genid1486 . _:genid1485 . _:genid1494 . _:genid1494 . _:genid1495 . _:genid1496 . _:genid1497 . _:genid1496 _:genid1497 . _:genid1497 . _:genid1495 _:genid1496 . _:genid1494 _:genid1495 . _:genid1494 . "A type of direct assay evidence where a blood sample is extracted from an organism to analyze different blood components."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001016"^^ . "blood test evidence"^^ . _:genid1498 . _:genid1498 . _:genid1498 . _:genid1498 "A type of direct assay evidence where a blood sample is extracted from an organism to analyze different blood components."^^ . _:genid1498 "ECO:SN"^^ . _:genid1498 "url:https://www.nhlbi.nih.gov/health/health-topics/topics/bdt"^^ . . . _:genid1499 . _:genid1499 . _:genid1499 . _:genid1499 . "A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis is determined by measuring the number of cells that migrate from the upper compartment of a chamber (separated by a micro-porous membrane) to the lower compartment, in which chemotactic agents are present."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001017"^^ . "Boyden chamber assay evidence"^^ . _:genid1500 . _:genid1500 . _:genid1500 . _:genid1500 "A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis is determined by measuring the number of cells that migrate from the upper compartment of a chamber (separated by a micro-porous membrane) to the lower compartment, in which chemotactic agents are present."^^ . _:genid1500 "PMID:13872176"^^ . _:genid1500 "PMID:15576901"^^ . . . _:genid1501 . _:genid1501 . _:genid1501 . _:genid1501 . _:genid1502 . _:genid1502 . _:genid1503 . _:genid1504 . _:genid1506 _:genid1505 . _:genid1504 _:genid1506 . _:genid1505 . _:genid1505 . _:genid1507 . _:genid1508 . _:genid1510 _:genid1509 . _:genid1508 _:genid1510 . _:genid1509 . _:genid1509 . _:genid1509 . _:genid1510 . _:genid1507 _:genid1508 . _:genid1505 _:genid1507 . _:genid1506 . _:genid1503 _:genid1504 . _:genid1502 _:genid1503 . _:genid1502 . "A type of nucleotide analog incorporation evidence resulting from the incorporation of bromodeoxyuridine (BrdU) as a thymidine analog into nuclear DNA, resulting in a label that can be tracked using antibody probes."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "ECO:0005010"^^ . "cell proliferation marker detection assay evidence"^^ . "5-bromo-2'-deoxyuridine incorporation assay evidence"^^ . "BUdR incorporation assay evidence"^^ . "BrdU incorporation assay evidence"^^ . "BrdUrd incorporation assay evidence"^^ . "eco"^^ . "ECO:0001018"^^ . "bromodeoxyuridine incorporation assay evidence"^^ . _:genid1511 . _:genid1511 . _:genid1511 . _:genid1511 "A type of nucleotide analog incorporation evidence resulting from the incorporation of bromodeoxyuridine (BrdU) as a thymidine analog into nuclear DNA, resulting in a label that can be tracked using antibody probes."^^ . _:genid1511 "PMID:23690005"^^ . . . "A type of apoptotic assay evidence resulting from the detection of caspase activation, which results in the cleaving of intracellular substrates during apoptosis."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001019"^^ . "caspase assay evidence"^^ . _:genid1512 . _:genid1512 . _:genid1512 . _:genid1512 "A type of apoptotic assay evidence resulting from the detection of caspase activation, which results in the cleaving of intracellular substrates during apoptosis."^^ . _:genid1512 "PMID:18314058"^^ . _:genid1512 "PMID:25086023"^^ . . . _:genid1513 . _:genid1513 . _:genid1513 . _:genid1513 . _:genid1514 . _:genid1514 . _:genid1514 . _:genid1514 . _:genid1515 . _:genid1515 . _:genid1516 . _:genid1517 . _:genid1519 _:genid1518 . _:genid1517 _:genid1519 . _:genid1518 . _:genid1518 . _:genid1520 . _:genid1520 . _:genid1520 . _:genid1518 _:genid1520 . _:genid1519 . _:genid1516 _:genid1517 . _:genid1515 _:genid1516 . _:genid1515 . "A type of cell-based assay evidence resulting from the quantification of a sample of cells."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001020"^^ . "cell counting evidence"^^ . _:genid1521 . _:genid1521 . _:genid1521 . _:genid1521 "A type of cell-based assay evidence resulting from the quantification of a sample of cells."^^ . _:genid1521 "ECO:RCT"^^ . . . _:genid1522 . _:genid1522 . _:genid1522 . _:genid1522 . _:genid1523 . _:genid1523 . _:genid1523 . _:genid1523 . _:genid1524 . _:genid1524 . _:genid1525 . _:genid1526 . _:genid1528 _:genid1527 . _:genid1526 _:genid1528 . _:genid1527 . _:genid1527 . _:genid1529 . _:genid1529 . _:genid1529 . _:genid1527 _:genid1529 . _:genid1528 . _:genid1525 _:genid1526 . _:genid1524 _:genid1525 . _:genid1524 . "A type of cell-based assay evidence resulting from the quantification of cell permeability."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001021"^^ . "cell permeability assay evidence"^^ . _:genid1530 . _:genid1530 . _:genid1530 . _:genid1530 "A type of cell-based assay evidence resulting from the quantification of cell permeability."^^ . _:genid1530 "PMID:16962665"^^ . . . "A type of staining evidence resulting from monitoring division by the use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to label intracellular molecules with carboxyfluorescein; when a labeled cell divides, the number of carboxyfluorescein-tagged molecules is split."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "CFDA-SE staining evidence"^^ . "CFSE-staining evidence"^^ . "eco"^^ . "ECO:0001022"^^ . "carboxyfluorescein diacetate succinimidyl ester staining evidence"^^ . _:genid1531 . _:genid1531 . _:genid1531 . _:genid1531 "A type of staining evidence resulting from monitoring division by the use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to label intracellular molecules with carboxyfluorescein; when a labeled cell divides, the number of carboxyfluorescein-tagged molecules is split."^^ . _:genid1531 "PMC:3185625"^^ . . . "A type of protein detection assay evidence resulting from a complex (a chemiluminescent compound, protein and a steroidal hapten) utilized as a labeled antigen, which emits light when treated with hydrogen peroxide and copper acetate at a high pH."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "CLIA evidence"^^ . "eco"^^ . "ECO:0001023"^^ . "chemiluminescence-linked immunoassay evidence"^^ . _:genid1532 . _:genid1532 . _:genid1532 . _:genid1532 "A type of protein detection assay evidence resulting from a complex (a chemiluminescent compound, protein and a steroidal hapten) utilized as a labeled antigen, which emits light when treated with hydrogen peroxide and copper acetate at a high pH."^^ . _:genid1532 "PMID:659901"^^ . . . "A type of mutant phenotype evidence resulting from the fusion of two or more different genes to create one protein product."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "chimeric protein evidence"^^ . "eco"^^ . "ECO:0001024"^^ . "chimeric protein phenotypic evidence"^^ . _:genid1533 . _:genid1533 . _:genid1533 . _:genid1533 "A type of mutant phenotype evidence resulting from the fusion of two or more different genes to create one protein product."^^ . _:genid1533 "PMID:22588898"^^ . _:genid1533 "PMID:25832756"^^ . . . _:genid1534 . _:genid1534 . _:genid1534 . _:genid1534 . _:genid1535 . _:genid1535 . _:genid1536 . _:genid1537 . _:genid1539 _:genid1538 . _:genid1537 _:genid1539 . _:genid1538 . _:genid1538 . _:genid1540 . _:genid1541 . _:genid1542 . _:genid1541 _:genid1542 . _:genid1542 . _:genid1540 _:genid1541 . _:genid1538 _:genid1540 . _:genid1539 . _:genid1536 _:genid1537 . _:genid1535 _:genid1536 . _:genid1535 . _:genid1543 . _:genid1543 . _:genid1544 . _:genid1545 . _:genid1547 _:genid1546 . _:genid1545 _:genid1547 . _:genid1546 . _:genid1546 . _:genid1546 . _:genid1547 . _:genid1544 _:genid1545 . _:genid1543 _:genid1544 . _:genid1543 . "A type of gel electrophoresis evidence resulting from the electrophoresis of two substances together, allowing for the characterization of ligand/nucleic acid binding interactions."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001025"^^ . "co-electrophoresis evidence"^^ . _:genid1548 . _:genid1548 . _:genid1548 . _:genid1548 "A type of gel electrophoresis evidence resulting from the electrophoresis of two substances together, allowing for the characterization of ligand/nucleic acid binding interactions."^^ . _:genid1548 "PMID:7668395"^^ . . . _:genid1549 . _:genid1549 . _:genid1549 . _:genid1549 . "A type of imaging assay evidence resulting from the limited observation of the co-occurrence of molecules in a subcellular location."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001026"^^ . "co-localization evidence"^^ . _:genid1550 . _:genid1550 . _:genid1550 . _:genid1550 "A type of imaging assay evidence resulting from the limited observation of the co-occurrence of molecules in a subcellular location."^^ . _:genid1550 "PMC:3074624"^^ . . . _:genid1551 . _:genid1551 . _:genid1552 . _:genid1553 . _:genid1555 _:genid1554 . _:genid1553 _:genid1555 . _:genid1554 . _:genid1554 . _:genid1556 . _:genid1556 . _:genid1556 . _:genid1554 _:genid1556 . _:genid1555 . _:genid1552 _:genid1553 . _:genid1551 _:genid1552 . _:genid1551 . _:genid1557 . _:genid1557 . _:genid1558 . _:genid1559 . _:genid1561 _:genid1560 . _:genid1559 _:genid1561 . _:genid1560 . _:genid1560 . _:genid1560 . _:genid1561 . _:genid1558 _:genid1559 . _:genid1557 _:genid1558 . _:genid1557 . "A type of direct assay evidence resulting from the counting of microbial colonies that arise from viable cells grown on a plate or dish."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001027"^^ . "colony counting evidence"^^ . _:genid1562 . _:genid1562 . _:genid1562 . _:genid1562 "A type of direct assay evidence resulting from the counting of microbial colonies that arise from viable cells grown on a plate or dish."^^ . _:genid1562 "PMID:16558698"^^ . _:genid1562 "PMID:23457446"^^ . . . _:genid1563 . _:genid1563 . _:genid1563 . _:genid1563 . "A type of physical interaction evidence resulting from the separation of a mixture of molecules under the influence of a force such as artificial gravity, where molecules sedimenting together are assumed to interact."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001028"^^ . "co-sedimentation assay evidence"^^ . _:genid1564 . _:genid1564 . _:genid1564 . _:genid1564 "A type of physical interaction evidence resulting from the separation of a mixture of molecules under the influence of a force such as artificial gravity, where molecules sedimenting together are assumed to interact."^^ . _:genid1564 "MI:0027"^^ . . . _:genid1565 . _:genid1565 . _:genid1565 . _:genid1565 . _:genid1566 . _:genid1566 . _:genid1566 . _:genid1566 . "A type of gel electrophoresis evidence resulting in the assessment of DNA breakage in a cell, based on size and shape of DNA migration."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001029"^^ . "comet assay evidence"^^ . _:genid1567 . _:genid1567 . _:genid1567 . _:genid1567 "A type of gel electrophoresis evidence resulting in the assessment of DNA breakage in a cell, based on size and shape of DNA migration."^^ . _:genid1567 "OBI:0302736"^^ . _:genid1567 "PMID:10737956"^^ . . . "A type of knockout evidence resulting from a temporally-restricted and/or tissue-specific targeted gene removal."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001030"^^ . "conditional knockout evidence"^^ . _:genid1568 . _:genid1568 . _:genid1568 . _:genid1568 "A type of knockout evidence resulting from a temporally-restricted and/or tissue-specific targeted gene removal."^^ . _:genid1568 "PMC:3572410"^^ . . . "A type of knockin evidence resulting from the targeted introduction of a temporally-restricted and/or tissue-specific mutation."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001031"^^ . "conditional knockin evidence"^^ . _:genid1569 . _:genid1569 . _:genid1569 . _:genid1569 "A type of knockin evidence resulting from the targeted introduction of a temporally-restricted and/or tissue-specific mutation."^^ . _:genid1569 "PMID:16832820"^^ . . . _:genid1570 . _:genid1570 . _:genid1571 . _:genid1572 . _:genid1573 . _:genid1572 _:genid1573 . _:genid1573 . _:genid1571 _:genid1572 . _:genid1570 _:genid1571 . _:genid1570 . _:genid1574 . _:genid1574 . _:genid1575 . _:genid1576 . _:genid1578 _:genid1577 . _:genid1576 _:genid1578 . _:genid1577 . _:genid1577 . _:genid1579 . _:genid1579 . _:genid1579 . _:genid1577 _:genid1579 . _:genid1578 . _:genid1575 _:genid1576 . _:genid1574 _:genid1575 . _:genid1574 . "A type of experimental phenotypic evidence resulting from a constitutively active mutant (CAM), resulting in mutant proteins that remain active in the absence of upstream signals."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001032"^^ . "constitutively active mutant evidence"^^ . _:genid1580 . _:genid1580 . _:genid1580 . _:genid1580 "A type of experimental phenotypic evidence resulting from a constitutively active mutant (CAM), resulting in mutant proteins that remain active in the absence of upstream signals."^^ . _:genid1580 "PMID:12217490"^^ . . . _:genid1581 . _:genid1581 . _:genid1581 . _:genid1581 . _:genid1582 . _:genid1582 . _:genid1582 . _:genid1582 . _:genid1583 . _:genid1583 . _:genid1584 . _:genid1585 . _:genid1587 _:genid1586 . _:genid1585 _:genid1587 . _:genid1586 . _:genid1586 . _:genid1586 . _:genid1587 . _:genid1584 _:genid1585 . _:genid1583 _:genid1584 . _:genid1583 . "To confirm this intriguing observation, we cross-linked AdpA and DNA in the presence of increasing amounts of ATP (figure 2b(iii)). In this assay, ATP prevented the formation of AdpA - DNA complexes in a concentration-dependent manner, an outcome consistent with the results obtained by SPR analysis."^^ . "A type of protein binding evidence resulting from the identification of two interacting proteins (that exist in close proximity) by linking through covalent bonds followed by identification"^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001033"^^ . "cross-linking evidence"^^ . _:genid1588 . _:genid1588 . _:genid1588 . _:genid1588 "To confirm this intriguing observation, we cross-linked AdpA and DNA in the presence of increasing amounts of ATP (figure 2b(iii)). In this assay, ATP prevented the formation of AdpA - DNA complexes in a concentration-dependent manner, an outcome consistent with the results obtained by SPR analysis."^^ . _:genid1588 "PMID:22870392"^^ . _:genid1589 . _:genid1589 . _:genid1589 . _:genid1589 "A type of protein binding evidence resulting from the identification of two interacting proteins (that exist in close proximity) by linking through covalent bonds followed by identification"^^ . _:genid1589 "PMID:15530987"^^ . _:genid1589 "PMID:19241040"^^ . . . "The crystal structures of E. coli MarR and Enterococcus faecalis SlyA-like proteins show their cross-sections are ~70 angstroms, suggesting they would protect ~20 bp of DNA (Alekshun et al., 2001; Wu et al., 2003). This suggests the presence of two SlyA dimers at the SlyA I site and at least three dimers at the SlyA II site."^^ . "A type of structure determination evidence resulting from the use of a narrow beam of x-rays to identify molecular structures by creating a diffraction pattern."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001034"^^ . "crystallography evidence"^^ . _:genid1590 . _:genid1590 . _:genid1590 . _:genid1590 "The crystal structures of E. coli MarR and Enterococcus faecalis SlyA-like proteins show their cross-sections are ~70 angstroms, suggesting they would protect ~20 bp of DNA (Alekshun et al., 2001; Wu et al., 2003). This suggests the presence of two SlyA dimers at the SlyA I site and at least three dimers at the SlyA II site."^^ . _:genid1590 "PMID:17892462"^^ . _:genid1591 . _:genid1591 . _:genid1591 . _:genid1591 "A type of structure determination evidence resulting from the use of a narrow beam of x-rays to identify molecular structures by creating a diffraction pattern."^^ . _:genid1591 "MI:0114"^^ . . . "A type of histochemistry evidence resulting from localizing chemical components of cells and organelles on histological sections."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001035"^^ . "cytochemistry evidence"^^ . _:genid1592 . _:genid1592 . _:genid1592 . _:genid1592 "A type of histochemistry evidence resulting from localizing chemical components of cells and organelles on histological sections."^^ . _:genid1592 "PMID:11597006"^^ . . . _:genid1593 . _:genid1593 . _:genid1594 . _:genid1595 . _:genid1596 . _:genid1595 _:genid1596 . _:genid1596 . _:genid1594 _:genid1595 . _:genid1593 _:genid1594 . _:genid1593 . "A type of apoptotic assay evidence resulting from the identification of an accumulation of cytochrome C in the cytoplasm after its release from the mitochondria, an early event in apoptosis."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001036"^^ . "cytochrome C release assay evidence"^^ . _:genid1597 . _:genid1597 . _:genid1597 . _:genid1597 "A type of apoptotic assay evidence resulting from the identification of an accumulation of cytochrome C in the cytoplasm after its release from the mitochondria, an early event in apoptosis."^^ . _:genid1597 "PMID:10914021"^^ . _:genid1597 "PMID:12815469"^^ . . . "A type of staining evidence resulting from 4',6-diamidino-2-phenylindole (DAPI) binding to AT regions of DNA and emitting a blue fluorescence."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "DAPI staining evidence"^^ . "diaminophenylindole staining"^^ . "eco"^^ . "ECO:0001037"^^ . "4',6-diamidino-2-phenylindole staining evidence"^^ . _:genid1598 . _:genid1598 . _:genid1598 . _:genid1598 "A type of staining evidence resulting from 4',6-diamidino-2-phenylindole (DAPI) binding to AT regions of DNA and emitting a blue fluorescence."^^ . _:genid1598 "PMID:8580206"^^ . _:genid1598 "url:https://www.thermofisher.com/us/en/home/references/protocols/cell-and-tissue-analysis/protocols/dapi-imaging-protocol.html"^^ . . . "In contrast, and in full agreement with the previous results of Wade et al. (17), the longer deletion in the TB23 fragment, that removes MelR binding site 2, results in a sharp reduction in the repression of the melR promoter by MelR."^^ . "A type of mutant phenotype evidence resulting from a mutation in which there is the removal of one or more contiguous nucleotides that may result in altered function or other measurable properties."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "ECO:0005510"^^ . "deletion mutation evidence"^^ . "eco"^^ . "ECO:0001038"^^ . "As a child of 'experimental phenotypic evidence', this is not to be confused with the biological processes deletion mutation / deletion deficiency in which DNA is lost during DNA replication."^^ . "Contrast with knockout phenotypic evidence in which any number of changes to the DNA result in elimination of the function of the gene in question."^^ . "The length of the DNA deleted can range from a single nucleotide to enough material that could include multiple genes."^^ . "deletion mutation phenotypic evidence"^^ . _:genid1599 . _:genid1599 . _:genid1599 . _:genid1599 "In contrast, and in full agreement with the previous results of Wade et al. (17), the longer deletion in the TB23 fragment, that removes MelR binding site 2, results in a sharp reduction in the repression of the melR promoter by MelR."^^ . _:genid1599 "PMID:18346968"^^ . _:genid1600 . _:genid1600 . _:genid1600 . _:genid1600 "A type of mutant phenotype evidence resulting from a mutation in which there is the removal of one or more contiguous nucleotides that may result in altered function or other measurable properties."^^ . _:genid1600 "SO:0000159"^^ . . . _:genid1601 . _:genid1601 . _:genid1601 . _:genid1601 . "A type of apoptotic assay evidence resulting from the visualization via gel electrophoresis of the fragmented DNA (DNA ladder) which is the result of apoptotic DNA fragmentation."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001039"^^ . "DNA laddering assay evidence"^^ . _:genid1602 . _:genid1602 . _:genid1602 . _:genid1602 "A type of apoptotic assay evidence resulting from the visualization via gel electrophoresis of the fragmented DNA (DNA ladder) which is the result of apoptotic DNA fragmentation."^^ . _:genid1602 "PMC:4401164"^^ . . . _:genid1603 . _:genid1603 . _:genid1604 . _:genid1605 . _:genid1607 _:genid1606 . _:genid1605 _:genid1607 . _:genid1606 . _:genid1606 . _:genid1606 . _:genid1607 . _:genid1604 _:genid1605 . _:genid1603 _:genid1604 . _:genid1603 . _:genid1608 . _:genid1608 . _:genid1609 . _:genid1610 . _:genid1612 _:genid1611 . _:genid1610 _:genid1612 . _:genid1611 . _:genid1611 . _:genid1611 . _:genid1612 . _:genid1609 _:genid1610 . _:genid1608 _:genid1609 . _:genid1608 . "A type of RNA detection assay evidence based on the direct application of a RNA mixture in a circular motion on a matrix for hybridization with labeled DNA fragments."^^ . "CollecTF"^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "RNA dot blot"^^ . "ECO:0001040"^^ . "RNA dot blot assay evidence"^^ . _:genid1613 . _:genid1613 . _:genid1613 . _:genid1613 "A type of RNA detection assay evidence based on the direct application of a RNA mixture in a circular motion on a matrix for hybridization with labeled DNA fragments."^^ . _:genid1613 "ECO:SW"^^ . _:genid1613 "PMID:21424648"^^ . . . "A type of mutant phenotype evidence resulting from a mutated gene producing mutant polypeptides that disrupt the activity of the wild-type genes."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "dominant-negative mutant evidence"^^ . "eco"^^ . "ECO:0001042"^^ . "dominant-negative mutant phenotypic evidence"^^ . _:genid1614 . _:genid1614 . _:genid1614 . _:genid1614 "A type of mutant phenotype evidence resulting from a mutated gene producing mutant polypeptides that disrupt the activity of the wild-type genes."^^ . _:genid1614 "PMC:2217636"^^ . _:genid1614 "PMID:8018332"^^ . . _:genid1615 . _:genid1616 . _:genid1618 _:genid1617 . _:genid1616 _:genid1618 . _:genid1617 . _:genid1617 . _:genid1617 . _:genid1618 . _:genid1615 _:genid1616 . _:genid1615 . . . "EXP"^^ . "A type of Edman degradation evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:59:00Z"^^ . "eco"^^ . "ECO:0001043"^^ . "Edman degradation evidence used in manual assertion"^^ . _:genid1619 . _:genid1619 . _:genid1619 . _:genid1619 . _:genid1619 "true"^^ . _:genid1620 . _:genid1620 . _:genid1620 . _:genid1620 "A type of Edman degradation evidence that is used in a manual assertion."^^ . _:genid1620 "ECO:MCC"^^ . . . "A type of protein detection assay evidence resulting from labeling a termonal amino acid residue and cleaving it from a peptide by sequentially removing one residue at a time from the amino end of the peptide, without disrupting the bonds."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001044"^^ . "Edman degradation evidence"^^ . _:genid1621 . _:genid1621 . _:genid1621 . _:genid1621 "A type of protein detection assay evidence resulting from labeling a termonal amino acid residue and cleaving it from a peptide by sequentially removing one residue at a time from the amino end of the peptide, without disrupting the bonds."^^ . _:genid1621 "OBI:0000705"^^ . _:genid1621 "doi:10.3891/acta.chem.scand.04-0283"^^ . . . _:genid1622 . _:genid1622 . _:genid1622 . _:genid1622 . _:genid1623 . _:genid1623 . _:genid1624 . _:genid1625 . _:genid1627 _:genid1626 . _:genid1625 _:genid1627 . _:genid1626 . _:genid1629 _:genid1628 . _:genid1628 . _:genid1628 . _:genid1628 . _:genid1631 _:genid1630 . _:genid1629 _:genid1631 . _:genid1630 . _:genid1630 . _:genid1632 . _:genid1633 . _:genid1635 _:genid1634 . _:genid1633 _:genid1635 . _:genid1634 . _:genid1634 . _:genid1634 . _:genid1635 . _:genid1632 _:genid1633 . _:genid1630 _:genid1632 . _:genid1631 . _:genid1626 _:genid1629 . _:genid1627 . _:genid1624 _:genid1625 . _:genid1623 _:genid1624 . _:genid1623 . "A type of affinity evidence resulting from the quantitative analysis of gene and protein expression monitored by proprietary eTag reporters."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001045"^^ . "eTag assay evidence"^^ . _:genid1636 . _:genid1636 . _:genid1636 . _:genid1636 "A type of affinity evidence resulting from the quantitative analysis of gene and protein expression monitored by proprietary eTag reporters."^^ . _:genid1636 "PMID:15137949"^^ . . . _:genid1637 . _:genid1637 . _:genid1638 . _:genid1639 . _:genid1641 _:genid1640 . _:genid1639 _:genid1641 . _:genid1640 . _:genid1640 . _:genid1640 . _:genid1641 . _:genid1638 _:genid1639 . _:genid1637 _:genid1638 . _:genid1637 . "A type of physical interaction evidence resulting from a mixture of two molecules passed through a nitrocellulose filter, where one may be immobilized on the filter, and if the immobilized molecule is capable of binding to the other, it will be retained on the filter as well."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001046"^^ . "filter binding assay evidence"^^ . _:genid1642 . _:genid1642 . _:genid1642 . _:genid1642 "A type of physical interaction evidence resulting from a mixture of two molecules passed through a nitrocellulose filter, where one may be immobilized on the filter, and if the immobilized molecule is capable of binding to the other, it will be retained on the filter as well."^^ . _:genid1642 "PMID:23028069"^^ . . . . _:genid1643 . _:genid1643 . _:genid1643 . _:genid1643 . _:genid1644 . _:genid1644 . _:genid1644 . _:genid1644 . _:genid1645 . _:genid1645 . _:genid1646 . _:genid1647 . _:genid1649 _:genid1648 . _:genid1647 _:genid1649 . _:genid1648 . _:genid1648 . _:genid1650 . _:genid1650 . _:genid1651 . _:genid1652 . _:genid1654 _:genid1653 . _:genid1652 _:genid1654 . _:genid1653 . _:genid1653 . _:genid1653 . _:genid1654 . _:genid1651 _:genid1652 . _:genid1650 _:genid1651 . _:genid1648 _:genid1650 . _:genid1649 . _:genid1646 _:genid1647 . _:genid1645 _:genid1646 . _:genid1645 . "A type of nucleic acid localization evidence and in situ hybridization evidence resulting from the use of fluorescent probes to detect complementary sequences of nucleic acids."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001047"^^ . "fluorescence in situ hybridization evidence"^^ . _:genid1655 . _:genid1655 . _:genid1655 . _:genid1655 "A type of nucleic acid localization evidence and in situ hybridization evidence resulting from the use of fluorescent probes to detect complementary sequences of nucleic acids."^^ . _:genid1655 "PMC:346675"^^ . _:genid1655 "PMID:6812046"^^ . . . "A type of dynamic fluorescence quenching evidence resulting from the measurement of the proximity of two fluorophores, where the energy from an excited molecular fluorophore to another fluorophore can only occur within ~10nm."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "FRET"^^ . "eco"^^ . "ECO:0001048"^^ . "fluorescence resonance energy transfer evidence"^^ . _:genid1656 . _:genid1656 . _:genid1656 . _:genid1656 "A type of dynamic fluorescence quenching evidence resulting from the measurement of the proximity of two fluorophores, where the energy from an excited molecular fluorophore to another fluorophore can only occur within ~10nm."^^ . _:genid1656 "PMID:11516318"^^ . _:genid1656 "PMID:15696158"^^ . . . _:genid1657 . _:genid1657 . _:genid1658 . _:genid1659 . _:genid1661 _:genid1660 . _:genid1659 _:genid1661 . _:genid1660 . _:genid1660 . _:genid1660 . _:genid1661 . _:genid1658 _:genid1659 . _:genid1657 _:genid1658 . _:genid1657 . "A type of chromatography evidence resulting from the exclusion of proteins based on molecular size by filtration through a porous matrix (swollen gel), from which larger molecules are excluded."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001049"^^ . "gel-filtration evidence"^^ . _:genid1662 . _:genid1662 . _:genid1662 . _:genid1662 "A type of chromatography evidence resulting from the exclusion of proteins based on molecular size by filtration through a porous matrix (swollen gel), from which larger molecules are excluded."^^ . _:genid1662 "CHMO:0001011"^^ . _:genid1662 "doi:10.1038/nmeth0506-410"^^ . . . _:genid1663 . _:genid1663 . _:genid1664 . _:genid1665 . _:genid1667 _:genid1666 . _:genid1665 _:genid1667 . _:genid1666 . _:genid1666 . _:genid1668 . _:genid1668 . _:genid1668 . _:genid1666 _:genid1668 . _:genid1667 . _:genid1664 _:genid1665 . _:genid1663 _:genid1664 . _:genid1663 . "A type of histology evidence resulting from the identification of chemical components in cells and tissues."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001050"^^ . "histochemistry evidence"^^ . _:genid1669 . _:genid1669 . _:genid1669 . _:genid1669 "A type of histology evidence resulting from the identification of chemical components in cells and tissues."^^ . _:genid1669 "MMO:0000497"^^ . . . _:genid1670 . _:genid1670 . _:genid1670 . _:genid1670 . _:genid1671 . _:genid1671 . _:genid1671 . _:genid1671 . "A type of imaging assay evidence resulting from the qualitative microscopic examination of cells or tissues."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001051"^^ . "histology evidence"^^ . _:genid1672 . _:genid1672 . _:genid1672 . _:genid1672 "A type of imaging assay evidence resulting from the qualitative microscopic examination of cells or tissues."^^ . _:genid1672 "OBI:0600020"^^ . . . _:genid1673 . _:genid1673 . _:genid1673 . _:genid1673 . "No OD increases with the mutant and the wild type were measured with DMSO provided as electron acceptor at 2 and 10 mM; however, HPLC analyses of cultures with 2 mM DMSO revealed that DMSO was completely consumed in wild type cultures, whereas no DMSO consumption was evident in the mutant cultures (Figure 3)."^^ . "A type of chromatography evidence resulting from the separation of molecules in a solute by forcing the solvent containing the sample through a column packed with nonporous particles at high pressure."^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "HPLC evidence"^^ . "eco"^^ . "ECO:0001052"^^ . "high-performance liquid chromatography evidence"^^ . _:genid1674 . _:genid1674 . _:genid1674 . _:genid1674 "No OD increases with the mutant and the wild type were measured with DMSO provided as electron acceptor at 2 and 10 mM; however, HPLC analyses of cultures with 2 mM DMSO revealed that DMSO was completely consumed in wild type cultures, whereas no DMSO consumption was evident in the mutant cultures (Figure 3)."^^ . _:genid1674 "PMID:21450087"^^ . _:genid1675 . _:genid1675 . _:genid1675 . _:genid1675 "A type of chromatography evidence resulting from the separation of molecules in a solute by forcing the solvent containing the sample through a column packed with nonporous particles at high pressure."^^ . _:genid1675 "PMID:16376355"^^ . . . "A type of protein detection assay evidence resulting from the use of antibodies linked to coloring agents to localize structures in cell cultures to identify proteins."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001053"^^ . "immunocytochemistry evidence"^^ . _:genid1676 . _:genid1676 . _:genid1676 . _:genid1676 "A type of protein detection assay evidence resulting from the use of antibodies linked to coloring agents to localize structures in cell cultures to identify proteins."^^ . _:genid1676 "MI:1200"^^ . _:genid1676 "OBI:0001986"^^ . . . "A type of immunological assay evidence resulting from the use of antibodies to remove specific proteins from a sample."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001054"^^ . "immunodepletion evidence"^^ . _:genid1677 . _:genid1677 . _:genid1677 . _:genid1677 "A type of immunological assay evidence resulting from the use of antibodies to remove specific proteins from a sample."^^ . _:genid1677 "BAO:0002505"^^ . . . "A type of protein detection assay evidence resulting from the use of antibodies to detect proteins in localized cells of tissue sections."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001055"^^ . "immunohistochemistry evidence"^^ . _:genid1678 . _:genid1678 . _:genid1678 . _:genid1678 "A type of protein detection assay evidence resulting from the use of antibodies to detect proteins in localized cells of tissue sections."^^ . _:genid1678 "OBI:0001986"^^ . . "A type of genetic transformation evidence resulting from a mutation induced by a mutagenic compounds or irradiation."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001056"^^ . "This term was made obsolete for a couple of reasons: the def. doesn\u2019t make sense as the suggested means of mutagenesis fail to introduce exogenous DNA (it is a child of genetic transformation evidence) and the def. is too much like random mutagenesis evidence."^^ . "induced mutation evidence"^^ . "true"^^ . _:genid1679 . _:genid1679 . _:genid1679 . _:genid1679 "A type of genetic transformation evidence resulting from a mutation induced by a mutagenic compounds or irradiation."^^ . _:genid1679 "OBI:0001154"^^ . . . "A type of acetylation assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001057"^^ . "in vitro acetylation assay evidence"^^ . _:genid1680 . _:genid1680 . _:genid1680 . _:genid1680 "A type of acetylation assay evidence used in an in vitro experiment."^^ . _:genid1680 "ECO:SN"^^ . _:genid1680 "SIB:PG"^^ . _:genid1680 "url:http://www.perkinelmer.com/resources/technicalresources/applicationsupportknowledgebase/radiometric/acetylation.xhtml"^^ . . . "A type of cleavage assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001058"^^ . "in vitro cleavage assay evidence"^^ . _:genid1681 . _:genid1681 . _:genid1681 . _:genid1681 "A type of cleavage assay evidence used in an in vitro experiment."^^ . _:genid1681 "PMID:21121091"^^ . . . "A type of deubiquitination assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001059"^^ . "in vitro deubiquitination assay evidence"^^ . _:genid1682 . _:genid1682 . _:genid1682 . _:genid1682 "A type of deubiquitination assay evidence used in an in vitro experiment."^^ . _:genid1682 "ECO:SN"^^ . _:genid1682 "PMID:19692941"^^ . _:genid1682 "SIB:PG"^^ . . . "A type of deacetylation assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001060"^^ . "in vitro deacetylation assay evidence"^^ . _:genid1683 . _:genid1683 . _:genid1683 . _:genid1683 "A type of deacetylation assay evidence used in an in vitro experiment."^^ . _:genid1683 "ECO:SN"^^ . _:genid1683 "SIB:PG"^^ . _:genid1683 "url:http://www.perkinelmer.com/resources/technicalresources/applicationsupportknowledgebase/radiometric/acetylation.xhtml"^^ . . . "A type of defarnesylation assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001061"^^ . "in vitro defarnesylation assay evidence"^^ . _:genid1684 . _:genid1684 . _:genid1684 . _:genid1684 "A type of defarnesylation assay evidence used in an in vitro experiment."^^ . _:genid1684 "ECO:SN"^^ . _:genid1684 "PMID:16126733"^^ . _:genid1684 "SIB:PG"^^ . . . "A type of demethylation assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001062"^^ . "in vitro demethylation assay evidence"^^ . _:genid1685 . _:genid1685 . _:genid1685 . _:genid1685 "A type of demethylation assay evidence used in an in vitro experiment."^^ . _:genid1685 "ECO:SN"^^ . _:genid1685 "SIB:PG"^^ . _:genid1685 "url:http://en.wikipedia.org/wiki/Demethylation"^^ . . . "A type of desumoylation assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001063"^^ . "in vitro desumoylation assay evidence"^^ . _:genid1686 . _:genid1686 . _:genid1686 . _:genid1686 "A type of desumoylation assay evidence used in an in vitro experiment."^^ . _:genid1686 "ECO:SN"^^ . _:genid1686 "SIB:PG"^^ . _:genid1686 "url:http://www.enzolifesciences.com/BML-UW8955/sumoylation-kit/"^^ . . . "A type of farnesylation assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001064"^^ . "in vitro farnesylation assay evidence"^^ . _:genid1687 . _:genid1687 . _:genid1687 . _:genid1687 "A type of farnesylation assay evidence used in an in vitro experiment."^^ . _:genid1687 "ECO:SN"^^ . _:genid1687 "SIB:PG"^^ . _:genid1687 "url:http://en.wikipedia.org/wiki/Farnesyltransferase"^^ . . . "A type of methylation assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001065"^^ . "in vitro methylation assay evidence"^^ . _:genid1688 . _:genid1688 . _:genid1688 . _:genid1688 "A type of methylation assay evidence used in an in vitro experiment."^^ . _:genid1688 "ECO:SN"^^ . _:genid1688 "SIB:PG"^^ . _:genid1688 "url:http://en.wikipedia.org/wiki/Methylation"^^ . . . "A type of palmitoylation assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001066"^^ . "in vitro palmitoylation assay evidence"^^ . _:genid1689 . _:genid1689 . _:genid1689 . _:genid1689 "A type of palmitoylation assay evidence used in an in vitro experiment."^^ . _:genid1689 "ECO:SN"^^ . _:genid1689 "PMID:17077383"^^ . _:genid1689 "SIB:PG"^^ . . . "A type of phosphatase assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001067"^^ . "in vitro phosphatase assay evidence"^^ . _:genid1690 . _:genid1690 . _:genid1690 . _:genid1690 "A type of phosphatase assay evidence used in an in vitro experiment."^^ . _:genid1690 "ECO:SN"^^ . _:genid1690 "SIB:PG"^^ . _:genid1690 "url:http://en.wikipedia.org/wiki/Phosphatase"^^ . . . "A type of protein kinase assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001068"^^ . "in vitro protein kinase assay evidence"^^ . _:genid1691 . _:genid1691 . _:genid1691 . _:genid1691 "A type of protein kinase assay evidence used in an in vitro experiment."^^ . _:genid1691 "ECO:SN"^^ . _:genid1691 "SIB:PG"^^ . _:genid1691 "url:http://en.wikipedia.org/wiki/Protein_kinase"^^ . _:genid1691 "url:http://en.wikipedia.org/wiki/Protein_phosphorylation"^^ . . . "A type of polyADP-ribosylation assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001069"^^ . "in vitro polyADP-ribosylation assay evidence"^^ . _:genid1692 . _:genid1692 . _:genid1692 . _:genid1692 "A type of polyADP-ribosylation assay evidence used in an in vitro experiment."^^ . _:genid1692 "ECO:SN"^^ . _:genid1692 "PMID:21870253"^^ . _:genid1692 "SIB:PG"^^ . . . "A type of sumoylation assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001070"^^ . "in vitro sumoylation assay evidence"^^ . _:genid1693 . _:genid1693 . _:genid1693 . _:genid1693 "A type of sumoylation assay evidence used in an in vitro experiment."^^ . _:genid1693 "ECO:SN"^^ . _:genid1693 "SIB:PG"^^ . _:genid1693 "url:http://www.enzolifesciences.com/BML-UW8955/sumoylation-kit/"^^ . . . "A type of transcription assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001071"^^ . "in vitro transcription assay evidence"^^ . _:genid1694 . _:genid1694 . _:genid1694 . _:genid1694 "A type of transcription assay evidence used in an in vitro experiment."^^ . _:genid1694 "ECO:SN"^^ . _:genid1694 "ECO:SW"^^ . _:genid1694 "PMID:21125481"^^ . _:genid1694 "SIB:PG"^^ . . . "A type of translation assay evidence used in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001072"^^ . "in vitro translation assay evidence"^^ . _:genid1695 . _:genid1695 . _:genid1695 . _:genid1695 "A type of translation assay evidence used in an in vitro experiment."^^ . _:genid1695 "ECO:SN"^^ . _:genid1695 "PMID:18230759"^^ . _:genid1695 "SIB:PG"^^ . . . "A type of ubiquitination assay evidenceused in an in vitro experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001073"^^ . "in vitro ubiquitination assay evidence"^^ . _:genid1696 . _:genid1696 . _:genid1696 . _:genid1696 "A type of ubiquitination assay evidenceused in an in vitro experiment."^^ . _:genid1696 "ECO:SN"^^ . _:genid1696 "PMID:19692941"^^ . _:genid1696 "SIB:PG"^^ . . . "A type of acetylation assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001074"^^ . "in vivo acetylation assay evidence"^^ . _:genid1697 . _:genid1697 . _:genid1697 . _:genid1697 "A type of acetylation assay evidence used in an in vivo experiment."^^ . _:genid1697 "ECO:SN"^^ . _:genid1697 "SIB:PG"^^ . _:genid1697 "url:http://www.perkinelmer.com/resources/technicalresources/applicationsupportknowledgebase/radiometric/acetylation.xhtml"^^ . . . "A type of cleavage assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001075"^^ . "in vivo cleavage assay evidence"^^ . _:genid1698 . _:genid1698 . _:genid1698 . _:genid1698 "A type of cleavage assay evidence used in an in vivo experiment."^^ . _:genid1698 "ECO:SN"^^ . _:genid1698 "PMID:22154596"^^ . . . "A type of deacetylation assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001076"^^ . "in vivo deacetylation assay evidence"^^ . _:genid1699 . _:genid1699 . _:genid1699 . _:genid1699 "A type of deacetylation assay evidence used in an in vivo experiment."^^ . _:genid1699 "ECO:SN"^^ . _:genid1699 "SIB:PG"^^ . _:genid1699 "url:http://www.perkinelmer.com/resources/technicalresources/applicationsupportknowledgebase/radiometric/acetylation.xhtml"^^ . . . "A type of defarnesylation assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001077"^^ . "in vivo defarnesylation assay evidence"^^ . _:genid1700 . _:genid1700 . _:genid1700 . _:genid1700 "A type of defarnesylation assay evidence used in an in vivo experiment."^^ . _:genid1700 "ECO:SN"^^ . _:genid1700 "PMID:15556768"^^ . _:genid1700 "PMID:16507103"^^ . _:genid1700 "SIB:PG"^^ . . . "A type of demethylation assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001078"^^ . "in vivo demethylation assay evidence"^^ . _:genid1701 . _:genid1701 . _:genid1701 . _:genid1701 "A type of demethylation assay evidence used in an in vivo experiment."^^ . _:genid1701 "ECO:SN"^^ . _:genid1701 "SIB:PG"^^ . _:genid1701 "url:http://en.wikipedia.org/wiki/Demethylation"^^ . . . "A type of deubiquitination assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001079"^^ . "in vivo deubiquitination assay evidence"^^ . _:genid1702 . _:genid1702 . _:genid1702 . _:genid1702 "A type of deubiquitination assay evidence used in an in vivo experiment."^^ . _:genid1702 "ECO:SN"^^ . _:genid1702 "PMID:19692941"^^ . _:genid1702 "SIB:PG"^^ . . . "A type of desumoylation assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001080"^^ . "in vivo desumoylation assay evidence"^^ . _:genid1703 . _:genid1703 . _:genid1703 . _:genid1703 "A type of desumoylation assay evidence used in an in vivo experiment."^^ . _:genid1703 "ECO:SN"^^ . _:genid1703 "SIB:PG"^^ . _:genid1703 "url:http://www.enzolifesciences.com/BML-UW8955/sumoylation-kit/"^^ . . . "A type of farnesylation assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001081"^^ . "in vivo farnesylation assay evidence"^^ . _:genid1704 . _:genid1704 . _:genid1704 . _:genid1704 "A type of farnesylation assay evidence used in an in vivo experiment."^^ . _:genid1704 "ECO:SN"^^ . _:genid1704 "PMID:9030603"^^ . _:genid1704 "SIB:PG"^^ . . . "A type of methylation assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001082"^^ . "in vivo methylation assay evidence"^^ . _:genid1705 . _:genid1705 . _:genid1705 . _:genid1705 "A type of methylation assay evidence used in an in vivo experiment."^^ . _:genid1705 "ECO:SN"^^ . _:genid1705 "SIB:PG"^^ . _:genid1705 "url:http://en.wikipedia.org/wiki/Methylation"^^ . . . "A type of palmitoylation assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001083"^^ . "in vivo palmitoylation assay evidence"^^ . _:genid1706 . _:genid1706 . _:genid1706 . _:genid1706 "A type of palmitoylation assay evidence used in an in vivo experiment."^^ . _:genid1706 "ECO:SN"^^ . _:genid1706 "PMID:10329400"^^ . _:genid1706 "SIB:PG"^^ . . . "A type of phosphatase assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001084"^^ . "in vivo phosphatase assay evidence"^^ . _:genid1707 . _:genid1707 . _:genid1707 . _:genid1707 "A type of phosphatase assay evidence used in an in vivo experiment."^^ . _:genid1707 "ECO:SN"^^ . _:genid1707 "SIB:PG"^^ . _:genid1707 "url:http://en.wikipedia.org/wiki/Phosphatase"^^ . . . "A type of protein kinase assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001085"^^ . "in vivo protein kinase assay evidence"^^ . _:genid1708 . _:genid1708 . _:genid1708 . _:genid1708 "A type of protein kinase assay evidence used in an in vivo experiment."^^ . _:genid1708 "ECO:SN"^^ . _:genid1708 "SIB:PG"^^ . _:genid1708 "url:http://en.wikipedia.org/wiki/Protein_kinase"^^ . _:genid1708 "url:http://en.wikipedia.org/wiki/Protein_phosphorylation"^^ . . . "A type of sumoylation assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001086"^^ . "in vivo sumoylation assay evidence"^^ . _:genid1709 . _:genid1709 . _:genid1709 . _:genid1709 "A type of sumoylation assay evidence used in an in vivo experiment."^^ . _:genid1709 "ECO:SN"^^ . _:genid1709 "SIB:PG"^^ . _:genid1709 "url:http://www.enzolifesciences.com/BML-UW8955/sumoylation-kit/"^^ . . . "A type of transcription assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001087"^^ . "in vivo transcription assay evidence"^^ . _:genid1710 . _:genid1710 . _:genid1710 . _:genid1710 "A type of transcription assay evidence used in an in vivo experiment."^^ . _:genid1710 "ECO:SN"^^ . _:genid1710 "PMID:12181418"^^ . _:genid1710 "SIB:PG"^^ . . . _:genid1711 . _:genid1711 . _:genid1711 . _:genid1711 . _:genid1712 . _:genid1712 . _:genid1712 . _:genid1712 . _:genid1713 . _:genid1713 . _:genid1714 . _:genid1715 . _:genid1717 _:genid1716 . _:genid1715 _:genid1717 . _:genid1716 . _:genid1716 . _:genid1718 . _:genid1718 . _:genid1718 . _:genid1716 _:genid1718 . _:genid1717 . _:genid1714 _:genid1715 . _:genid1713 _:genid1714 . _:genid1713 . "A type of translation assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001088"^^ . "in vivo translation assay evidence"^^ . _:genid1719 . _:genid1719 . _:genid1719 . _:genid1719 "A type of translation assay evidence used in an in vivo experiment."^^ . _:genid1719 "ECO:SN"^^ . _:genid1719 "PMID:24901308"^^ . _:genid1719 "SIB:PG"^^ . . . "A type of ubiquitination assay evidence used in an in vivo experiment."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001089"^^ . "in vivo ubiquitination assay evidence"^^ . _:genid1720 . _:genid1720 . _:genid1720 . _:genid1720 "A type of ubiquitination assay evidence used in an in vivo experiment."^^ . _:genid1720 "ECO:SN"^^ . _:genid1720 "PMID:19692941"^^ . _:genid1720 "SIB:PG"^^ . . . _:genid1721 . _:genid1721 . _:genid1722 . _:genid1723 . _:genid1725 _:genid1724 . _:genid1723 _:genid1725 . _:genid1724 . _:genid1724 . _:genid1724 . _:genid1725 . _:genid1722 _:genid1723 . _:genid1721 _:genid1722 . _:genid1721 . "A type of genetic transformation evidence resulting from the targetted replacement of a wild-type DNA sequence with a different sequence."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001090"^^ . "knockin evidence"^^ . _:genid1726 . _:genid1726 . _:genid1726 . _:genid1726 "A type of genetic transformation evidence resulting from the targetted replacement of a wild-type DNA sequence with a different sequence."^^ . _:genid1726 "PMID:18077807"^^ . _:genid1726 "PMID:21800101"^^ . . . _:genid1727 . _:genid1727 . _:genid1728 . _:genid1729 . _:genid1731 _:genid1730 . _:genid1729 _:genid1731 . _:genid1730 . _:genid1730 . _:genid1730 . _:genid1731 . _:genid1728 _:genid1729 . _:genid1727 _:genid1728 . _:genid1727 . "A type of genetic transformation evidence resulting from a change in the DNA that results in the elimination of the function of the gene, allowing for functional analysis."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "knockout evidence"^^ . "gene deletion evidence"^^ . "gene knockout evidence"^^ . "eco"^^ . "ECO:0001091"^^ . "A change in the DNA may result from any number of processes such (deletion, insertion, frame shift, etc.) Additionally, the gene may be made inoperative via homologous recombination, site-specific nucleases, zinc finger nucleases, transcription activator-like effector nucleases (TALENs), or CRISPR (Clustered regularly interspaced short palindromic repeats)."^^ . "Contrast with deletion mutation phenotypic evidence in which DNA is deleted which may result in altering the function of the resulting protein(s)."^^ . "knockout phenotypic evidence"^^ . _:genid1732 . _:genid1732 . _:genid1732 . _:genid1732 "A type of genetic transformation evidence resulting from a change in the DNA that results in the elimination of the function of the gene, allowing for functional analysis."^^ . _:genid1732 "PMC:2782548"^^ . . . _:genid1733 . _:genid1733 . _:genid1734 . _:genid1735 . _:genid1737 _:genid1736 . _:genid1735 _:genid1737 . _:genid1736 . _:genid1736 . _:genid1736 . _:genid1737 . _:genid1734 _:genid1735 . _:genid1733 _:genid1734 . _:genid1733 . _:genid1738 . _:genid1738 . _:genid1738 . _:genid1738 . "A type of physical interaction evidence resulting from the qualitative and quantitative analysis of the affinity with which a protein binds to a lipid."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001092"^^ . "lipid binding assay evidence"^^ . _:genid1739 . _:genid1739 . _:genid1739 . _:genid1739 "A type of physical interaction evidence resulting from the qualitative and quantitative analysis of the affinity with which a protein binds to a lipid."^^ . _:genid1739 "PMID:22848065"^^ . _:genid1739 "PMID:23681540"^^ . . . _:genid1740 . _:genid1740 . _:genid1740 . _:genid1740 . _:genid1741 . _:genid1741 . _:genid1741 . _:genid1741 . "A type of physical interaction evidence resulting from the analysis of protein-protein interactions by use of a luciferase enzyme fused to a particular protein (or proteins), which are coexpressed with epitope-tagged partners in mammalian cells."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "LUMIER assay"^^ . "eco"^^ . "ECO:0001093"^^ . "luminescence-based mammalian interactome mapping assay evidence"^^ . _:genid1742 . _:genid1742 . _:genid1742 . _:genid1742 "A type of physical interaction evidence resulting from the analysis of protein-protein interactions by use of a luciferase enzyme fused to a particular protein (or proteins), which are coexpressed with epitope-tagged partners in mammalian cells."^^ . _:genid1742 "MI:0729"^^ . _:genid1742 "PMID:15761153"^^ . . . "A type of experimental evidence that is visible to the naked eye cf. microscopy evidence which requires the aid of a microscope."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001094"^^ . "macroscopy evidence"^^ . . . "A type of bait-prey hybrid interaction evidence resulting from the analysis of proteins of interest attached to two portions of the transcriptional activator, and in interaction bring the two portions together to increase expression of the reporter gene."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001095"^^ . "mammalian 2-hybrid assay evidence"^^ . _:genid1743 . _:genid1743 . _:genid1743 . _:genid1743 "A type of bait-prey hybrid interaction evidence resulting from the analysis of proteins of interest attached to two portions of the transcriptional activator, and in interaction bring the two portions together to increase expression of the reporter gene."^^ . _:genid1743 "ECO:RCT"^^ . _:genid1743 "PMID:9043710"^^ . . . _:genid1744 . _:genid1744 . _:genid1744 . _:genid1744 . _:genid1745 . _:genid1745 . _:genid1746 . _:genid1747 . _:genid1749 _:genid1748 . _:genid1747 _:genid1749 . _:genid1748 . _:genid1748 . _:genid1748 . _:genid1749 . _:genid1746 _:genid1747 . _:genid1745 _:genid1746 . _:genid1745 . "The MS analyses showed that two VapB10 peaks (836.437, 1584.789 m/z) and three VapC10-His6 peaks (1049.526, 1299.733 and 1455.853 m/z) were detected in MS-DIGEST program, indicating that both VapB10 and VapC10-His6 had the expected peptide masses (Figure S3). These results suggest that VapB10 binds to VapC10-His6 forming the TA complex VapBC10 in vivo, which may cause the counteraction of the VapC10-induced growth arrest (Figure 2)."^^ . "A type of spectrometry evidence resulting from identifying the amount and type of material entities present in a sample by fragmenting it and measuring the mass-to-charge ratio of the resulting particles."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001096"^^ . "mass spectrometry evidence"^^ . _:genid1750 . _:genid1750 . _:genid1750 . _:genid1750 "The MS analyses showed that two VapB10 peaks (836.437, 1584.789 m/z) and three VapC10-His6 peaks (1049.526, 1299.733 and 1455.853 m/z) were detected in MS-DIGEST program, indicating that both VapB10 and VapC10-His6 had the expected peptide masses (Figure S3). These results suggest that VapB10 binds to VapC10-His6 forming the TA complex VapBC10 in vivo, which may cause the counteraction of the VapC10-induced growth arrest (Figure 2)."^^ . _:genid1750 "PMID:24260461"^^ . _:genid1751 . _:genid1751 . _:genid1751 . _:genid1751 "A type of spectrometry evidence resulting from identifying the amount and type of material entities present in a sample by fragmenting it and measuring the mass-to-charge ratio of the resulting particles."^^ . _:genid1751 "OBI:0000470"^^ . . . "A type of imaging assay evidence resulting from the use of technology to visualize and provide information about the body to diagnose, treat, or monitor medical conditions."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001097"^^ . "medical imaging evidence"^^ . _:genid1752 . _:genid1752 . _:genid1752 . _:genid1752 "A type of imaging assay evidence resulting from the use of technology to visualize and provide information about the body to diagnose, treat, or monitor medical conditions."^^ . _:genid1752 "url:http://www.fda.gov/Radiation-EmittingProducts/RadiationEmittingProductsandProcedures/MedicalImaging/ucm2005914.htm"^^ . . . _:genid1753 . _:genid1753 . _:genid1754 . _:genid1755 . _:genid1757 _:genid1756 . _:genid1755 _:genid1757 . _:genid1756 . _:genid1756 . _:genid1756 . _:genid1757 . _:genid1754 _:genid1755 . _:genid1753 _:genid1754 . _:genid1753 . "A type of direct assay evidence resulting from the use of a microscope."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001098"^^ . "Microscopy may include any of the following: optical, electron, scanning probe, or X-ray."^^ . "microscopy evidence"^^ . _:genid1758 . _:genid1758 . _:genid1758 . _:genid1758 "A type of direct assay evidence resulting from the use of a microscope."^^ . _:genid1758 "ECO:MCC"^^ . . . _:genid1759 . _:genid1759 . _:genid1759 . _:genid1759 . _:genid1760 . _:genid1760 . _:genid1760 . _:genid1760 . _:genid1761 . _:genid1761 . _:genid1762 . _:genid1763 . _:genid1765 _:genid1764 . _:genid1763 _:genid1765 . _:genid1764 . _:genid1764 . _:genid1766 . _:genid1766 . _:genid1766 . _:genid1764 _:genid1766 . _:genid1765 . _:genid1762 _:genid1763 . _:genid1761 _:genid1762 . _:genid1761 . "A type of cell-based assay evidence to measure cell motility in which a \"wound\" is created in a cell monolayer and the migration of the cells is captured by imaging at regular intervals during cell migration to close the wound."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "ECO:0001135"^^ . "wound healing assay evidence"^^ . "eco"^^ . "ECO:0001099"^^ . "motility wound healing assay evidence"^^ . . . _:genid1767 . _:genid1767 . _:genid1767 . _:genid1767 . _:genid1768 . _:genid1768 . _:genid1768 . _:genid1768 . _:genid1769 . _:genid1769 . _:genid1770 . _:genid1771 . _:genid1773 _:genid1772 . _:genid1771 _:genid1773 . _:genid1772 . _:genid1772 . _:genid1772 . _:genid1773 . _:genid1770 _:genid1771 . _:genid1769 _:genid1770 . _:genid1769 . "A type of apoptotic assay evidence resulting from the reduction of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) in combination with phenazine methyl sulfate (PMS) as an intermediate electron acceptor reagent to produce a soluble formazan dye in viable cells."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium"^^ . "eco"^^ . "ECO:0001100"^^ . "MTS assay evidence"^^ . _:genid1774 . _:genid1774 . _:genid1774 . _:genid1774 "A type of apoptotic assay evidence resulting from the reduction of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) in combination with phenazine methyl sulfate (PMS) as an intermediate electron acceptor reagent to produce a soluble formazan dye in viable cells."^^ . _:genid1774 "NBK:144065"^^ . _:genid1774 "PMID:1867954"^^ . . . _:genid1775 . _:genid1775 . _:genid1775 . _:genid1775 . _:genid1776 . _:genid1776 . _:genid1776 . _:genid1776 . _:genid1777 . _:genid1777 . _:genid1778 . _:genid1779 . _:genid1781 _:genid1780 . _:genid1779 _:genid1781 . _:genid1780 . _:genid1780 . _:genid1780 . _:genid1781 . _:genid1778 _:genid1779 . _:genid1777 _:genid1778 . _:genid1777 . "A type of apoptotic assay evidence resulting from the reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) to its insoluble purple formazan dye in viable cells and measures cell viability / metabolic activity."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide"^^ . "eco"^^ . "ECO:0001101"^^ . "MTT assay evidence"^^ . _:genid1782 . _:genid1782 . _:genid1782 . _:genid1782 "A type of apoptotic assay evidence resulting from the reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) to its insoluble purple formazan dye in viable cells and measures cell viability / metabolic activity."^^ . _:genid1782 "NBK:144065"^^ . _:genid1782 "PMID:6606682"^^ . . . _:genid1783 . _:genid1783 . _:genid1783 . _:genid1783 . _:genid1784 . _:genid1784 . _:genid1785 . _:genid1786 . _:genid1788 _:genid1787 . _:genid1786 _:genid1788 . _:genid1787 . _:genid1787 . _:genid1789 . _:genid1789 . _:genid1789 . _:genid1787 _:genid1789 . _:genid1788 . _:genid1785 _:genid1786 . _:genid1784 _:genid1785 . _:genid1784 . "A type of protein detection assay evidence resulting from determination of analyte concentration by fluorescent bead sets attached to an antibody (to a specific analyte) with a fluorescent reporter dye label attached to a second antibody (to a specific analyte)."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001102"^^ . "multiplex bead-based immunoassay evidence"^^ . _:genid1790 . _:genid1790 . _:genid1790 . _:genid1790 "A type of protein detection assay evidence resulting from determination of analyte concentration by fluorescent bead sets attached to an antibody (to a specific analyte) with a fluorescent reporter dye label attached to a second antibody (to a specific analyte)."^^ . _:genid1790 "PMC:1534009"^^ . . . "A type of experimental phenotypic evidence resulting from the observation of the impact of a natural mutation on the expressed traits."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001103"^^ . "natural variation mutant evidence"^^ . _:genid1791 . _:genid1791 . _:genid1791 . _:genid1791 "A type of experimental phenotypic evidence resulting from the observation of the impact of a natural mutation on the expressed traits."^^ . _:genid1791 "ECO:RCT"^^ . . . _:genid1792 . _:genid1792 . _:genid1792 . _:genid1792 . "A type of apoptotic assay evidence resulting from the nuclei fragmenting into smaller pieces during programmed cell death."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001104"^^ . "nuclear fragmentation evidence"^^ . _:genid1793 . _:genid1793 . _:genid1793 . _:genid1793 "A type of apoptotic assay evidence resulting from the nuclei fragmenting into smaller pieces during programmed cell death."^^ . _:genid1793 "PMID:16738861"^^ . . . "A type of magnetic resonance evidence in which atomic nuclei in a strong constant magnetic field are perturbed by a weak oscillating magnetic field and the resulting electromagnetic signal is captured."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001105"^^ . "nuclear magnetic resonance evidence"^^ . _:genid1794 . _:genid1794 . _:genid1794 . _:genid1794 "A type of magnetic resonance evidence in which atomic nuclei in a strong constant magnetic field are perturbed by a weak oscillating magnetic field and the resulting electromagnetic signal is captured."^^ . _:genid1794 "url:https://en.wikipedia.org/wiki/Nuclear_magnetic_resonance"^^ . . . _:genid1795 . _:genid1795 . _:genid1796 . _:genid1797 . _:genid1798 . _:genid1797 _:genid1798 . _:genid1798 . _:genid1796 _:genid1797 . _:genid1795 _:genid1796 . _:genid1795 . "A type of RNA detection assay evidence resulting from the detection and quantitation of specific RNAs (from a sample of total cellular RNA) that are bound by antisense RNA or DNA probes and therefore protected from nucleases."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001106"^^ . "nuclease protection assay evidence"^^ . _:genid1799 . _:genid1799 . _:genid1799 . _:genid1799 "A type of RNA detection assay evidence resulting from the detection and quantitation of specific RNAs (from a sample of total cellular RNA) that are bound by antisense RNA or DNA probes and therefore protected from nucleases."^^ . _:genid1799 "PMID:17486122"^^ . _:genid1799 "PMID:18428580"^^ . . . "A type of DNA synthesis cell proliferation assay evidence resulting from the analysis and measurement of the incorporation of fluorescently labeled nucleotide analog(s) into the DNA."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001107"^^ . "nucleotide analog incorporation assay evidence"^^ . _:genid1800 . _:genid1800 . _:genid1800 . _:genid1800 "A type of DNA synthesis cell proliferation assay evidence resulting from the analysis and measurement of the incorporation of fluorescently labeled nucleotide analog(s) into the DNA."^^ . _:genid1800 "PMC:3149870"^^ . . . _:genid1801 . _:genid1801 . _:genid1801 . _:genid1801 . _:genid1802 . _:genid1802 . _:genid1802 . _:genid1802 . _:genid1803 . _:genid1803 . _:genid1804 . _:genid1805 . _:genid1807 _:genid1806 . _:genid1805 _:genid1807 . _:genid1806 . _:genid1806 . _:genid1806 . _:genid1807 . _:genid1804 _:genid1805 . _:genid1803 _:genid1804 . _:genid1803 . "A type of protein binding evidence resulting from the panning of a phage library where the individual phage displayed a different peptide or protein by fusion to coat proteins on the capsid."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001108"^^ . "phage display evidence"^^ . _:genid1808 . _:genid1808 . _:genid1808 . _:genid1808 "A type of protein binding evidence resulting from the panning of a phage library where the individual phage displayed a different peptide or protein by fusion to coat proteins on the capsid."^^ . _:genid1808 "MI:0084"^^ . _:genid1808 "PMID:11680867"^^ . . . "A type of direct assay evidence resulting from the identification of the phosphorylated residue in a protein by amino acid analysis."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001109"^^ . "phosphoamino acid analysis evidence"^^ . _:genid1809 . _:genid1809 . _:genid1809 . _:genid1809 "A type of direct assay evidence resulting from the identification of the phosphorylated residue in a protein by amino acid analysis."^^ . _:genid1809 "PMID:11680867"^^ . _:genid1809 "PMID:18429115"^^ . . . _:genid1810 . _:genid1810 . _:genid1811 . _:genid1812 . _:genid1814 _:genid1813 . _:genid1812 _:genid1814 . _:genid1813 . _:genid1813 . _:genid1813 . _:genid1814 . _:genid1811 _:genid1812 . _:genid1810 _:genid1811 . _:genid1810 . _:genid1815 . _:genid1815 . _:genid1815 . _:genid1815 . "A type of affinity evidence resulting from the appending of affinity tags on proteins so that they may be purified from their biological source using an affinity technique."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "phosphopeptide affinity enrichment evidence"^^ . "eco"^^ . "ECO:0001110"^^ . "peptide affinity enrichment evidence"^^ . . . "A type of direct assay evidence resulting from the physical examination and measurement of the feature of a subject or sample."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001111"^^ . "physical examination evidence"^^ . _:genid1816 . _:genid1816 . _:genid1816 . _:genid1816 "A type of direct assay evidence resulting from the physical examination and measurement of the feature of a subject or sample."^^ . _:genid1816 "ECO:RCT"^^ . . . _:genid1817 . _:genid1817 . _:genid1817 . _:genid1817 . _:genid1818 . _:genid1818 . _:genid1819 . _:genid1820 . _:genid1822 _:genid1821 . _:genid1820 _:genid1822 . _:genid1821 . _:genid1821 . _:genid1823 . _:genid1823 . _:genid1823 . _:genid1821 _:genid1823 . _:genid1822 . _:genid1819 _:genid1820 . _:genid1818 _:genid1819 . _:genid1818 . "A type of protein binding evidence resulting from protein-bound peptides detected from a collection of peptides arranged as an array and incubated with the partner protein in order to map protein-protein interaction sites."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "phosphopeptide array evidence"^^ . "eco"^^ . "ECO:0001112"^^ . "peptide array evidence"^^ . _:genid1824 . _:genid1824 . _:genid1824 . _:genid1824 "A type of protein binding evidence resulting from protein-bound peptides detected from a collection of peptides arranged as an array and incubated with the partner protein in order to map protein-protein interaction sites."^^ . _:genid1824 "PMID:21243154"^^ . . . "A type of mutant phenotype evidence resulting from the change in a single nucleotide."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "point mutation evidence"^^ . "eco"^^ . "ECO:0001113"^^ . "point mutation phenotypic evidence"^^ . _:genid1825 . _:genid1825 . _:genid1825 . _:genid1825 "A type of mutant phenotype evidence resulting from the change in a single nucleotide."^^ . _:genid1825 "SO:1000008"^^ . . . "A type of staining evidence resulting from the binding and labeling of DNA (during apoptosis, when there is a loss of nuclear DNA content) with propidium iodide (PI) to identify the cells from which it originated."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001114"^^ . "propidium iodide staining evidence"^^ . _:genid1826 . _:genid1826 . _:genid1826 . _:genid1826 "A type of staining evidence resulting from the binding and labeling of DNA (during apoptosis, when there is a loss of nuclear DNA content) with propidium iodide (PI) to identify the cells from which it originated."^^ . _:genid1826 "PMID:17406435"^^ . . . _:genid1827 . _:genid1827 . _:genid1828 . _:genid1829 . _:genid1831 _:genid1830 . _:genid1829 _:genid1831 . _:genid1830 . _:genid1830 . _:genid1830 . _:genid1831 . _:genid1828 _:genid1829 . _:genid1827 _:genid1828 . _:genid1827 . "A type of direct assay evidence resulting from the analysis of a molecule by its intrinsic fluorescence, or by attaching it with a fluorophore."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001115"^^ . "fluorescence evidence"^^ . _:genid1832 . _:genid1832 . _:genid1832 . _:genid1832 "A type of direct assay evidence resulting from the analysis of a molecule by its intrinsic fluorescence, or by attaching it with a fluorophore."^^ . _:genid1832 "url:http://www.nature.com/subjects/biological-fluorescence"^^ . . . "A type of protein detection assay evidence resulting from protein samples immobilized on a membrane, then subsequently incubated and imaged."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001116"^^ . "protein dot blot assay evidence"^^ . _:genid1833 . _:genid1833 . _:genid1833 . _:genid1833 "A type of protein detection assay evidence resulting from protein samples immobilized on a membrane, then subsequently incubated and imaged."^^ . _:genid1833 "doi:10.1007/978-94-009-0951-9_24"^^ . . . "A type of protein detection assay evidence resulting from proteins immobilized to prepare protein chips, or microwells, that can be utilized to determine presence of proteins, monitor differential expression profiles, and/or study protein interactions."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001117"^^ . "protein microarray evidence"^^ . _:genid1834 . _:genid1834 . _:genid1834 . _:genid1834 "A type of protein detection assay evidence resulting from proteins immobilized to prepare protein chips, or microwells, that can be utilized to determine presence of proteins, monitor differential expression profiles, and/or study protein interactions."^^ . _:genid1834 "PMC:1828913"^^ . . . "A type of sequencing assay evidence resulting from determining the sequence of amino acids in a protein."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001118"^^ . "protein sequencing assay evidence"^^ . _:genid1835 . _:genid1835 . _:genid1835 . _:genid1835 "A type of sequencing assay evidence resulting from determining the sequence of amino acids in a protein."^^ . _:genid1835 "ERO:0001287"^^ . . . "A type of mass spectrometry evidence resulting from quantitative analysis of peptides, proteins, and proteomes."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001119"^^ . "quantitative mass spectrometry evidence"^^ . _:genid1836 . _:genid1836 . _:genid1836 . _:genid1836 "A type of mass spectrometry evidence resulting from quantitative analysis of peptides, proteins, and proteomes."^^ . _:genid1836 "PMID:22665296"^^ . . . _:genid1837 . _:genid1837 . _:genid1838 . _:genid1839 . _:genid1841 _:genid1840 . _:genid1839 _:genid1841 . _:genid1840 . _:genid1840 . _:genid1842 . _:genid1842 . _:genid1842 . _:genid1840 _:genid1842 . _:genid1841 . _:genid1838 _:genid1839 . _:genid1837 _:genid1838 . _:genid1837 . _:genid1843 . _:genid1843 . _:genid1844 . _:genid1845 . _:genid1847 _:genid1846 . _:genid1845 _:genid1847 . _:genid1846 . _:genid1846 . _:genid1846 . _:genid1847 . _:genid1844 _:genid1845 . _:genid1843 _:genid1844 . _:genid1843 . "A type of direct assay evidence resulting from the assessment of biological reactions by use of a radioactive isotope to label the reactant."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "radioassay"^^ . "radioisotopic assay"^^ . "eco"^^ . "ECO:0001120"^^ . "radioisotope assay evidence"^^ . _:genid1848 . _:genid1848 . _:genid1848 . _:genid1848 "A type of direct assay evidence resulting from the assessment of biological reactions by use of a radioactive isotope to label the reactant."^^ . _:genid1848 "ISBN:978-3-642-50036-7"^^ . . . "A type of protein detection assay evidence resulting from the use of a radioligand to measure the binding of a substance to a specific antibody or other receptor system."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001121"^^ . "radioimmunoassay evidence"^^ . _:genid1849 . _:genid1849 . _:genid1849 . _:genid1849 "A type of protein detection assay evidence resulting from the use of a radioligand to measure the binding of a substance to a specific antibody or other receptor system."^^ . _:genid1849 "MeSH:D011863"^^ . . . "A type of direct assay evidence from the analysis of the real-time interaction between an analyte in solution and its interactant linked to the surface of the resonant mirror."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001123"^^ . "resonant mirror biosensor evidence"^^ . _:genid1850 . _:genid1850 . _:genid1850 . _:genid1850 "A type of direct assay evidence from the analysis of the real-time interaction between an analyte in solution and its interactant linked to the surface of the resonant mirror."^^ . _:genid1850 "PMID:19151938"^^ . . . _:genid1851 . _:genid1851 . _:genid1852 . _:genid1853 . _:genid1855 _:genid1854 . _:genid1853 _:genid1855 . _:genid1854 . _:genid1854 . _:genid1856 . _:genid1856 . _:genid1856 . _:genid1854 _:genid1856 . _:genid1855 . _:genid1852 _:genid1853 . _:genid1851 _:genid1852 . _:genid1851 . _:genid1857 . _:genid1857 . _:genid1858 . _:genid1859 . _:genid1861 _:genid1860 . _:genid1859 _:genid1861 . _:genid1860 . _:genid1860 . _:genid1860 . _:genid1861 . _:genid1858 _:genid1859 . _:genid1857 _:genid1858 . _:genid1857 . "A type of DNA detection assay evidence resulting from homologous DNA fragments digested by restriction enzymes, and the resulting restriction fragments are sorted by length to illustrate differences."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001124"^^ . "restriction fragment detection evidence"^^ . _:genid1862 . _:genid1862 . _:genid1862 . _:genid1862 "A type of DNA detection assay evidence resulting from homologous DNA fragments digested by restriction enzymes, and the resulting restriction fragments are sorted by length to illustrate differences."^^ . _:genid1862 "doi:10.1007/978-94-009-0951-9_24"^^ . _:genid1862 "url:http://www.ncbi.nlm.nih.gov/probe/docs/techrflp/"^^ . . . _:genid1863 . _:genid1863 . _:genid1864 . _:genid1865 . _:genid1867 _:genid1866 . _:genid1865 _:genid1867 . _:genid1866 . _:genid1866 . _:genid1866 . _:genid1867 . _:genid1864 _:genid1865 . _:genid1863 _:genid1864 . _:genid1863 . "A type of spectrometry evidence resulting from the evaluation of a molecule in a fluid or solid by its ability to alter the transmission of light at specific wavelengths."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001126"^^ . "spectrophotometry evidence"^^ . _:genid1868 . _:genid1868 . _:genid1868 . _:genid1868 "A type of spectrometry evidence resulting from the evaluation of a molecule in a fluid or solid by its ability to alter the transmission of light at specific wavelengths."^^ . _:genid1868 "MMO:0000173"^^ . . . _:genid1869 . _:genid1869 . _:genid1869 . _:genid1869 . _:genid1870 . _:genid1870 . _:genid1871 . _:genid1872 . _:genid1874 _:genid1873 . _:genid1872 _:genid1874 . _:genid1873 . _:genid1873 . _:genid1875 . _:genid1876 . _:genid1878 _:genid1877 . _:genid1876 _:genid1878 . _:genid1877 . _:genid1877 . _:genid1877 . _:genid1878 . _:genid1875 _:genid1876 . _:genid1873 _:genid1875 . _:genid1874 . _:genid1871 _:genid1872 . _:genid1870 _:genid1871 . _:genid1870 . "Electrophoretic mobility shift assay (EMSA) and surface plasmon resonance (SPR) demonstrated that AdpAHis6 specifically bound the oriC fragment (283-bp) containing the in silico-predicted A-boxes in a concentration-dependent manner (figures 1b and 2a), but not the remaining part of oriC (data not shown)."^^ . "Further confirmation of the specific interaction was obtained by conducting the competing surface plasmon resonance (SPR) assay with the unlabeled DNA fragments. As shown in Additional file 3, a significantly lower response was observed when either the unlabeled S2 or S5 was added together with MtrA, which indicated that they could compete the binding of MtrA with the promoter DNA on the chip."^^ . "Our SPR analysis revealed that also housekeeping genes required for ribosome function (rplR) and beta subunit RNA polymerase (rpoB) belong to the LexA regulon, a feature of the SOS network not yet observed in bacteria."^^ . "A type of physical interaction evidence based on real-time, rapid plasmon generation on the interface between a planar surface and vacuum that measures changes in refractive index close to the sensor surface when an analyte and its immobilized ligand bind to observe and characterize molecular interaction."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "SPR evidence"^^ . "eco"^^ . "ECO:0001127"^^ . "Plasmons are generated by an incident light beam."^^ . "surface plasmon resonance evidence"^^ . _:genid1879 . _:genid1879 . _:genid1879 . _:genid1879 "Electrophoretic mobility shift assay (EMSA) and surface plasmon resonance (SPR) demonstrated that AdpAHis6 specifically bound the oriC fragment (283-bp) containing the in silico-predicted A-boxes in a concentration-dependent manner (figures 1b and 2a), but not the remaining part of oriC (data not shown)."^^ . _:genid1879 "PMID:22870392"^^ . _:genid1880 . _:genid1880 . _:genid1880 . _:genid1880 "Further confirmation of the specific interaction was obtained by conducting the competing surface plasmon resonance (SPR) assay with the unlabeled DNA fragments. As shown in Additional file 3, a significantly lower response was observed when either the unlabeled S2 or S5 was added together with MtrA, which indicated that they could compete the binding of MtrA with the promoter DNA on the chip."^^ . _:genid1880 "PMID:20843371"^^ . _:genid1881 . _:genid1881 . _:genid1881 . _:genid1881 "Our SPR analysis revealed that also housekeeping genes required for ribosome function (rplR) and beta subunit RNA polymerase (rpoB) belong to the LexA regulon, a feature of the SOS network not yet observed in bacteria."^^ . _:genid1881 "PMID:24713082"^^ . _:genid1882 . _:genid1882 . _:genid1882 . _:genid1882 "A type of physical interaction evidence based on real-time, rapid plasmon generation on the interface between a planar surface and vacuum that measures changes in refractive index close to the sensor surface when an analyte and its immobilized ligand bind to observe and characterize molecular interaction."^^ . _:genid1882 "ECO:SW"^^ . _:genid1882 "PMID:11578932"^^ . _:genid1882 "PMID:19151937"^^ . _:genid1882 "PMID:8574707"^^ . _:genid1883 . _:genid1883 . _:genid1883 . _:genid1883 "SPR evidence"^^ . _:genid1883 "PMID:11578932"^^ . . . _:genid1884 . _:genid1884 . _:genid1885 . _:genid1886 . _:genid1888 _:genid1887 . _:genid1886 _:genid1888 . _:genid1887 . _:genid1887 . _:genid1887 . _:genid1888 . _:genid1885 _:genid1886 . _:genid1884 _:genid1885 . _:genid1884 . "A type of experimental phenotypic evidence resulting from a transplantation in which the transplanted material (stem cells) is from an individual's identical twin."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001128"^^ . "syngeneic transplantation experiment evidence"^^ . _:genid1889 . _:genid1889 . _:genid1889 . _:genid1889 "A type of experimental phenotypic evidence resulting from a transplantation in which the transplanted material (stem cells) is from an individual's identical twin."^^ . _:genid1889 "PMID:18469352"^^ . . . _:genid1890 . _:genid1890 . _:genid1890 . _:genid1890 . _:genid1891 . _:genid1891 . _:genid1891 . _:genid1891 . "A type of enzymatic activity assay evidence resulting from the analysis of tumor necrosis factor (TNF)-a converting enzyme (TACE), which releases a soluble TNF-a from the membrane-bound precursor protein."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "Tumor necrosis factor - alpha converting enzyme activity assay"^^ . "eco"^^ . "ECO:0001129"^^ . "TACE activity assay evidence"^^ . _:genid1892 . _:genid1892 . _:genid1892 . _:genid1892 "A type of enzymatic activity assay evidence resulting from the analysis of tumor necrosis factor (TNF)-a converting enzyme (TACE), which releases a soluble TNF-a from the membrane-bound precursor protein."^^ . _:genid1892 "PMC:1808921"^^ . . . _:genid1893 . _:genid1893 . _:genid1894 . _:genid1895 . _:genid1897 _:genid1896 . _:genid1895 _:genid1897 . _:genid1896 . _:genid1896 . _:genid1898 . _:genid1899 . _:genid1901 _:genid1900 . _:genid1899 _:genid1901 . _:genid1900 . _:genid1900 . _:genid1900 . _:genid1901 . _:genid1898 _:genid1899 . _:genid1896 _:genid1898 . _:genid1897 . _:genid1894 _:genid1895 . _:genid1893 _:genid1894 . _:genid1893 . "A type of cytochemistry evidence resulting from the analysis of section(s) of a paraffin block containing embedded tissues cores arranged in an array pattern."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001130"^^ . "tissue microarray evidence"^^ . _:genid1902 . _:genid1902 . _:genid1902 . _:genid1902 "A type of cytochemistry evidence resulting from the analysis of section(s) of a paraffin block containing embedded tissues cores arranged in an array pattern."^^ . _:genid1902 "PMID:11770905"^^ . . . _:genid1903 . _:genid1903 . _:genid1904 . _:genid1905 . _:genid1907 _:genid1906 . _:genid1905 _:genid1907 . _:genid1906 . _:genid1906 . _:genid1906 . _:genid1907 . _:genid1904 _:genid1905 . _:genid1903 _:genid1904 . _:genid1903 . "A type of genetic transformation evidence resulting from an organism that has had its expressed phenotype altered by modification."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001131"^^ . "transgenic organism evidence"^^ . _:genid1908 . _:genid1908 . _:genid1908 . _:genid1908 "A type of genetic transformation evidence resulting from an organism that has had its expressed phenotype altered by modification."^^ . _:genid1908 "OBI:1000048"^^ . . . _:genid1909 . _:genid1909 . _:genid1909 . _:genid1909 . "A type of mass spectrometry evidence resulting from the analysis of prepared phosphopeptides separated in two dimensions on a TLC plate."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001132"^^ . "tryptic phosphopeptide mapping assay evidence"^^ . _:genid1910 . _:genid1910 . _:genid1910 . _:genid1910 "A type of mass spectrometry evidence resulting from the analysis of prepared phosphopeptides separated in two dimensions on a TLC plate."^^ . _:genid1910 "PMID:18429120"^^ . . . "A type of apoptotic assay evidence resulting from the visualization of DNA fragmentation by detection of exposed 3'-OH ends, localized by terminal deoxynucleotidyl transferase (TdT) which then catalyzes the addition of labeled dUTPs."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "TUNEL assay evidence"^^ . "TdT-mediated dUTP-biotin nick end labeling assay"^^ . "terminal deoxynucleotidyl transferase-dUTP nick end labeling assay evidence"^^ . "eco"^^ . "ECO:0001133"^^ . "terminal deoxynucleotidyl transferase dUTP nick end labeling assay evidence"^^ . _:genid1911 . _:genid1911 . _:genid1911 . _:genid1911 "A type of apoptotic assay evidence resulting from the visualization of DNA fragmentation by detection of exposed 3'-OH ends, localized by terminal deoxynucleotidyl transferase (TdT) which then catalyzes the addition of labeled dUTPs."^^ . _:genid1911 "PMID:22566045"^^ . . . _:genid1912 . _:genid1912 . _:genid1912 . _:genid1912 . _:genid1913 . _:genid1913 . _:genid1914 . _:genid1915 . _:genid1917 _:genid1916 . _:genid1915 _:genid1917 . _:genid1916 . _:genid1916 . _:genid1918 . _:genid1919 . _:genid1921 _:genid1920 . _:genid1919 _:genid1921 . _:genid1920 . _:genid1920 . _:genid1920 . _:genid1921 . _:genid1918 _:genid1919 . _:genid1916 _:genid1918 . _:genid1917 . _:genid1914 _:genid1915 . _:genid1913 _:genid1914 . _:genid1913 . "A type of direct assay evidence resulting from the analysis of a urine sample."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "eco"^^ . "ECO:0001134"^^ . "urine test evidence"^^ . _:genid1922 . _:genid1922 . _:genid1922 . _:genid1922 "A type of direct assay evidence resulting from the analysis of a urine sample."^^ . _:genid1922 "ECO:RCT"^^ . . . _:genid1923 . _:genid1923 . _:genid1924 . _:genid1925 . _:genid1927 _:genid1926 . _:genid1925 _:genid1927 . _:genid1926 . _:genid1926 . _:genid1926 . _:genid1927 . _:genid1924 _:genid1925 . _:genid1923 _:genid1924 . _:genid1923 . _:genid1928 . _:genid1928 . _:genid1929 . _:genid1930 . _:genid1931 . _:genid1930 _:genid1931 . _:genid1931 . _:genid1929 _:genid1930 . _:genid1928 _:genid1929 . _:genid1928 . "A type of cell proliferation assay evidence resulting from the assessment of metabolic activity from a water-soluble tetrazolium salt WST-1 being reduced outside the cell (by reacting with mitochondrial succinate-tetrazolium reductase) to form a formazan dye."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "ECO:0005009"^^ . "metabolic cell proliferation assay evidence"^^ . "eco"^^ . "ECO:0001136"^^ . "WST-1 assay evidence"^^ . _:genid1932 . _:genid1932 . _:genid1932 . _:genid1932 "A type of cell proliferation assay evidence resulting from the assessment of metabolic activity from a water-soluble tetrazolium salt WST-1 being reduced outside the cell (by reacting with mitochondrial succinate-tetrazolium reductase) to form a formazan dye."^^ . _:genid1932 "PMID:18417231"^^ . . . _:genid1933 . _:genid1933 . _:genid1934 . _:genid1935 . _:genid1937 _:genid1936 . _:genid1935 _:genid1937 . _:genid1936 . _:genid1936 . _:genid1936 . _:genid1937 . _:genid1934 _:genid1935 . _:genid1933 _:genid1934 . _:genid1933 . "A type of anatomical perturbation phenotypic evidence resulting from the transplantation, implantation, or infusion of live cells, tissues, or organs between individuals of different species."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-16T11:30:54Z"^^ . "Xenograft transplantation"^^ . "Xenografting"^^ . "Xenotransplantation"^^ . "xenotransplantation experiment evidence"^^ . "tissue grafting"^^ . "eco"^^ . "ECO:0001137"^^ . "xenotransplantation phenotypic evidence"^^ . _:genid1938 . _:genid1938 . _:genid1938 . _:genid1938 "A type of anatomical perturbation phenotypic evidence resulting from the transplantation, implantation, or infusion of live cells, tissues, or organs between individuals of different species."^^ . _:genid1938 "ECO:SN"^^ . _:genid1938 "url:http://ilarjournal.oxfordjournals.org/content/37/1/16.full.pdf+html"^^ . _:genid1938 "url:http://www.fda.gov/BiologicsBloodVaccines/Xenotransplantation/"^^ . . _:genid1939 . _:genid1940 . _:genid1942 _:genid1941 . _:genid1940 _:genid1942 . _:genid1941 . _:genid1941 . _:genid1941 . _:genid1942 . _:genid1939 _:genid1940 . _:genid1939 . . . "IDA"^^ . "A type of 3D cell culture evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T15:18:35Z"^^ . "eco"^^ . "ECO:0001138"^^ . "3D cell culture evidence used in manual assertion"^^ . _:genid1943 . _:genid1943 . _:genid1943 . _:genid1943 . _:genid1943 "true"^^ . _:genid1944 . _:genid1944 . _:genid1944 . _:genid1944 "A type of 3D cell culture evidence that is used in a manual assertion."^^ . _:genid1944 "ECO:MCC"^^ . . _:genid1945 . _:genid1946 . _:genid1948 _:genid1947 . _:genid1946 _:genid1948 . _:genid1947 . _:genid1947 . _:genid1947 . _:genid1948 . _:genid1945 _:genid1946 . _:genid1945 . . . "IDA"^^ . "A type of 51Cr release assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T15:20:55Z"^^ . "eco"^^ . "ECO:0001139"^^ . "51Cr release assay evidence used in manual assertion"^^ . _:genid1949 . _:genid1949 . _:genid1949 . _:genid1949 . _:genid1949 "true"^^ . _:genid1950 . _:genid1950 . _:genid1950 . _:genid1950 "A type of 51Cr release assay evidence that is used in a manual assertion."^^ . _:genid1950 "ECO:MCC"^^ . . _:genid1951 . _:genid1952 . _:genid1954 _:genid1953 . _:genid1952 _:genid1954 . _:genid1953 . _:genid1953 . _:genid1953 . _:genid1954 . _:genid1951 _:genid1952 . _:genid1951 . . . "IDA"^^ . "A type of 7-aminoactinomycin staining evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T15:22:01Z"^^ . "7-AAD staining evidence"^^ . "7-amino-actinomycin D staining evidence"^^ . "eco"^^ . "ECO:0001140"^^ . "7-aminoactinomycin staining evidence used in manual assertion"^^ . _:genid1955 . _:genid1955 . _:genid1955 . _:genid1955 . _:genid1955 "true"^^ . _:genid1956 . _:genid1956 . _:genid1956 . _:genid1956 "A type of 7-aminoactinomycin staining evidence that is used in a manual assertion."^^ . _:genid1956 "ECO:MCC"^^ . . _:genid1957 . _:genid1958 . _:genid1960 _:genid1959 . _:genid1958 _:genid1960 . _:genid1959 . _:genid1959 . _:genid1959 . _:genid1960 . _:genid1957 _:genid1958 . _:genid1957 . . . "IDA"^^ . "A type of [3H]-thymidine incorporation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T15:31:52Z"^^ . "eco"^^ . "ECO:0001141"^^ . "[3H]-thymidine incorporation assay evidence used in manual assertion"^^ . _:genid1961 . _:genid1961 . _:genid1961 . _:genid1961 . _:genid1961 "true"^^ . _:genid1962 . _:genid1962 . _:genid1962 . _:genid1962 "A type of [3H]-thymidine incorporation assay evidence that is used in a manual assertion."^^ . _:genid1962 "ECO:MCC"^^ . . _:genid1963 . _:genid1964 . _:genid1966 _:genid1965 . _:genid1964 _:genid1966 . _:genid1965 . _:genid1965 . _:genid1965 . _:genid1966 . _:genid1963 _:genid1964 . _:genid1963 . . . "IDA"^^ . "A type of [3H]arachidonic acid release assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T15:32:44Z"^^ . "eco"^^ . "ECO:0001142"^^ . "[3H]arachidonic acid release assay evidence used in manual assertion"^^ . _:genid1967 . _:genid1967 . _:genid1967 . _:genid1967 . _:genid1967 "true"^^ . _:genid1968 . _:genid1968 . _:genid1968 . _:genid1968 "A type of [3H]arachidonic acid release assay evidence that is used in a manual assertion."^^ . _:genid1968 "ECO:MCC"^^ . . _:genid1969 . _:genid1970 . _:genid1972 _:genid1971 . _:genid1970 _:genid1972 . _:genid1971 . _:genid1971 . _:genid1971 . _:genid1972 . _:genid1969 _:genid1970 . _:genid1969 . . . "IDA"^^ . "A type of adhesion assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T15:33:38Z"^^ . "eco"^^ . "ECO:0001143"^^ . "adhesion assay evidence used in manual assertion"^^ . _:genid1973 . _:genid1973 . _:genid1973 . _:genid1973 . _:genid1973 "true"^^ . _:genid1974 . _:genid1974 . _:genid1974 . _:genid1974 "A type of adhesion assay evidence that is used in a manual assertion."^^ . _:genid1974 "ECO:MCC"^^ . . _:genid1975 . _:genid1976 . _:genid1978 _:genid1977 . _:genid1976 _:genid1978 . _:genid1977 . _:genid1977 . _:genid1977 . _:genid1978 . _:genid1975 _:genid1976 . _:genid1975 . . . "IDA"^^ . "A type of adoptive cell transfer evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T15:36:19Z"^^ . "Adoptive immunotherapy"^^ . "passive immunization"^^ . "eco"^^ . "ECO:0001144"^^ . "adoptive cell transfer evidence used in manual assertion"^^ . _:genid1979 . _:genid1979 . _:genid1979 . _:genid1979 . _:genid1979 "true"^^ . _:genid1980 . _:genid1980 . _:genid1980 . _:genid1980 "A type of adoptive cell transfer evidence that is used in a manual assertion."^^ . _:genid1980 "ECO:MCC"^^ . . _:genid1981 . _:genid1982 . _:genid1984 _:genid1983 . _:genid1982 _:genid1984 . _:genid1983 . _:genid1983 . _:genid1983 . _:genid1984 . _:genid1981 _:genid1982 . _:genid1981 . . . "IDA"^^ . "A type of alamarBlue assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T15:37:21Z"^^ . "eco"^^ . "ECO:0001145"^^ . "alamarBlue assay evidence used in manual assertion"^^ . _:genid1985 . _:genid1985 . _:genid1985 . _:genid1985 . _:genid1985 "true"^^ . _:genid1986 . _:genid1986 . _:genid1986 . _:genid1986 "A type of alamarBlue assay evidence that is used in a manual assertion."^^ . _:genid1986 "ECO:MCC"^^ . . _:genid1987 . _:genid1988 . _:genid1990 _:genid1989 . _:genid1988 _:genid1990 . _:genid1989 . _:genid1989 . _:genid1989 . _:genid1990 . _:genid1987 _:genid1988 . _:genid1987 . . . "EXP"^^ . "A type of allograft transplantation phenotypic evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T15:38:22Z"^^ . "Allotransplantation"^^ . "allografting"^^ . "allograft transplantation evidence used in manual assertion"^^ . "eco"^^ . "tissue grafting"^^ . "ECO:0001146"^^ . "allograft transplantation phenotypic evidence used in manual assertion"^^ . _:genid1991 . _:genid1991 . _:genid1991 . _:genid1991 . _:genid1991 "true"^^ . _:genid1992 . _:genid1992 . _:genid1992 . _:genid1992 "A type of allograft transplantation phenotypic evidence that is used in a manual assertion."^^ . _:genid1992 "ECO:MCC"^^ . . _:genid1993 . _:genid1994 . _:genid1996 _:genid1995 . _:genid1994 _:genid1996 . _:genid1995 . _:genid1995 . _:genid1995 . _:genid1996 . _:genid1993 _:genid1994 . _:genid1993 . . . "EXP"^^ . "A type of anion-exchange chromatography evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T15:44:30Z"^^ . "eco"^^ . "ECO:0001147"^^ . "anion-exchange chromatography evidence used in manual assertion"^^ . _:genid1997 . _:genid1997 . _:genid1997 . _:genid1997 . _:genid1997 "true"^^ . _:genid1998 . _:genid1998 . _:genid1998 . _:genid1998 "A type of anion-exchange chromatography evidence that is used in a manual assertion."^^ . _:genid1998 "ECO:MCC"^^ . . _:genid1999 . _:genid2000 . _:genid2002 _:genid2001 . _:genid2000 _:genid2002 . _:genid2001 . _:genid2001 . _:genid2001 . _:genid2002 . _:genid1999 _:genid2000 . _:genid1999 . . . "IDA"^^ . "A type of annexin-V staining evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T15:52:01Z"^^ . "eco"^^ . "ECO:0001148"^^ . "annexin-V staining evidence used in manual assertion"^^ . _:genid2003 . _:genid2003 . _:genid2003 . _:genid2003 . _:genid2003 "true"^^ . _:genid2004 . _:genid2004 . _:genid2004 . _:genid2004 "A type of annexin-V staining evidence that is used in a manual assertion."^^ . _:genid2004 "ECO:MCC"^^ . . _:genid2005 . _:genid2006 . _:genid2008 _:genid2007 . _:genid2006 _:genid2008 . _:genid2007 . _:genid2007 . _:genid2007 . _:genid2008 . _:genid2005 _:genid2006 . _:genid2005 . . . "EXP"^^ . "A type of cognitive assay phenotypic evidence used that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T15:53:38Z"^^ . "behavioral assay evidence used in manual assertion"^^ . "eco"^^ . "ECO:0001149"^^ . "cognitive assay phenotypic evidence used in manual assertion"^^ . _:genid2009 . _:genid2009 . _:genid2009 . _:genid2009 . _:genid2009 "true"^^ . _:genid2010 . _:genid2010 . _:genid2010 . _:genid2010 "A type of cognitive assay phenotypic evidence used that is used in a manual assertion."^^ . _:genid2010 "ECO:MCC"^^ . . _:genid2011 . _:genid2012 . _:genid2014 _:genid2013 . _:genid2012 _:genid2014 . _:genid2013 . _:genid2013 . _:genid2013 . _:genid2014 . _:genid2011 _:genid2012 . _:genid2011 . . . "IPI"^^ . "A type of blocking monoclonal antibody evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T15:54:44Z"^^ . "eco"^^ . "ECO:0001150"^^ . "blocking monoclonal antibody evidence used in manual assertion"^^ . _:genid2015 . _:genid2015 . _:genid2015 . _:genid2015 . _:genid2015 "true"^^ . _:genid2016 . _:genid2016 . _:genid2016 . _:genid2016 "A type of blocking monoclonal antibody evidence that is used in a manual assertion."^^ . _:genid2016 "ECO:MCC"^^ . . _:genid2017 . _:genid2018 . _:genid2020 _:genid2019 . _:genid2018 _:genid2020 . _:genid2019 . _:genid2019 . _:genid2019 . _:genid2020 . _:genid2017 _:genid2018 . _:genid2017 . . . "IPI"^^ . "A type of blocking peptide evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T15:55:33Z"^^ . "eco"^^ . "ECO:0001151"^^ . "blocking peptide evidence used in manual assertion"^^ . _:genid2021 . _:genid2021 . _:genid2021 . _:genid2021 . _:genid2021 "true"^^ . _:genid2022 . _:genid2022 . _:genid2022 . _:genid2022 "A type of blocking peptide evidence that is used in a manual assertion."^^ . _:genid2022 "ECO:MCC"^^ . . _:genid2023 . _:genid2024 . _:genid2026 _:genid2025 . _:genid2024 _:genid2026 . _:genid2025 . _:genid2025 . _:genid2025 . _:genid2026 . _:genid2023 _:genid2024 . _:genid2023 . . . "IPI"^^ . "A type of blocking polyclonal antibody evidence tthat is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:01:39Z"^^ . "eco"^^ . "ECO:0001152"^^ . "blocking polyclonal antibody evidence used in manual assertion"^^ . _:genid2027 . _:genid2027 . _:genid2027 . _:genid2027 . _:genid2027 "true"^^ . _:genid2028 . _:genid2028 . _:genid2028 . _:genid2028 "A type of blocking polyclonal antibody evidence tthat is used in a manual assertion."^^ . _:genid2028 "ECO:MCC"^^ . . _:genid2029 . _:genid2030 . _:genid2032 _:genid2031 . _:genid2030 _:genid2032 . _:genid2031 . _:genid2031 . _:genid2031 . _:genid2032 . _:genid2029 _:genid2030 . _:genid2029 . . . "IDA"^^ . "A type of blood test evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:02:47Z"^^ . "eco"^^ . "ECO:0001153"^^ . "blood test evidence used in manual assertion"^^ . _:genid2033 . _:genid2033 . _:genid2033 . _:genid2033 . _:genid2033 "true"^^ . _:genid2034 . _:genid2034 . _:genid2034 . _:genid2034 "A type of blood test evidence that is used in a manual assertion."^^ . _:genid2034 "ECO:MCC"^^ . . _:genid2035 . _:genid2036 . _:genid2038 _:genid2037 . _:genid2036 _:genid2038 . _:genid2037 . _:genid2037 . _:genid2037 . _:genid2038 . _:genid2035 _:genid2036 . _:genid2035 . . . "IDA"^^ . "A type of Boyden chamber assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:03:53Z"^^ . "eco"^^ . "ECO:0001154"^^ . "Boyden chamber assay evidence used in manual assertion"^^ . _:genid2039 . _:genid2039 . _:genid2039 . _:genid2039 . _:genid2039 "true"^^ . _:genid2040 . _:genid2040 . _:genid2040 . _:genid2040 "A type of Boyden chamber assay evidence that is used in a manual assertion."^^ . _:genid2040 "ECO:MCC"^^ . . _:genid2041 . _:genid2042 . _:genid2044 _:genid2043 . _:genid2042 _:genid2044 . _:genid2043 . _:genid2043 . _:genid2043 . _:genid2044 . _:genid2041 _:genid2042 . _:genid2041 . . . "IDA"^^ . "A type of bromodeoxyuridine incorporation assay evidence used in manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:04:49Z"^^ . "5-bromo-2'-deoxyuridine incorporation assay evidence"^^ . "BUdR incorporation assay evidence"^^ . "BrdU incorporation assay evidence"^^ . "BrdUrd incorporation assay evidence"^^ . "eco"^^ . "ECO:0001155"^^ . "bromodeoxyuridine incorporation assay evidence used in manual assertion"^^ . _:genid2045 . _:genid2045 . _:genid2045 . _:genid2045 . _:genid2045 "true"^^ . _:genid2046 . _:genid2046 . _:genid2046 . _:genid2046 "A type of bromodeoxyuridine incorporation assay evidence used in manual assertion."^^ . _:genid2046 "ECO:MCC"^^ . . _:genid2047 . _:genid2048 . _:genid2050 _:genid2049 . _:genid2048 _:genid2050 . _:genid2049 . _:genid2049 . _:genid2049 . _:genid2050 . _:genid2047 _:genid2048 . _:genid2047 . . . "IDA"^^ . "A type of caspase assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:06:06Z"^^ . "eco"^^ . "ECO:0001156"^^ . "caspase assay evidence used in manual assertion"^^ . _:genid2051 . _:genid2051 . _:genid2051 . _:genid2051 . _:genid2051 "true"^^ . _:genid2052 . _:genid2052 . _:genid2052 . _:genid2052 "A type of caspase assay evidence that is used in a manual assertion."^^ . _:genid2052 "ECO:MCC"^^ . . _:genid2053 . _:genid2054 . _:genid2056 _:genid2055 . _:genid2054 _:genid2056 . _:genid2055 . _:genid2055 . _:genid2055 . _:genid2056 . _:genid2053 _:genid2054 . _:genid2053 . . . "IDA"^^ . "A type of cell counting evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:07:13Z"^^ . "eco"^^ . "ECO:0001157"^^ . "cell counting evidence used in manual assertion"^^ . _:genid2057 . _:genid2057 . _:genid2057 . _:genid2057 . _:genid2057 "true"^^ . _:genid2058 . _:genid2058 . _:genid2058 . _:genid2058 "A type of cell counting evidence that is used in a manual assertion."^^ . _:genid2058 "ECO:MCC"^^ . . _:genid2059 . _:genid2060 . _:genid2062 _:genid2061 . _:genid2060 _:genid2062 . _:genid2061 . _:genid2061 . _:genid2061 . _:genid2062 . _:genid2059 _:genid2060 . _:genid2059 . . . "IDA"^^ . "A type of cell permeability assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:07:58Z"^^ . "eco"^^ . "ECO:0001158"^^ . "cell permeability assay evidence used in manual assertion"^^ . _:genid2063 . _:genid2063 . _:genid2063 . _:genid2063 . _:genid2063 "true"^^ . _:genid2064 . _:genid2064 . _:genid2064 . _:genid2064 "A type of cell permeability assay evidence that is used in a manual assertion."^^ . _:genid2064 "ECO:MCC"^^ . . _:genid2065 . _:genid2066 . _:genid2068 _:genid2067 . _:genid2066 _:genid2068 . _:genid2067 . _:genid2067 . _:genid2067 . _:genid2068 . _:genid2065 _:genid2066 . _:genid2065 . . . "IDA"^^ . "A type of carboxyfluorescein diacetate succinimidyl ester staining evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:08:54Z"^^ . "CFDA-SE staining evidence"^^ . "CFSE-staining evidence"^^ . "eco"^^ . "ECO:0001159"^^ . "carboxyfluorescein diacetate succinimidyl ester staining evidence used in manual assertion"^^ . _:genid2069 . _:genid2069 . _:genid2069 . _:genid2069 . _:genid2069 "true"^^ . _:genid2070 . _:genid2070 . _:genid2070 . _:genid2070 "A type of carboxyfluorescein diacetate succinimidyl ester staining evidence that is used in a manual assertion."^^ . _:genid2070 "ECO:MCC"^^ . . _:genid2071 . _:genid2072 . _:genid2074 _:genid2073 . _:genid2072 _:genid2074 . _:genid2073 . _:genid2073 . _:genid2073 . _:genid2074 . _:genid2071 _:genid2072 . _:genid2071 . . . "EXP"^^ . "A type of chemiluminescence-linked immunoassay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:09:55Z"^^ . "CLIA evidence"^^ . "eco"^^ . "ECO:0001160"^^ . "chemiluminescence-linked immunoassay evidence used in manual assertion"^^ . _:genid2075 . _:genid2075 . _:genid2075 . _:genid2075 . _:genid2075 "true"^^ . _:genid2076 . _:genid2076 . _:genid2076 . _:genid2076 "A type of chemiluminescence-linked immunoassay evidence that is used in a manual assertion."^^ . _:genid2076 "ECO:MCC"^^ . . _:genid2077 . _:genid2078 . _:genid2080 _:genid2079 . _:genid2078 _:genid2080 . _:genid2079 . _:genid2079 . _:genid2079 . _:genid2080 . _:genid2077 _:genid2078 . _:genid2077 . . . "IMP"^^ . "A type of chimeric protein phenotypic evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:10:40Z"^^ . "chimeric protein evidence used in manual assertion"^^ . "eco"^^ . "ECO:0001161"^^ . "chimeric protein phenotypic evidence used in manual assertion"^^ . _:genid2081 . _:genid2081 . _:genid2081 . _:genid2081 . _:genid2081 "true"^^ . _:genid2082 . _:genid2082 . _:genid2082 . _:genid2082 "A type of chimeric protein phenotypic evidence that is used in a manual assertion."^^ . _:genid2082 "ECO:MCC"^^ . . _:genid2083 . _:genid2084 . _:genid2086 _:genid2085 . _:genid2084 _:genid2086 . _:genid2085 . _:genid2085 . _:genid2085 . _:genid2086 . _:genid2083 _:genid2084 . _:genid2083 . . . "IDA"^^ . "A type of co-electrophoresis evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:11:22Z"^^ . "eco"^^ . "ECO:0001162"^^ . "co-electrophoresis evidence used in manual assertion"^^ . _:genid2087 . _:genid2087 . _:genid2087 . _:genid2087 . _:genid2087 "true"^^ . _:genid2088 . _:genid2088 . _:genid2088 . _:genid2088 "A type of co-electrophoresis evidence that is used in a manual assertion."^^ . _:genid2088 "ECO:MCC"^^ . . _:genid2089 . _:genid2090 . _:genid2092 _:genid2091 . _:genid2090 _:genid2092 . _:genid2091 . _:genid2091 . _:genid2091 . _:genid2092 . _:genid2089 _:genid2090 . _:genid2089 . . . "IDA"^^ . "A type of co-localization evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:12:04Z"^^ . "eco"^^ . "ECO:0001163"^^ . "co-localization evidence used in manual assertion"^^ . _:genid2093 . _:genid2093 . _:genid2093 . _:genid2093 . _:genid2093 "true"^^ . _:genid2094 . _:genid2094 . _:genid2094 . _:genid2094 "A type of co-localization evidence that is used in a manual assertion."^^ . _:genid2094 "ECO:MCC"^^ . . _:genid2095 . _:genid2096 . _:genid2098 _:genid2097 . _:genid2096 _:genid2098 . _:genid2097 . _:genid2097 . _:genid2097 . _:genid2098 . _:genid2095 _:genid2096 . _:genid2095 . . . "IPI"^^ . "A type of co-sedimentation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:12:55Z"^^ . "eco"^^ . "ECO:0001164"^^ . "co-sedimentation assay evidence used in manual assertion"^^ . _:genid2099 . _:genid2099 . _:genid2099 . _:genid2099 . _:genid2099 "true"^^ . _:genid2100 . _:genid2100 . _:genid2100 . _:genid2100 "A type of co-sedimentation assay evidence that is used in a manual assertion."^^ . _:genid2100 "ECO:MCC"^^ . . _:genid2101 . _:genid2102 . _:genid2104 _:genid2103 . _:genid2102 _:genid2104 . _:genid2103 . _:genid2103 . _:genid2103 . _:genid2104 . _:genid2101 _:genid2102 . _:genid2101 . . . "IDA"^^ . "A type of colony counting evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:14:57Z"^^ . "eco"^^ . "ECO:0001165"^^ . "colony counting evidence used in manual assertion"^^ . _:genid2105 . _:genid2105 . _:genid2105 . _:genid2105 . _:genid2105 "true"^^ . _:genid2106 . _:genid2106 . _:genid2106 . _:genid2106 "A type of colony counting evidence that is used in a manual assertion."^^ . _:genid2106 "ECO:MCC"^^ . . _:genid2107 . _:genid2108 . _:genid2110 _:genid2109 . _:genid2108 _:genid2110 . _:genid2109 . _:genid2109 . _:genid2109 . _:genid2110 . _:genid2107 _:genid2108 . _:genid2107 . . . "IDA"^^ . "A type of comet assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:16:01Z"^^ . "eco"^^ . "ECO:0001166"^^ . "comet assay evidence used in manual assertion"^^ . _:genid2111 . _:genid2111 . _:genid2111 . _:genid2111 . _:genid2111 "true"^^ . _:genid2112 . _:genid2112 . _:genid2112 . _:genid2112 "A type of comet assay evidence that is used in a manual assertion."^^ . _:genid2112 "ECO:MCC"^^ . . _:genid2113 . _:genid2114 . _:genid2116 _:genid2115 . _:genid2114 _:genid2116 . _:genid2115 . _:genid2115 . _:genid2115 . _:genid2116 . _:genid2113 _:genid2114 . _:genid2113 . . . "IMP"^^ . "A type of conditional knockin evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:17:22Z"^^ . "eco"^^ . "ECO:0001167"^^ . "conditional knockin evidence used in manual assertion"^^ . _:genid2117 . _:genid2117 . _:genid2117 . _:genid2117 . _:genid2117 "true"^^ . _:genid2118 . _:genid2118 . _:genid2118 . _:genid2118 "A type of conditional knockin evidence that is used in a manual assertion."^^ . _:genid2118 "ECO:MCC"^^ . . _:genid2119 . _:genid2120 . _:genid2122 _:genid2121 . _:genid2120 _:genid2122 . _:genid2121 . _:genid2121 . _:genid2121 . _:genid2122 . _:genid2119 _:genid2120 . _:genid2119 . . . "IMP"^^ . "A type of conditional knockout evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:17:58Z"^^ . "eco"^^ . "ECO:0001168"^^ . "conditional knockout evidence used in manual assertion"^^ . _:genid2123 . _:genid2123 . _:genid2123 . _:genid2123 . _:genid2123 "true"^^ . _:genid2124 . _:genid2124 . _:genid2124 . _:genid2124 "A type of conditional knockout evidence that is used in a manual assertion."^^ . _:genid2124 "ECO:MCC"^^ . . _:genid2125 . _:genid2126 . _:genid2128 _:genid2127 . _:genid2126 _:genid2128 . _:genid2127 . _:genid2127 . _:genid2127 . _:genid2128 . _:genid2125 _:genid2126 . _:genid2125 . . . "EXP"^^ . "A type of constitutively active mutant evidence that is used a in manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:20:23Z"^^ . "eco"^^ . "ECO:0001169"^^ . "constitutively active mutant evidence used in manual assertion"^^ . _:genid2129 . _:genid2129 . _:genid2129 . _:genid2129 . _:genid2129 "true"^^ . _:genid2130 . _:genid2130 . _:genid2130 . _:genid2130 "A type of constitutively active mutant evidence that is used a in manual assertion."^^ . _:genid2130 "ECO:MCC"^^ . . _:genid2131 . _:genid2132 . _:genid2134 _:genid2133 . _:genid2132 _:genid2134 . _:genid2133 . _:genid2133 . _:genid2133 . _:genid2134 . _:genid2131 _:genid2132 . _:genid2131 . . . "IPI"^^ . "A type of cross-linking evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:21:29Z"^^ . "eco"^^ . "ECO:0001170"^^ . "cross-linking evidence used in manual assertion"^^ . _:genid2135 . _:genid2135 . _:genid2135 . _:genid2135 . _:genid2135 "true"^^ . _:genid2136 . _:genid2136 . _:genid2136 . _:genid2136 "A type of cross-linking evidence that is used in a manual assertion."^^ . _:genid2136 "ECO:MCC"^^ . . _:genid2137 . _:genid2138 . _:genid2140 _:genid2139 . _:genid2138 _:genid2140 . _:genid2139 . _:genid2139 . _:genid2139 . _:genid2140 . _:genid2137 _:genid2138 . _:genid2137 . . . "EXP"^^ . "A type of crystallography evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:22:20Z"^^ . "eco"^^ . "ECO:0001171"^^ . "crystallography evidence used in manual assertion"^^ . _:genid2141 . _:genid2141 . _:genid2141 . _:genid2141 . _:genid2141 "true"^^ . _:genid2142 . _:genid2142 . _:genid2142 . _:genid2142 "A type of crystallography evidence that is used in a manual assertion."^^ . _:genid2142 "ECO:MCC"^^ . . _:genid2143 . _:genid2144 . _:genid2146 _:genid2145 . _:genid2144 _:genid2146 . _:genid2145 . _:genid2145 . _:genid2145 . _:genid2146 . _:genid2143 _:genid2144 . _:genid2143 . . . "IDA"^^ . "A type of cytochemistry evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:23:10Z"^^ . "eco"^^ . "ECO:0001172"^^ . "cytochemistry evidence used in manual assertion"^^ . _:genid2147 . _:genid2147 . _:genid2147 . _:genid2147 . _:genid2147 "true"^^ . _:genid2148 . _:genid2148 . _:genid2148 . _:genid2148 "A type of cytochemistry evidence that is used in a manual assertion."^^ . _:genid2148 "ECO:MCC"^^ . . _:genid2149 . _:genid2150 . _:genid2152 _:genid2151 . _:genid2150 _:genid2152 . _:genid2151 . _:genid2151 . _:genid2151 . _:genid2152 . _:genid2149 _:genid2150 . _:genid2149 . . . "IDA"^^ . "A type of cytochrome C release assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:23:53Z"^^ . "eco"^^ . "ECO:0001173"^^ . "cytochrome C release assay evidence used in manual assertion"^^ . _:genid2153 . _:genid2153 . _:genid2153 . _:genid2153 . _:genid2153 "true"^^ . _:genid2154 . _:genid2154 . _:genid2154 . _:genid2154 "A type of cytochrome C release assay evidence that is used in a manual assertion."^^ . _:genid2154 "ECO:MCC"^^ . . _:genid2155 . _:genid2156 . _:genid2158 _:genid2157 . _:genid2156 _:genid2158 . _:genid2157 . _:genid2157 . _:genid2157 . _:genid2158 . _:genid2155 _:genid2156 . _:genid2155 . . . "IDA"^^ . "A type of 4',6-diamidino-2-phenylindole staining evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:25:03Z"^^ . "DAPI staining evidence"^^ . "eco"^^ . "ECO:0001174"^^ . "4',6-diamidino-2-phenylindole staining evidence used in manual assertion"^^ . _:genid2159 . _:genid2159 . _:genid2159 . _:genid2159 . _:genid2159 "true"^^ . _:genid2160 . _:genid2160 . _:genid2160 . _:genid2160 "A type of 4',6-diamidino-2-phenylindole staining evidence that is used in a manual assertion."^^ . _:genid2160 "ECO:MCC"^^ . . _:genid2161 . _:genid2162 . _:genid2164 _:genid2163 . _:genid2162 _:genid2164 . _:genid2163 . _:genid2163 . _:genid2163 . _:genid2164 . _:genid2161 _:genid2162 . _:genid2161 . . . "IMP"^^ . "A type of deletion mutation phenotypic evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:25:54Z"^^ . "deletion mutation evidence used in manual assertion"^^ . "eco"^^ . "ECO:0001175"^^ . "deletion mutation phenotypic evidence used in manual assertion"^^ . _:genid2165 . _:genid2165 . _:genid2165 . _:genid2165 . _:genid2165 "true"^^ . _:genid2166 . _:genid2166 . _:genid2166 . _:genid2166 "A type of deletion mutation phenotypic evidence that is used in a manual assertion."^^ . _:genid2166 "ECO:MCC"^^ . . _:genid2167 . _:genid2168 . _:genid2170 _:genid2169 . _:genid2168 _:genid2170 . _:genid2169 . _:genid2169 . _:genid2169 . _:genid2170 . _:genid2167 _:genid2168 . _:genid2167 . . . "IDA"^^ . "A type of DNA laddering assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:26:46Z"^^ . "eco"^^ . "ECO:0001176"^^ . "DNA laddering assay evidence used in manual assertion"^^ . _:genid2171 . _:genid2171 . _:genid2171 . _:genid2171 . _:genid2171 "true"^^ . _:genid2172 . _:genid2172 . _:genid2172 . _:genid2172 "A type of DNA laddering assay evidence that is used in a manual assertion."^^ . _:genid2172 "ECO:MCC"^^ . . _:genid2173 . _:genid2174 . _:genid2176 _:genid2175 . _:genid2174 _:genid2176 . _:genid2175 . _:genid2175 . _:genid2175 . _:genid2176 . _:genid2173 _:genid2174 . _:genid2173 . . . "EXP"^^ . "A type of RNA dot blot assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:45:52Z"^^ . "RNA dot blot evidence"^^ . "eco"^^ . "ECO:0001177"^^ . "RNA dot blot assay evidence used in manual assertion"^^ . _:genid2177 . _:genid2177 . _:genid2177 . _:genid2177 . _:genid2177 "true"^^ . _:genid2178 . _:genid2178 . _:genid2178 . _:genid2178 "A type of RNA dot blot assay evidence that is used in a manual assertion."^^ . _:genid2178 "ECO:MCC"^^ . . _:genid2179 . _:genid2180 . _:genid2182 _:genid2181 . _:genid2180 _:genid2182 . _:genid2181 . _:genid2181 . _:genid2181 . _:genid2182 . _:genid2179 _:genid2180 . _:genid2179 . . . "IMP"^^ . "A type of dominant-negative mutant phenotypic evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:47:44Z"^^ . "dominant-negative mutant evidence used in manual assertion"^^ . "eco"^^ . "ECO:0001179"^^ . "dominant-negative mutant phenotypic evidence used in manual assertion"^^ . _:genid2183 . _:genid2183 . _:genid2183 . _:genid2183 . _:genid2183 "true"^^ . _:genid2184 . _:genid2184 . _:genid2184 . _:genid2184 "A type of dominant-negative mutant phenotypic evidence that is used in a manual assertion."^^ . _:genid2184 "ECO:MCC"^^ . . _:genid2185 . _:genid2186 . _:genid2188 _:genid2187 . _:genid2186 _:genid2188 . _:genid2187 . _:genid2187 . _:genid2187 . _:genid2188 . _:genid2185 _:genid2186 . _:genid2185 . . . "IPI"^^ . "A type of eTag assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T16:59:39Z"^^ . "eco"^^ . "ECO:0001180"^^ . "eTag assay evidence used in manual assertion"^^ . _:genid2189 . _:genid2189 . _:genid2189 . _:genid2189 . _:genid2189 "true"^^ . _:genid2190 . _:genid2190 . _:genid2190 . _:genid2190 "A type of eTag assay evidence that is used in a manual assertion."^^ . _:genid2190 "ECO:MCC"^^ . . _:genid2191 . _:genid2192 . _:genid2194 _:genid2193 . _:genid2192 _:genid2194 . _:genid2193 . _:genid2193 . _:genid2193 . _:genid2194 . _:genid2191 _:genid2192 . _:genid2191 . . . "IPI"^^ . "A type of filter binding assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:03:28Z"^^ . "eco"^^ . "ECO:0001181"^^ . "filter binding assay evidence used in manual assertion"^^ . _:genid2195 . _:genid2195 . _:genid2195 . _:genid2195 . _:genid2195 "true"^^ . _:genid2196 . _:genid2196 . _:genid2196 . _:genid2196 "A type of filter binding assay evidence that is used in a manual assertion."^^ . _:genid2196 "ECO:MCC"^^ . . _:genid2197 . _:genid2198 . _:genid2200 _:genid2199 . _:genid2198 _:genid2200 . _:genid2199 . _:genid2199 . _:genid2199 . _:genid2200 . _:genid2197 _:genid2198 . _:genid2197 . . . . "IEP"^^ . "A type of fluorescence in situ hybridization evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:04:20Z"^^ . "eco"^^ . "ECO:0001182"^^ . "fluorescence in situ hybridization evidence used in manual assertion"^^ . _:genid2201 . _:genid2201 . _:genid2201 . _:genid2201 . _:genid2201 "true"^^ . _:genid2202 . _:genid2202 . _:genid2202 . _:genid2202 . _:genid2202 "true"^^ . _:genid2203 . _:genid2203 . _:genid2203 . _:genid2203 "A type of fluorescence in situ hybridization evidence that is used in a manual assertion."^^ . _:genid2203 "ECO:MCC"^^ . . _:genid2204 . _:genid2205 . _:genid2207 _:genid2206 . _:genid2205 _:genid2207 . _:genid2206 . _:genid2206 . _:genid2206 . _:genid2207 . _:genid2204 _:genid2205 . _:genid2204 . . . "IPI"^^ . "A type of fluorescence resonance energy transfer evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:05:22Z"^^ . "FRET evidence"^^ . "eco"^^ . "ECO:0001183"^^ . "fluorescence resonance energy transfer evidence used in manual assertion"^^ . _:genid2208 . _:genid2208 . _:genid2208 . _:genid2208 . _:genid2208 "true"^^ . _:genid2209 . _:genid2209 . _:genid2209 . _:genid2209 "A type of fluorescence resonance energy transfer evidence that is used in a manual assertion."^^ . _:genid2209 "ECO:MCC"^^ . . _:genid2210 . _:genid2211 . _:genid2213 _:genid2212 . _:genid2211 _:genid2213 . _:genid2212 . _:genid2212 . _:genid2212 . _:genid2213 . _:genid2210 _:genid2211 . _:genid2210 . . . "EXP"^^ . "A type of gel-filtration evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:06:14Z"^^ . "eco"^^ . "ECO:0001184"^^ . "gel-filtration evidence used in manual assertion"^^ . _:genid2214 . _:genid2214 . _:genid2214 . _:genid2214 . _:genid2214 "true"^^ . _:genid2215 . _:genid2215 . _:genid2215 . _:genid2215 "A type of gel-filtration evidence that is used in a manual assertion."^^ . _:genid2215 "ECO:MCC"^^ . . _:genid2216 . _:genid2217 . _:genid2219 _:genid2218 . _:genid2217 _:genid2219 . _:genid2218 . _:genid2218 . _:genid2218 . _:genid2219 . _:genid2216 _:genid2217 . _:genid2216 . . . "IDA"^^ . "A type of histochemistry evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:07:19Z"^^ . "eco"^^ . "ECO:0001185"^^ . "histochemistry evidence used in manual assertion"^^ . _:genid2220 . _:genid2220 . _:genid2220 . _:genid2220 . _:genid2220 "true"^^ . _:genid2221 . _:genid2221 . _:genid2221 . _:genid2221 "A type of histochemistry evidence that is used in a manual assertion."^^ . _:genid2221 "ECO:MCC"^^ . . _:genid2222 . _:genid2223 . _:genid2225 _:genid2224 . _:genid2223 _:genid2225 . _:genid2224 . _:genid2224 . _:genid2224 . _:genid2225 . _:genid2222 _:genid2223 . _:genid2222 . . . "EXP"^^ . "A type of immunocytochemistry evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:12:39Z"^^ . "eco"^^ . "ECO:0001186"^^ . "immunocytochemistry evidence used in manual assertion"^^ . _:genid2226 . _:genid2226 . _:genid2226 . _:genid2226 . _:genid2226 "true"^^ . _:genid2227 . _:genid2227 . _:genid2227 . _:genid2227 "A type of immunocytochemistry evidence that is used in a manual assertion."^^ . _:genid2227 "ECO:MCC"^^ . . _:genid2228 . _:genid2229 . _:genid2231 _:genid2230 . _:genid2229 _:genid2231 . _:genid2230 . _:genid2230 . _:genid2230 . _:genid2231 . _:genid2228 _:genid2229 . _:genid2228 . . . "IDA"^^ . "A type of histology evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:09:50Z"^^ . "eco"^^ . "ECO:0001187"^^ . "histology evidence used in manual assertion"^^ . _:genid2232 . _:genid2232 . _:genid2232 . _:genid2232 . _:genid2232 "true"^^ . _:genid2233 . _:genid2233 . _:genid2233 . _:genid2233 "A type of histology evidence that is used in a manual assertion."^^ . _:genid2233 "ECO:MCC"^^ . . _:genid2234 . _:genid2235 . _:genid2237 _:genid2236 . _:genid2235 _:genid2237 . _:genid2236 . _:genid2236 . _:genid2236 . _:genid2237 . _:genid2234 _:genid2235 . _:genid2234 . . . "IPI"^^ . "A type of immunodepletion evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:16:19Z"^^ . "eco"^^ . "ECO:0001188"^^ . "immunodepletion evidence used in manual assertion"^^ . _:genid2238 . _:genid2238 . _:genid2238 . _:genid2238 . _:genid2238 "true"^^ . _:genid2239 . _:genid2239 . _:genid2239 . _:genid2239 "A type of immunodepletion evidence that is used in a manual assertion."^^ . _:genid2239 "ECO:MCC"^^ . . _:genid2240 . _:genid2241 . _:genid2243 _:genid2242 . _:genid2241 _:genid2243 . _:genid2242 . _:genid2242 . _:genid2242 . _:genid2243 . _:genid2240 _:genid2241 . _:genid2240 . . . "EXP"^^ . "A type of immunohistochemistry evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:17:22Z"^^ . "eco"^^ . "ECO:0001189"^^ . "immunohistochemistry evidence used in manual assertion"^^ . _:genid2244 . _:genid2244 . _:genid2244 . _:genid2244 . _:genid2244 "true"^^ . _:genid2245 . _:genid2245 . _:genid2245 . _:genid2245 "A type of immunohistochemistry evidence that is used in a manual assertion."^^ . _:genid2245 "ECO:MCC"^^ . . _:genid2246 . _:genid2247 . _:genid2249 _:genid2248 . _:genid2247 _:genid2249 . _:genid2248 . _:genid2248 . _:genid2248 . _:genid2249 . _:genid2246 _:genid2247 . _:genid2246 . . . "IDA"^^ . "A type of in vitro acetylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:19:24Z"^^ . "eco"^^ . "ECO:0001190"^^ . "in vitro acetylation assay evidence used in manual assertion"^^ . _:genid2250 . _:genid2250 . _:genid2250 . _:genid2250 . _:genid2250 "true"^^ . _:genid2251 . _:genid2251 . _:genid2251 . _:genid2251 "A type of in vitro acetylation assay evidence that is used in a manual assertion."^^ . _:genid2251 "ECO:MCC"^^ . . _:genid2252 . _:genid2253 . _:genid2255 _:genid2254 . _:genid2253 _:genid2255 . _:genid2254 . _:genid2254 . _:genid2254 . _:genid2255 . _:genid2252 _:genid2253 . _:genid2252 . . . "IDA"^^ . "A type of in vitro cleavage assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:21:22Z"^^ . "eco"^^ . "ECO:0001191"^^ . "in vitro cleavage assay evidence used in manual assertion"^^ . _:genid2256 . _:genid2256 . _:genid2256 . _:genid2256 . _:genid2256 "true"^^ . _:genid2257 . _:genid2257 . _:genid2257 . _:genid2257 "A type of in vitro cleavage assay evidence that is used in a manual assertion."^^ . _:genid2257 "ECO:MCC"^^ . . _:genid2258 . _:genid2259 . _:genid2261 _:genid2260 . _:genid2259 _:genid2261 . _:genid2260 . _:genid2260 . _:genid2260 . _:genid2261 . _:genid2258 _:genid2259 . _:genid2258 . . . "IDA"^^ . "A type of in vitro deacetylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:23:42Z"^^ . "eco"^^ . "ECO:0001192"^^ . "in vitro deacetylation assay evidence used in manual assertion"^^ . _:genid2262 . _:genid2262 . _:genid2262 . _:genid2262 . _:genid2262 "true"^^ . _:genid2263 . _:genid2263 . _:genid2263 . _:genid2263 "A type of in vitro deacetylation assay evidence that is used in a manual assertion."^^ . _:genid2263 "ECO:MCC"^^ . . _:genid2264 . _:genid2265 . _:genid2267 _:genid2266 . _:genid2265 _:genid2267 . _:genid2266 . _:genid2266 . _:genid2266 . _:genid2267 . _:genid2264 _:genid2265 . _:genid2264 . . . "IDA"^^ . "A type of in vitro defarnesylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:25:45Z"^^ . "eco"^^ . "ECO:0001193"^^ . "in vitro defarnesylation assay evidence used in manual assertion"^^ . _:genid2268 . _:genid2268 . _:genid2268 . _:genid2268 . _:genid2268 "true"^^ . _:genid2269 . _:genid2269 . _:genid2269 . _:genid2269 "A type of in vitro defarnesylation assay evidence that is used in a manual assertion."^^ . _:genid2269 "ECO:MCC"^^ . . _:genid2270 . _:genid2271 . _:genid2273 _:genid2272 . _:genid2271 _:genid2273 . _:genid2272 . _:genid2272 . _:genid2272 . _:genid2273 . _:genid2270 _:genid2271 . _:genid2270 . . . "IDA"^^ . "A type of in vitro demethylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:27:00Z"^^ . "eco"^^ . "ECO:0001194"^^ . "in vitro demethylation assay evidence used in manual assertion"^^ . _:genid2274 . _:genid2274 . _:genid2274 . _:genid2274 . _:genid2274 "true"^^ . _:genid2275 . _:genid2275 . _:genid2275 . _:genid2275 "A type of in vitro demethylation assay evidence that is used in a manual assertion."^^ . _:genid2275 "ECO:MCC"^^ . . _:genid2276 . _:genid2277 . _:genid2279 _:genid2278 . _:genid2277 _:genid2279 . _:genid2278 . _:genid2278 . _:genid2278 . _:genid2279 . _:genid2276 _:genid2277 . _:genid2276 . . . "IDA"^^ . "A type of in vitro desumoylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:29:01Z"^^ . "eco"^^ . "ECO:0001195"^^ . "in vitro desumoylation assay evidence used in manual assertion"^^ . _:genid2280 . _:genid2280 . _:genid2280 . _:genid2280 . _:genid2280 "true"^^ . _:genid2281 . _:genid2281 . _:genid2281 . _:genid2281 "A type of in vitro desumoylation assay evidence that is used in a manual assertion."^^ . _:genid2281 "ECO:MCC"^^ . . _:genid2282 . _:genid2283 . _:genid2285 _:genid2284 . _:genid2283 _:genid2285 . _:genid2284 . _:genid2284 . _:genid2284 . _:genid2285 . _:genid2282 _:genid2283 . _:genid2282 . . . "IDA"^^ . "A type of in vitro deubiquitination assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:29:48Z"^^ . "eco"^^ . "ECO:0001196"^^ . "in vitro deubiquitination assay evidence used in manual assertion"^^ . _:genid2286 . _:genid2286 . _:genid2286 . _:genid2286 . _:genid2286 "true"^^ . _:genid2287 . _:genid2287 . _:genid2287 . _:genid2287 "A type of in vitro deubiquitination assay evidence that is used in a manual assertion."^^ . _:genid2287 "ECO:MCC"^^ . . _:genid2288 . _:genid2289 . _:genid2291 _:genid2290 . _:genid2289 _:genid2291 . _:genid2290 . _:genid2290 . _:genid2290 . _:genid2291 . _:genid2288 _:genid2289 . _:genid2288 . . . "IDA"^^ . "A type of in vitro farnesylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:30:50Z"^^ . "eco"^^ . "ECO:0001197"^^ . "in vitro farnesylation assay evidence used in manual assertion"^^ . _:genid2292 . _:genid2292 . _:genid2292 . _:genid2292 . _:genid2292 "true"^^ . _:genid2293 . _:genid2293 . _:genid2293 . _:genid2293 "A type of in vitro farnesylation assay evidence that is used in a manual assertion."^^ . _:genid2293 "ECO:MCC"^^ . . _:genid2294 . _:genid2295 . _:genid2297 _:genid2296 . _:genid2295 _:genid2297 . _:genid2296 . _:genid2296 . _:genid2296 . _:genid2297 . _:genid2294 _:genid2295 . _:genid2294 . . . "IDA"^^ . "A type of in vitro methylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:31:54Z"^^ . "eco"^^ . "ECO:0001198"^^ . "in vitro methylation assay evidence used in manual assertion"^^ . _:genid2298 . _:genid2298 . _:genid2298 . _:genid2298 . _:genid2298 "true"^^ . _:genid2299 . _:genid2299 . _:genid2299 . _:genid2299 "A type of in vitro methylation assay evidence that is used in a manual assertion."^^ . _:genid2299 "ECO:MCC"^^ . . _:genid2300 . _:genid2301 . _:genid2303 _:genid2302 . _:genid2301 _:genid2303 . _:genid2302 . _:genid2302 . _:genid2302 . _:genid2303 . _:genid2300 _:genid2301 . _:genid2300 . . . "IDA"^^ . "A type of in vitro palmitoylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:32:57Z"^^ . "eco"^^ . "ECO:0001199"^^ . "in vitro palmitoylation assay evidence used in manual assertion"^^ . _:genid2304 . _:genid2304 . _:genid2304 . _:genid2304 . _:genid2304 "true"^^ . _:genid2305 . _:genid2305 . _:genid2305 . _:genid2305 "A type of in vitro palmitoylation assay evidence that is used in a manual assertion."^^ . _:genid2305 "ECO:MCC"^^ . . _:genid2306 . _:genid2307 . _:genid2309 _:genid2308 . _:genid2307 _:genid2309 . _:genid2308 . _:genid2308 . _:genid2308 . _:genid2309 . _:genid2306 _:genid2307 . _:genid2306 . . . "IDA"^^ . "A type of in vitro phosphatase assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:34:16Z"^^ . "eco"^^ . "ECO:0001200"^^ . "in vitro phosphatase assay evidence used in manual assertion"^^ . _:genid2310 . _:genid2310 . _:genid2310 . _:genid2310 . _:genid2310 "true"^^ . _:genid2311 . _:genid2311 . _:genid2311 . _:genid2311 "A type of in vitro phosphatase assay evidence that is used in a manual assertion."^^ . _:genid2311 "ECO:MCC"^^ . . _:genid2312 . _:genid2313 . _:genid2315 _:genid2314 . _:genid2313 _:genid2315 . _:genid2314 . _:genid2314 . _:genid2314 . _:genid2315 . _:genid2312 _:genid2313 . _:genid2312 . . . "IDA"^^ . "A type of in vitro polyADP-ribosylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:34:57Z"^^ . "eco"^^ . "ECO:0001201"^^ . "in vitro polyADP-ribosylation assay evidence used in manual assertion"^^ . _:genid2316 . _:genid2316 . _:genid2316 . _:genid2316 . _:genid2316 "true"^^ . _:genid2317 . _:genid2317 . _:genid2317 . _:genid2317 "A type of in vitro polyADP-ribosylation assay evidence that is used in a manual assertion."^^ . _:genid2317 "ECO:MCC"^^ . . _:genid2318 . _:genid2319 . _:genid2321 _:genid2320 . _:genid2319 _:genid2321 . _:genid2320 . _:genid2320 . _:genid2320 . _:genid2321 . _:genid2318 _:genid2319 . _:genid2318 . . . "IDA"^^ . "A type of in vitro protein kinase assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:39:57Z"^^ . "eco"^^ . "ECO:0001202"^^ . "in vitro protein kinase assay evidence used in manual assertion"^^ . _:genid2322 . _:genid2322 . _:genid2322 . _:genid2322 . _:genid2322 "true"^^ . _:genid2323 . _:genid2323 . _:genid2323 . _:genid2323 "A type of in vitro protein kinase assay evidence that is used in a manual assertion."^^ . _:genid2323 "ECO:MCC"^^ . . _:genid2324 . _:genid2325 . _:genid2327 _:genid2326 . _:genid2325 _:genid2327 . _:genid2326 . _:genid2326 . _:genid2326 . _:genid2327 . _:genid2324 _:genid2325 . _:genid2324 . . . "IDA"^^ . "A type of in vitro sumoylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:41:25Z"^^ . "eco"^^ . "ECO:0001203"^^ . "in vitro sumoylation assay evidence used in manual assertion"^^ . _:genid2328 . _:genid2328 . _:genid2328 . _:genid2328 . _:genid2328 "true"^^ . _:genid2329 . _:genid2329 . _:genid2329 . _:genid2329 "A type of in vitro sumoylation assay evidence that is used in a manual assertion."^^ . _:genid2329 "ECO:MCC"^^ . . _:genid2330 . _:genid2331 . _:genid2333 _:genid2332 . _:genid2331 _:genid2333 . _:genid2332 . _:genid2332 . _:genid2332 . _:genid2333 . _:genid2330 _:genid2331 . _:genid2330 . . . "IDA"^^ . "A type of in vitro transcription assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:44:40Z"^^ . "eco"^^ . "ECO:0001204"^^ . "in vitro transcription assay evidence used in manual assertion"^^ . _:genid2334 . _:genid2334 . _:genid2334 . _:genid2334 . _:genid2334 "true"^^ . _:genid2335 . _:genid2335 . _:genid2335 . _:genid2335 "A type of in vitro transcription assay evidence that is used in a manual assertion."^^ . _:genid2335 "ECO:MCC"^^ . . _:genid2336 . _:genid2337 . _:genid2339 _:genid2338 . _:genid2337 _:genid2339 . _:genid2338 . _:genid2338 . _:genid2338 . _:genid2339 . _:genid2336 _:genid2337 . _:genid2336 . . . "IDA"^^ . "A type of in vitro translation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:46:30Z"^^ . "eco"^^ . "ECO:0001205"^^ . "in vitro translation assay evidence used in manual assertion"^^ . _:genid2340 . _:genid2340 . _:genid2340 . _:genid2340 . _:genid2340 "true"^^ . _:genid2341 . _:genid2341 . _:genid2341 . _:genid2341 "A type of in vitro translation assay evidence that is used in a manual assertion."^^ . _:genid2341 "ECO:MCC"^^ . . _:genid2342 . _:genid2343 . _:genid2345 _:genid2344 . _:genid2343 _:genid2345 . _:genid2344 . _:genid2344 . _:genid2344 . _:genid2345 . _:genid2342 _:genid2343 . _:genid2342 . . . "IDA"^^ . "A type of in vitro ubiquitination assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:47:18Z"^^ . "eco"^^ . "ECO:0001206"^^ . "in vitro ubiquitination assay evidence used in manual assertion"^^ . _:genid2346 . _:genid2346 . _:genid2346 . _:genid2346 . _:genid2346 "true"^^ . _:genid2347 . _:genid2347 . _:genid2347 . _:genid2347 "A type of in vitro ubiquitination assay evidence that is used in a manual assertion."^^ . _:genid2347 "ECO:MCC"^^ . . _:genid2348 . _:genid2349 . _:genid2351 _:genid2350 . _:genid2349 _:genid2351 . _:genid2350 . _:genid2350 . _:genid2350 . _:genid2351 . _:genid2348 _:genid2349 . _:genid2348 . . . "IDA"^^ . "A type of in vivo acetylation assay evidence that is used in manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:48:56Z"^^ . "eco"^^ . "ECO:0001207"^^ . "in vivo acetylation assay evidence used in manual assertion"^^ . _:genid2352 . _:genid2352 . _:genid2352 . _:genid2352 . _:genid2352 "true"^^ . _:genid2353 . _:genid2353 . _:genid2353 . _:genid2353 "A type of in vivo acetylation assay evidence that is used in manual assertion."^^ . _:genid2353 "ECO:MCC"^^ . . _:genid2354 . _:genid2355 . _:genid2357 _:genid2356 . _:genid2355 _:genid2357 . _:genid2356 . _:genid2356 . _:genid2356 . _:genid2357 . _:genid2354 _:genid2355 . _:genid2354 . . . "IDA"^^ . "A type of in vivo cleavage assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:49:43Z"^^ . "eco"^^ . "ECO:0001208"^^ . "in vivo cleavage assay evidence used in manual assertion"^^ . _:genid2358 . _:genid2358 . _:genid2358 . _:genid2358 . _:genid2358 "true"^^ . _:genid2359 . _:genid2359 . _:genid2359 . _:genid2359 "A type of in vivo cleavage assay evidence that is used in a manual assertion."^^ . _:genid2359 "ECO:MCC"^^ . . _:genid2360 . _:genid2361 . _:genid2363 _:genid2362 . _:genid2361 _:genid2363 . _:genid2362 . _:genid2362 . _:genid2362 . _:genid2363 . _:genid2360 _:genid2361 . _:genid2360 . . . "IDA"^^ . "A type of in vivo deacetylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:50:47Z"^^ . "eco"^^ . "ECO:0001209"^^ . "in vivo deacetylation assay evidence used in manual assertion"^^ . _:genid2364 . _:genid2364 . _:genid2364 . _:genid2364 . _:genid2364 "true"^^ . _:genid2365 . _:genid2365 . _:genid2365 . _:genid2365 "A type of in vivo deacetylation assay evidence that is used in a manual assertion."^^ . _:genid2365 "ECO:MCC"^^ . . _:genid2366 . _:genid2367 . _:genid2369 _:genid2368 . _:genid2367 _:genid2369 . _:genid2368 . _:genid2368 . _:genid2368 . _:genid2369 . _:genid2366 _:genid2367 . _:genid2366 . . . "IDA"^^ . "A type of in vivo defarnesylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:52:41Z"^^ . "eco"^^ . "ECO:0001210"^^ . "in vivo defarnesylation assay evidence used in manual assertion"^^ . _:genid2370 . _:genid2370 . _:genid2370 . _:genid2370 . _:genid2370 "true"^^ . _:genid2371 . _:genid2371 . _:genid2371 . _:genid2371 "A type of in vivo defarnesylation assay evidence that is used in a manual assertion."^^ . _:genid2371 "ECO:MCC"^^ . . _:genid2372 . _:genid2373 . _:genid2375 _:genid2374 . _:genid2373 _:genid2375 . _:genid2374 . _:genid2374 . _:genid2374 . _:genid2375 . _:genid2372 _:genid2373 . _:genid2372 . . . "IDA"^^ . "A type of in vivo demethylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:53:40Z"^^ . "eco"^^ . "ECO:0001211"^^ . "in vivo demethylation assay evidence used in manual assertion"^^ . _:genid2376 . _:genid2376 . _:genid2376 . _:genid2376 . _:genid2376 "true"^^ . _:genid2377 . _:genid2377 . _:genid2377 . _:genid2377 "A type of in vivo demethylation assay evidence that is used in a manual assertion."^^ . _:genid2377 "ECO:MCC"^^ . . _:genid2378 . _:genid2379 . _:genid2381 _:genid2380 . _:genid2379 _:genid2381 . _:genid2380 . _:genid2380 . _:genid2380 . _:genid2381 . _:genid2378 _:genid2379 . _:genid2378 . . . "IDA"^^ . "A type of in vivo desumoylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:54:36Z"^^ . "eco"^^ . "ECO:0001212"^^ . "in vivo desumoylation assay evidence used in manual assertion"^^ . _:genid2382 . _:genid2382 . _:genid2382 . _:genid2382 . _:genid2382 "true"^^ . _:genid2383 . _:genid2383 . _:genid2383 . _:genid2383 "A type of in vivo desumoylation assay evidence that is used in a manual assertion."^^ . _:genid2383 "ECO:MCC"^^ . . _:genid2384 . _:genid2385 . _:genid2387 _:genid2386 . _:genid2385 _:genid2387 . _:genid2386 . _:genid2386 . _:genid2386 . _:genid2387 . _:genid2384 _:genid2385 . _:genid2384 . . . "IDA"^^ . "A type of in vivo deubiquitination assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:56:28Z"^^ . "eco"^^ . "ECO:0001213"^^ . "in vivo deubiquitination assay evidence used in manual assertion"^^ . _:genid2388 . _:genid2388 . _:genid2388 . _:genid2388 . _:genid2388 "true"^^ . _:genid2389 . _:genid2389 . _:genid2389 . _:genid2389 "A type of in vivo deubiquitination assay evidence that is used in a manual assertion."^^ . _:genid2389 "ECO:MCC"^^ . . _:genid2390 . _:genid2391 . _:genid2393 _:genid2392 . _:genid2391 _:genid2393 . _:genid2392 . _:genid2392 . _:genid2392 . _:genid2393 . _:genid2390 _:genid2391 . _:genid2390 . . . "IDA"^^ . "A type of in vivo farnesylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T17:57:18Z"^^ . "eco"^^ . "ECO:0001214"^^ . "in vivo farnesylation assay evidence used in manual assertion"^^ . _:genid2394 . _:genid2394 . _:genid2394 . _:genid2394 . _:genid2394 "true"^^ . _:genid2395 . _:genid2395 . _:genid2395 . _:genid2395 "A type of in vivo farnesylation assay evidence that is used in a manual assertion."^^ . _:genid2395 "ECO:MCC"^^ . . _:genid2396 . _:genid2397 . _:genid2399 _:genid2398 . _:genid2397 _:genid2399 . _:genid2398 . _:genid2398 . _:genid2398 . _:genid2399 . _:genid2396 _:genid2397 . _:genid2396 . . . "IDA"^^ . "A type of in vivo methylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:03:16Z"^^ . "eco"^^ . "ECO:0001215"^^ . "in vivo methylation assay evidence used in manual assertion"^^ . _:genid2400 . _:genid2400 . _:genid2400 . _:genid2400 . _:genid2400 "true"^^ . _:genid2401 . _:genid2401 . _:genid2401 . _:genid2401 "A type of in vivo methylation assay evidence that is used in a manual assertion."^^ . _:genid2401 "ECO:MCC"^^ . . _:genid2402 . _:genid2403 . _:genid2405 _:genid2404 . _:genid2403 _:genid2405 . _:genid2404 . _:genid2404 . _:genid2404 . _:genid2405 . _:genid2402 _:genid2403 . _:genid2402 . . . "IDA"^^ . "A type of in vivo palmitoylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:04:07Z"^^ . "eco"^^ . "ECO:0001216"^^ . "in vivo palmitoylation assay evidence used in manual assertion"^^ . _:genid2406 . _:genid2406 . _:genid2406 . _:genid2406 . _:genid2406 "true"^^ . _:genid2407 . _:genid2407 . _:genid2407 . _:genid2407 "A type of in vivo palmitoylation assay evidence that is used in a manual assertion."^^ . _:genid2407 "ECO:MCC"^^ . . _:genid2408 . _:genid2409 . _:genid2411 _:genid2410 . _:genid2409 _:genid2411 . _:genid2410 . _:genid2410 . _:genid2410 . _:genid2411 . _:genid2408 _:genid2409 . _:genid2408 . . . "IDA"^^ . "A type of in vivo phosphatase assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:06:08Z"^^ . "eco"^^ . "ECO:0001217"^^ . "in vivo phosphatase assay evidence used in manual assertion"^^ . _:genid2412 . _:genid2412 . _:genid2412 . _:genid2412 . _:genid2412 "true"^^ . _:genid2413 . _:genid2413 . _:genid2413 . _:genid2413 "A type of in vivo phosphatase assay evidence that is used in a manual assertion."^^ . _:genid2413 "ECO:MCC"^^ . . _:genid2414 . _:genid2415 . _:genid2417 _:genid2416 . _:genid2415 _:genid2417 . _:genid2416 . _:genid2416 . _:genid2416 . _:genid2417 . _:genid2414 _:genid2415 . _:genid2414 . . . "IDA"^^ . "A type of in vivo protein kinase assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:07:58Z"^^ . "eco"^^ . "ECO:0001218"^^ . "in vivo protein kinase assay evidence used in manual assertion"^^ . _:genid2418 . _:genid2418 . _:genid2418 . _:genid2418 . _:genid2418 "true"^^ . _:genid2419 . _:genid2419 . _:genid2419 . _:genid2419 "A type of in vivo protein kinase assay evidence that is used in a manual assertion."^^ . _:genid2419 "ECO:MCC"^^ . . _:genid2420 . _:genid2421 . _:genid2423 _:genid2422 . _:genid2421 _:genid2423 . _:genid2422 . _:genid2422 . _:genid2422 . _:genid2423 . _:genid2420 _:genid2421 . _:genid2420 . . . "IDA"^^ . "A type of in vivo sumoylation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:09:49Z"^^ . "eco"^^ . "ECO:0001219"^^ . "in vivo sumoylation assay evidence used in manual assertion"^^ . _:genid2424 . _:genid2424 . _:genid2424 . _:genid2424 . _:genid2424 "true"^^ . _:genid2425 . _:genid2425 . _:genid2425 . _:genid2425 "A type of in vivo sumoylation assay evidence that is used in a manual assertion."^^ . _:genid2425 "ECO:MCC"^^ . . _:genid2426 . _:genid2427 . _:genid2429 _:genid2428 . _:genid2427 _:genid2429 . _:genid2428 . _:genid2428 . _:genid2428 . _:genid2429 . _:genid2426 _:genid2427 . _:genid2426 . . . "IDA"^^ . "A type of in vivo transcription assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:11:20Z"^^ . "eco"^^ . "ECO:0001220"^^ . "in vivo transcription assay evidence used in manual assertion"^^ . _:genid2430 . _:genid2430 . _:genid2430 . _:genid2430 . _:genid2430 "true"^^ . _:genid2431 . _:genid2431 . _:genid2431 . _:genid2431 "A type of in vivo transcription assay evidence that is used in a manual assertion."^^ . _:genid2431 "ECO:MCC"^^ . . _:genid2432 . _:genid2433 . _:genid2435 _:genid2434 . _:genid2433 _:genid2435 . _:genid2434 . _:genid2434 . _:genid2434 . _:genid2435 . _:genid2432 _:genid2433 . _:genid2432 . . . "IDA"^^ . "A type of in vivo translation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:42:50Z"^^ . "eco"^^ . "ECO:0001221"^^ . "in vivo translation assay evidence used in manual assertion"^^ . _:genid2436 . _:genid2436 . _:genid2436 . _:genid2436 . _:genid2436 "true"^^ . _:genid2437 . _:genid2437 . _:genid2437 . _:genid2437 "A type of in vivo translation assay evidence that is used in a manual assertion."^^ . _:genid2437 "ECO:MCC"^^ . . _:genid2438 . _:genid2439 . _:genid2441 _:genid2440 . _:genid2439 _:genid2441 . _:genid2440 . _:genid2440 . _:genid2440 . _:genid2441 . _:genid2438 _:genid2439 . _:genid2438 . . . "IDA"^^ . "A type of in vivo ubiquitination assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:44:11Z"^^ . "eco"^^ . "ECO:0001222"^^ . "in vivo ubiquitination assay evidence used in manual assertion"^^ . _:genid2442 . _:genid2442 . _:genid2442 . _:genid2442 . _:genid2442 "true"^^ . _:genid2443 . _:genid2443 . _:genid2443 . _:genid2443 "A type of in vivo ubiquitination assay evidence that is used in a manual assertion."^^ . _:genid2443 "ECO:MCC"^^ . . "A type of induced mutation evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:45:56Z"^^ . "eco"^^ . "ECO:0001223"^^ . "induced mutation evidence used in manual assertion"^^ . "true"^^ . _:genid2444 . _:genid2444 . _:genid2444 . _:genid2444 "A type of induced mutation evidence that is used in a manual assertion."^^ . _:genid2444 "ECO:MCC"^^ . . _:genid2445 . _:genid2446 . _:genid2448 _:genid2447 . _:genid2446 _:genid2448 . _:genid2447 . _:genid2447 . _:genid2447 . _:genid2448 . _:genid2445 _:genid2446 . _:genid2445 . . . "IMP"^^ . "A type of knockin evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:49:35Z"^^ . "eco"^^ . "ECO:0001224"^^ . "knockin evidence used in manual assertion"^^ . _:genid2449 . _:genid2449 . _:genid2449 . _:genid2449 . _:genid2449 "true"^^ . _:genid2450 . _:genid2450 . _:genid2450 . _:genid2450 "A type of knockin evidence that is used in a manual assertion."^^ . _:genid2450 "ECO:MCC"^^ . . _:genid2451 . _:genid2452 . _:genid2454 _:genid2453 . _:genid2452 _:genid2454 . _:genid2453 . _:genid2453 . _:genid2453 . _:genid2454 . _:genid2451 _:genid2452 . _:genid2451 . . . "IMP"^^ . "A type of knockout evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:51:31Z"^^ . "eco"^^ . "ECO:0001225"^^ . "knockout evidence used in manual assertion"^^ . _:genid2455 . _:genid2455 . _:genid2455 . _:genid2455 . _:genid2455 "true"^^ . _:genid2456 . _:genid2456 . _:genid2456 . _:genid2456 "A type of knockout evidence that is used in a manual assertion."^^ . _:genid2456 "ECO:MCC"^^ . . _:genid2457 . _:genid2458 . _:genid2460 _:genid2459 . _:genid2458 _:genid2460 . _:genid2459 . _:genid2459 . _:genid2459 . _:genid2460 . _:genid2457 _:genid2458 . _:genid2457 . . . "IPI"^^ . "A type of lipid binding assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:52:19Z"^^ . "eco"^^ . "ECO:0001226"^^ . "lipid binding assay evidence used in manual assertion"^^ . _:genid2461 . _:genid2461 . _:genid2461 . _:genid2461 . _:genid2461 "true"^^ . _:genid2462 . _:genid2462 . _:genid2462 . _:genid2462 "A type of lipid binding assay evidence that is used in a manual assertion."^^ . _:genid2462 "ECO:MCC"^^ . . _:genid2463 . _:genid2464 . _:genid2466 _:genid2465 . _:genid2464 _:genid2466 . _:genid2465 . _:genid2465 . _:genid2465 . _:genid2466 . _:genid2463 _:genid2464 . _:genid2463 . . . "IPI"^^ . "A type of LUMIER assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:55:16Z"^^ . "LUMIER assay evidence"^^ . "eco"^^ . "ECO:0001227"^^ . "luminescence-based mammalian interactome mapping assay evidence used in manual assertion"^^ . _:genid2467 . _:genid2467 . _:genid2467 . _:genid2467 . _:genid2467 "true"^^ . _:genid2468 . _:genid2468 . _:genid2468 . _:genid2468 "A type of LUMIER assay evidence that is used in a manual assertion."^^ . _:genid2468 "ECO:MCC"^^ . . _:genid2469 . _:genid2470 . _:genid2472 _:genid2471 . _:genid2470 _:genid2472 . _:genid2471 . _:genid2471 . _:genid2471 . _:genid2472 . _:genid2469 _:genid2470 . _:genid2469 . . . "EXP"^^ . "A type of macroscopy evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:56:21Z"^^ . "eco"^^ . "ECO:0001228"^^ . "macroscopy evidence used in manual assertion"^^ . _:genid2473 . _:genid2473 . _:genid2473 . _:genid2473 . _:genid2473 "true"^^ . _:genid2474 . _:genid2474 . _:genid2474 . _:genid2474 "A type of macroscopy evidence that is used in a manual assertion."^^ . _:genid2474 "ECO:MCC"^^ . . _:genid2475 . _:genid2476 . _:genid2478 _:genid2477 . _:genid2476 _:genid2478 . _:genid2477 . _:genid2477 . _:genid2477 . _:genid2478 . _:genid2475 _:genid2476 . _:genid2475 . . . "IPI"^^ . "A type of mammalian 2-hybrid assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:57:25Z"^^ . "eco"^^ . "ECO:0001229"^^ . "mammalian 2-hybrid assay evidence used in manual assertion"^^ . _:genid2479 . _:genid2479 . _:genid2479 . _:genid2479 . _:genid2479 "true"^^ . _:genid2480 . _:genid2480 . _:genid2480 . _:genid2480 "A type of mammalian 2-hybrid assay evidence that is used in a manual assertion."^^ . _:genid2480 "ECO:MCC"^^ . . _:genid2481 . _:genid2482 . _:genid2484 _:genid2483 . _:genid2482 _:genid2484 . _:genid2483 . _:genid2483 . _:genid2483 . _:genid2484 . _:genid2481 _:genid2482 . _:genid2481 . . . "EXP"^^ . "A type of mass spectrometry evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T18:59:50Z"^^ . "eco"^^ . "ECO:0001230"^^ . "mass spectrometry evidence used in manual assertion"^^ . _:genid2485 . _:genid2485 . _:genid2485 . _:genid2485 . _:genid2485 "true"^^ . _:genid2486 . _:genid2486 . _:genid2486 . _:genid2486 "A type of mass spectrometry evidence that is used in a manual assertion."^^ . _:genid2486 "ECO:MCC"^^ . . _:genid2487 . _:genid2488 . _:genid2490 _:genid2489 . _:genid2488 _:genid2490 . _:genid2489 . _:genid2489 . _:genid2489 . _:genid2490 . _:genid2487 _:genid2488 . _:genid2487 . . . "IDA"^^ . "A type of medical imaging evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T19:04:43Z"^^ . "eco"^^ . "ECO:0001231"^^ . "medical imaging evidence used in manual assertion"^^ . _:genid2491 . _:genid2491 . _:genid2491 . _:genid2491 . _:genid2491 "true"^^ . _:genid2492 . _:genid2492 . _:genid2492 . _:genid2492 "A type of medical imaging evidence that is used in a manual assertion."^^ . _:genid2492 "ECO:MCC"^^ . . _:genid2493 . _:genid2494 . _:genid2496 _:genid2495 . _:genid2494 _:genid2496 . _:genid2495 . _:genid2495 . _:genid2495 . _:genid2496 . _:genid2493 _:genid2494 . _:genid2493 . . . "IDA"^^ . "A type of microscopy evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T19:05:37Z"^^ . "eco"^^ . "ECO:0001232"^^ . "microscopy evidence used in manual assertion"^^ . _:genid2497 . _:genid2497 . _:genid2497 . _:genid2497 . _:genid2497 "true"^^ . _:genid2498 . _:genid2498 . _:genid2498 . _:genid2498 "A type of microscopy evidence that is used in a manual assertion."^^ . _:genid2498 "ECO:MCC"^^ . . _:genid2499 . _:genid2500 . _:genid2502 _:genid2501 . _:genid2500 _:genid2502 . _:genid2501 . _:genid2501 . _:genid2501 . _:genid2502 . _:genid2499 _:genid2500 . _:genid2499 . . . "IDA"^^ . "A type of motility wound healing assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T19:08:13Z"^^ . "ECO:0001262"^^ . "wound healing assay evidence used in manual assertion"^^ . "eco"^^ . "ECO:0001233"^^ . "motility wound healing assay evidence used in manual assertion"^^ . _:genid2503 . _:genid2503 . _:genid2503 . _:genid2503 . _:genid2503 "true"^^ . _:genid2504 . _:genid2504 . _:genid2504 . _:genid2504 "A type of motility wound healing assay evidence that is used in a manual assertion."^^ . _:genid2504 "ECO:MCC"^^ . . _:genid2505 . _:genid2506 . _:genid2508 _:genid2507 . _:genid2506 _:genid2508 . _:genid2507 . _:genid2507 . _:genid2507 . _:genid2508 . _:genid2505 _:genid2506 . _:genid2505 . . . "IDA"^^ . "A type of MTS assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T19:08:51Z"^^ . "eco"^^ . "3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium"^^ . "ECO:0001234"^^ . "MTS assay evidence used in manual assertion"^^ . _:genid2509 . _:genid2509 . _:genid2509 . _:genid2509 . _:genid2509 "true"^^ . _:genid2510 . _:genid2510 . _:genid2510 . _:genid2510 "A type of MTS assay evidence that is used in a manual assertion."^^ . _:genid2510 "ECO:MCC"^^ . . _:genid2511 . _:genid2512 . _:genid2514 _:genid2513 . _:genid2512 _:genid2514 . _:genid2513 . _:genid2513 . _:genid2513 . _:genid2514 . _:genid2511 _:genid2512 . _:genid2511 . . . "IDA"^^ . "A type of MTT assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T19:13:17Z"^^ . "eco"^^ . "3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide"^^ . "ECO:0001235"^^ . "MTT assay evidence used in manual assertion"^^ . _:genid2515 . _:genid2515 . _:genid2515 . _:genid2515 . _:genid2515 "true"^^ . _:genid2516 . _:genid2516 . _:genid2516 . _:genid2516 "A type of MTT assay evidence that is used in a manual assertion."^^ . _:genid2516 "ECO:MCC"^^ . . _:genid2517 . _:genid2518 . _:genid2520 _:genid2519 . _:genid2518 _:genid2520 . _:genid2519 . _:genid2519 . _:genid2519 . _:genid2520 . _:genid2517 _:genid2518 . _:genid2517 . . . "EXP"^^ . "A type of multiplex bead-based immunoassay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T19:14:03Z"^^ . "eco"^^ . "ECO:0001236"^^ . "multiplex bead-based immunoassay evidence used in manual assertion"^^ . _:genid2521 . _:genid2521 . _:genid2521 . _:genid2521 . _:genid2521 "true"^^ . _:genid2522 . _:genid2522 . _:genid2522 . _:genid2522 "A type of multiplex bead-based immunoassay evidence that is used in a manual assertion."^^ . _:genid2522 "ECO:MCC"^^ . . _:genid2523 . _:genid2524 . _:genid2526 _:genid2525 . _:genid2524 _:genid2526 . _:genid2525 . _:genid2525 . _:genid2525 . _:genid2526 . _:genid2523 _:genid2524 . _:genid2523 . . . "EXP"^^ . "A type of natural variation mutant evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T19:15:48Z"^^ . "eco"^^ . "ECO:0001237"^^ . "natural variation mutant evidence used in manual assertion"^^ . _:genid2527 . _:genid2527 . _:genid2527 . _:genid2527 . _:genid2527 "true"^^ . _:genid2528 . _:genid2528 . _:genid2528 . _:genid2528 "A type of natural variation mutant evidence that is used in a manual assertion."^^ . _:genid2528 "ECO:MCC"^^ . . _:genid2529 . _:genid2530 . _:genid2532 _:genid2531 . _:genid2530 _:genid2532 . _:genid2531 . _:genid2531 . _:genid2531 . _:genid2532 . _:genid2529 _:genid2530 . _:genid2529 . . . "EXP"^^ . "A type of nuclear magnetic resonance evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T19:18:50Z"^^ . "eco"^^ . "ECO:0001238"^^ . "nuclear magnetic resonance evidence used in manual assertion"^^ . _:genid2533 . _:genid2533 . _:genid2533 . _:genid2533 . _:genid2533 "true"^^ . _:genid2534 . _:genid2534 . _:genid2534 . _:genid2534 "A type of nuclear magnetic resonance evidence that is used in a manual assertion."^^ . _:genid2534 "ECO:MCC"^^ . . _:genid2535 . _:genid2536 . _:genid2538 _:genid2537 . _:genid2536 _:genid2538 . _:genid2537 . _:genid2537 . _:genid2537 . _:genid2538 . _:genid2535 _:genid2536 . _:genid2535 . . . "IDA"^^ . "A type of nuclear fragmentation evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T19:19:55Z"^^ . "eco"^^ . "ECO:0001239"^^ . "nuclear fragmentation evidence used in manual assertion"^^ . _:genid2539 . _:genid2539 . _:genid2539 . _:genid2539 . _:genid2539 "true"^^ . _:genid2540 . _:genid2540 . _:genid2540 . _:genid2540 "A type of nuclear fragmentation evidence that is used in a manual assertion."^^ . _:genid2540 "ECO:MCC"^^ . . _:genid2541 . _:genid2542 . _:genid2544 _:genid2543 . _:genid2542 _:genid2544 . _:genid2543 . _:genid2543 . _:genid2543 . _:genid2544 . _:genid2541 _:genid2542 . _:genid2541 . . . "EXP"^^ . "A type of nuclease protection assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T19:23:41Z"^^ . "eco"^^ . "ECO:0001240"^^ . "nuclease protection assay evidence used in manual assertion"^^ . _:genid2545 . _:genid2545 . _:genid2545 . _:genid2545 . _:genid2545 "true"^^ . _:genid2546 . _:genid2546 . _:genid2546 . _:genid2546 "A type of nuclease protection assay evidence that is used in a manual assertion."^^ . _:genid2546 "ECO:MCC"^^ . . _:genid2547 . _:genid2548 . _:genid2550 _:genid2549 . _:genid2548 _:genid2550 . _:genid2549 . _:genid2549 . _:genid2549 . _:genid2550 . _:genid2547 _:genid2548 . _:genid2547 . . . "IDA"^^ . "A type of nucleotide analog incorporation assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T19:25:17Z"^^ . "eco"^^ . "ECO:0001241"^^ . "nucleotide analog incorporation assay evidence used in manual assertion"^^ . _:genid2551 . _:genid2551 . _:genid2551 . _:genid2551 . _:genid2551 "true"^^ . _:genid2552 . _:genid2552 . _:genid2552 . _:genid2552 "A type of nucleotide analog incorporation assay evidence that is used in a manual assertion."^^ . _:genid2552 "ECO:MCC"^^ . . _:genid2553 . _:genid2554 . _:genid2556 _:genid2555 . _:genid2554 _:genid2556 . _:genid2555 . _:genid2555 . _:genid2555 . _:genid2556 . _:genid2553 _:genid2554 . _:genid2553 . . . "IPI"^^ . "A type of phage display evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T19:27:17Z"^^ . "eco"^^ . "ECO:0001242"^^ . "phage display evidence used in manual assertion"^^ . _:genid2557 . _:genid2557 . _:genid2557 . _:genid2557 . _:genid2557 "true"^^ . _:genid2558 . _:genid2558 . _:genid2558 . _:genid2558 "A type of phage display evidence that is used in a manual assertion."^^ . _:genid2558 "ECO:MCC"^^ . . _:genid2559 . _:genid2560 . _:genid2562 _:genid2561 . _:genid2560 _:genid2562 . _:genid2561 . _:genid2561 . _:genid2561 . _:genid2562 . _:genid2559 _:genid2560 . _:genid2559 . . . "IDA"^^ . "A type of phosphoamino acid analysis evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T19:28:59Z"^^ . "eco"^^ . "ECO:0001243"^^ . "phosphoamino acid analysis evidence used in manual assertion"^^ . _:genid2563 . _:genid2563 . _:genid2563 . _:genid2563 . _:genid2563 "true"^^ . _:genid2564 . _:genid2564 . _:genid2564 . _:genid2564 "A type of phosphoamino acid analysis evidence that is used in a manual assertion."^^ . _:genid2564 "ECO:MCC"^^ . . _:genid2565 . _:genid2566 . _:genid2568 _:genid2567 . _:genid2566 _:genid2568 . _:genid2567 . _:genid2567 . _:genid2567 . _:genid2568 . _:genid2565 _:genid2566 . _:genid2565 . . . "IPI"^^ . "A type of peptide affinity enrichment evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T19:30:13Z"^^ . "eco"^^ . "phosphopeptide affinity enrichment evidence"^^ . "ECO:0001244"^^ . "peptide affinity enrichment evidence used in manual assertion"^^ . _:genid2569 . _:genid2569 . _:genid2569 . _:genid2569 . _:genid2569 "true"^^ . _:genid2570 . _:genid2570 . _:genid2570 . _:genid2570 "A type of peptide affinity enrichment evidence that is used in a manual assertion."^^ . _:genid2570 "ECO:MCC"^^ . . _:genid2571 . _:genid2572 . _:genid2574 _:genid2573 . _:genid2572 _:genid2574 . _:genid2573 . _:genid2573 . _:genid2573 . _:genid2574 . _:genid2571 _:genid2572 . _:genid2571 . . . "IPI"^^ . "A type of peptide array evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:16:45Z"^^ . "eco"^^ . "phosphopeptide array evidence"^^ . "ECO:0001245"^^ . "peptide array evidence used in manual assertion"^^ . _:genid2575 . _:genid2575 . _:genid2575 . _:genid2575 . _:genid2575 "true"^^ . _:genid2576 . _:genid2576 . _:genid2576 . _:genid2576 "A type of peptide array evidence that is used in a manual assertion."^^ . _:genid2576 "ECO:MCC"^^ . . _:genid2577 . _:genid2578 . _:genid2580 _:genid2579 . _:genid2578 _:genid2580 . _:genid2579 . _:genid2579 . _:genid2579 . _:genid2580 . _:genid2577 _:genid2578 . _:genid2577 . . . "IDA"^^ . "A type of physical examination evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:17:27Z"^^ . "eco"^^ . "ECO:0001246"^^ . "physical examination evidence used in manual assertion"^^ . _:genid2581 . _:genid2581 . _:genid2581 . _:genid2581 . _:genid2581 "true"^^ . _:genid2582 . _:genid2582 . _:genid2582 . _:genid2582 "A type of physical examination evidence that is used in a manual assertion."^^ . _:genid2582 "ECO:MCC"^^ . . _:genid2583 . _:genid2584 . _:genid2586 _:genid2585 . _:genid2584 _:genid2586 . _:genid2585 . _:genid2585 . _:genid2585 . _:genid2586 . _:genid2583 _:genid2584 . _:genid2583 . . . "IMP"^^ . "A type of point mutation phenotypic evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:18:10Z"^^ . "point mutation evidence used in manual assertion"^^ . "eco"^^ . "ECO:0001247"^^ . "point mutation phenotypic evidence used in manual assertion"^^ . _:genid2587 . _:genid2587 . _:genid2587 . _:genid2587 . _:genid2587 "true"^^ . _:genid2588 . _:genid2588 . _:genid2588 . _:genid2588 "A type of point mutation phenotypic evidence that is used in a manual assertion."^^ . _:genid2588 "ECO:MCC"^^ . . _:genid2589 . _:genid2590 . _:genid2592 _:genid2591 . _:genid2590 _:genid2592 . _:genid2591 . _:genid2591 . _:genid2591 . _:genid2592 . _:genid2589 _:genid2590 . _:genid2589 . . . "IDA"^^ . "A type of propidium iodide staining evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:18:58Z"^^ . "eco"^^ . "ECO:0001248"^^ . "propidium iodide staining evidence used in manual assertion"^^ . _:genid2593 . _:genid2593 . _:genid2593 . _:genid2593 . _:genid2593 "true"^^ . _:genid2594 . _:genid2594 . _:genid2594 . _:genid2594 "A type of propidium iodide staining evidence that is used in a manual assertion."^^ . _:genid2594 "ECO:MCC"^^ . . _:genid2595 . _:genid2596 . _:genid2598 _:genid2597 . _:genid2596 _:genid2598 . _:genid2597 . _:genid2597 . _:genid2597 . _:genid2598 . _:genid2595 _:genid2596 . _:genid2595 . . . "IDA"^^ . "A type of protein detection by fluorescence evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:19:35Z"^^ . "eco"^^ . "ECO:0001249"^^ . "fluorescence evidence used in manual assertion"^^ . _:genid2599 . _:genid2599 . _:genid2599 . _:genid2599 . _:genid2599 "true"^^ . _:genid2600 . _:genid2600 . _:genid2600 . _:genid2600 "A type of protein detection by fluorescence evidence that is used in a manual assertion."^^ . _:genid2600 "ECO:MCC"^^ . . _:genid2601 . _:genid2602 . _:genid2604 _:genid2603 . _:genid2602 _:genid2604 . _:genid2603 . _:genid2603 . _:genid2603 . _:genid2604 . _:genid2601 _:genid2602 . _:genid2601 . . . "EXP"^^ . "A type of protein dot blot assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:20:30Z"^^ . "eco"^^ . "ECO:0001250"^^ . "protein dot blot assay evidence used in manual assertion"^^ . _:genid2605 . _:genid2605 . _:genid2605 . _:genid2605 . _:genid2605 "true"^^ . _:genid2606 . _:genid2606 . _:genid2606 . _:genid2606 "A type of protein dot blot assay evidence that is used in a manual assertion."^^ . _:genid2606 "ECO:MCC"^^ . . _:genid2607 . _:genid2608 . _:genid2610 _:genid2609 . _:genid2608 _:genid2610 . _:genid2609 . _:genid2609 . _:genid2609 . _:genid2610 . _:genid2607 _:genid2608 . _:genid2607 . . . "EXP"^^ . "A type of protein microarray evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:21:11Z"^^ . "eco"^^ . "ECO:0001251"^^ . "protein microarray evidence used in manual assertion"^^ . _:genid2611 . _:genid2611 . _:genid2611 . _:genid2611 . _:genid2611 "true"^^ . _:genid2612 . _:genid2612 . _:genid2612 . _:genid2612 "A type of protein microarray evidence that is used in a manual assertion."^^ . _:genid2612 "ECO:MCC"^^ . . _:genid2613 . _:genid2614 . _:genid2616 _:genid2615 . _:genid2614 _:genid2616 . _:genid2615 . _:genid2615 . _:genid2615 . _:genid2616 . _:genid2613 _:genid2614 . _:genid2613 . . . "EXP"^^ . "A type of protein sequencing assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:22:08Z"^^ . "eco"^^ . "ECO:0001252"^^ . "protein sequencing assay evidence used in manual assertion"^^ . _:genid2617 . _:genid2617 . _:genid2617 . _:genid2617 . _:genid2617 "true"^^ . _:genid2618 . _:genid2618 . _:genid2618 . _:genid2618 "A type of protein sequencing assay evidence that is used in a manual assertion."^^ . _:genid2618 "ECO:MCC"^^ . . _:genid2619 . _:genid2620 . _:genid2622 _:genid2621 . _:genid2620 _:genid2622 . _:genid2621 . _:genid2621 . _:genid2621 . _:genid2622 . _:genid2619 _:genid2620 . _:genid2619 . . . "EXP"^^ . "A type of quantitative mass spectrometry evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:23:15Z"^^ . "eco"^^ . "ECO:0001253"^^ . "quantitative mass spectrometry evidence used in manual assertion"^^ . _:genid2623 . _:genid2623 . _:genid2623 . _:genid2623 . _:genid2623 "true"^^ . _:genid2624 . _:genid2624 . _:genid2624 . _:genid2624 "A type of quantitative mass spectrometry evidence that is used in a manual assertion."^^ . _:genid2624 "ECO:MCC"^^ . . _:genid2625 . _:genid2626 . _:genid2628 _:genid2627 . _:genid2626 _:genid2628 . _:genid2627 . _:genid2627 . _:genid2627 . _:genid2628 . _:genid2625 _:genid2626 . _:genid2625 . . . "IDA"^^ . "A type of radioisotope assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:27:05Z"^^ . "radioassay evidence"^^ . "radioisotopic assay evidence"^^ . "eco"^^ . "ECO:0001254"^^ . "radioisotope assay evidence used in manual assertion"^^ . _:genid2629 . _:genid2629 . _:genid2629 . _:genid2629 . _:genid2629 "true"^^ . _:genid2630 . _:genid2630 . _:genid2630 . _:genid2630 "A type of radioisotope assay evidence that is used in a manual assertion."^^ . _:genid2630 "ECO:MCC"^^ . . _:genid2631 . _:genid2632 . _:genid2634 _:genid2633 . _:genid2632 _:genid2634 . _:genid2633 . _:genid2633 . _:genid2633 . _:genid2634 . _:genid2631 _:genid2632 . _:genid2631 . . . "EXP"^^ . "A type of radioimmunoassay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:28:04Z"^^ . "eco"^^ . "ECO:0001255"^^ . "radioimmunoassay evidence used in manual assertion"^^ . _:genid2635 . _:genid2635 . _:genid2635 . _:genid2635 . _:genid2635 "true"^^ . _:genid2636 . _:genid2636 . _:genid2636 . _:genid2636 "A type of radioimmunoassay evidence that is used in a manual assertion."^^ . _:genid2636 "ECO:MCC"^^ . . _:genid2637 . _:genid2638 . _:genid2640 _:genid2639 . _:genid2638 _:genid2640 . _:genid2639 . _:genid2639 . _:genid2639 . _:genid2640 . _:genid2637 _:genid2638 . _:genid2637 . . . "IDA"^^ . "A type of imaging assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:29:00Z"^^ . "eco"^^ . "radiologic test evidence"^^ . "ECO:0001256"^^ . "imaging assay evidence used in manual assertion"^^ . _:genid2641 . _:genid2641 . _:genid2641 . _:genid2641 . _:genid2641 "true"^^ . _:genid2642 . _:genid2642 . _:genid2642 . _:genid2642 "A type of imaging assay evidence that is used in a manual assertion."^^ . _:genid2642 "ECO:MCC"^^ . . _:genid2643 . _:genid2644 . _:genid2646 _:genid2645 . _:genid2644 _:genid2646 . _:genid2645 . _:genid2645 . _:genid2645 . _:genid2646 . _:genid2643 _:genid2644 . _:genid2643 . . . "EXP"^^ . "A type of restriction fragment detection evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:29:05Z"^^ . "eco"^^ . "ECO:0001257"^^ . "restriction fragment detection evidence used in manual assertion"^^ . _:genid2647 . _:genid2647 . _:genid2647 . _:genid2647 . _:genid2647 "true"^^ . _:genid2648 . _:genid2648 . _:genid2648 . _:genid2648 "A type of restriction fragment detection evidence that is used in a manual assertion."^^ . _:genid2648 "ECO:MCC"^^ . . _:genid2649 . _:genid2650 . _:genid2652 _:genid2651 . _:genid2650 _:genid2652 . _:genid2651 . _:genid2651 . _:genid2651 . _:genid2652 . _:genid2649 _:genid2650 . _:genid2649 . . . "EXP"^^ . "A type of spectrophotometry evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:29:09Z"^^ . "eco"^^ . "ECO:0001258"^^ . "spectrophotometry evidence used in manual assertion"^^ . _:genid2653 . _:genid2653 . _:genid2653 . _:genid2653 . _:genid2653 "true"^^ . _:genid2654 . _:genid2654 . _:genid2654 . _:genid2654 "A type of spectrophotometry evidence that is used in a manual assertion."^^ . _:genid2654 "ECO:MCC"^^ . . _:genid2655 . _:genid2656 . _:genid2658 _:genid2657 . _:genid2656 _:genid2658 . _:genid2657 . _:genid2657 . _:genid2657 . _:genid2658 . _:genid2655 _:genid2656 . _:genid2655 . . . "EXP"^^ . "A type of syngeneic transplantation experiment evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:29:13Z"^^ . "eco"^^ . "ECO:0001259"^^ . "syngeneic transplantation experiment evidence used in manual assertion"^^ . _:genid2659 . _:genid2659 . _:genid2659 . _:genid2659 . _:genid2659 "true"^^ . _:genid2660 . _:genid2660 . _:genid2660 . _:genid2660 "A type of syngeneic transplantation experiment evidence that is used in a manual assertion."^^ . _:genid2660 "ECO:MCC"^^ . . _:genid2661 . _:genid2662 . _:genid2664 _:genid2663 . _:genid2662 _:genid2664 . _:genid2663 . _:genid2663 . _:genid2663 . _:genid2664 . _:genid2661 _:genid2662 . _:genid2661 . . . "EXP"^^ . "A type of xenotransplantation phenotypic evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:29:18Z"^^ . "xenograft transplantation evidence"^^ . "xenografting evidence"^^ . "xenotransplantation evidence"^^ . "xenotransplantation experiment evidence used in manual assertion"^^ . "eco"^^ . "tissue grafting"^^ . "ECO:0001260"^^ . "xenotransplantation phenotypic evidence used in manual assertion"^^ . _:genid2665 . _:genid2665 . _:genid2665 . _:genid2665 . _:genid2665 "true"^^ . _:genid2666 . _:genid2666 . _:genid2666 . _:genid2666 "A type of xenotransplantation phenotypic evidence that is used in a manual assertion."^^ . _:genid2666 "ECO:MCC"^^ . . _:genid2667 . _:genid2668 . _:genid2670 _:genid2669 . _:genid2668 _:genid2670 . _:genid2669 . _:genid2669 . _:genid2669 . _:genid2670 . _:genid2667 _:genid2668 . _:genid2667 . . . "IDA"^^ . "A type of WST-1 assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:29:22Z"^^ . "metabolic cell proliferation assay evidence"^^ . "eco"^^ . "ECO:0001261"^^ . "WST-1 assay evidence used in manual assertion"^^ . _:genid2671 . _:genid2671 . _:genid2671 . _:genid2671 . _:genid2671 "true"^^ . _:genid2672 . _:genid2672 . _:genid2672 . _:genid2672 "A type of WST-1 assay evidence that is used in a manual assertion."^^ . _:genid2672 "ECO:MCC"^^ . . _:genid2673 . _:genid2674 . _:genid2676 _:genid2675 . _:genid2674 _:genid2676 . _:genid2675 . _:genid2675 . _:genid2675 . _:genid2676 . _:genid2673 _:genid2674 . _:genid2673 . . . "IDA"^^ . "A type of urine test evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:29:30Z"^^ . "eco"^^ . "ECO:0001263"^^ . "urine test evidence used in manual assertion"^^ . _:genid2677 . _:genid2677 . _:genid2677 . _:genid2677 . _:genid2677 "true"^^ . _:genid2678 . _:genid2678 . _:genid2678 . _:genid2678 "A type of urine test evidence that is used in a manual assertion."^^ . _:genid2678 "ECO:MCC"^^ . . _:genid2679 . _:genid2680 . _:genid2682 _:genid2681 . _:genid2680 _:genid2682 . _:genid2681 . _:genid2681 . _:genid2681 . _:genid2682 . _:genid2679 _:genid2680 . _:genid2679 . . . "IDA"^^ . "A type of terminal deoxynucleotidyl transferase dUTP nick end labeling assay evidence assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:29:34Z"^^ . "TUNEL assay evidence"^^ . "TdT-mediated dUTP-biotin nick end labeling assay evidence"^^ . "terminal deoxynucleotidyl transferase-dUTP nick end labeling assay evidence"^^ . "eco"^^ . "ECO:0001264"^^ . "terminal deoxynucleotidyl transferase dUTP nick end labeling assay evidence used in manual assertion"^^ . _:genid2683 . _:genid2683 . _:genid2683 . _:genid2683 . _:genid2683 "true"^^ . _:genid2684 . _:genid2684 . _:genid2684 . _:genid2684 "A type of terminal deoxynucleotidyl transferase dUTP nick end labeling assay evidence assay evidence that is used in a manual assertion."^^ . _:genid2684 "ECO:MCC"^^ . . _:genid2685 . _:genid2686 . _:genid2688 _:genid2687 . _:genid2686 _:genid2688 . _:genid2687 . _:genid2687 . _:genid2687 . _:genid2688 . _:genid2685 _:genid2686 . _:genid2685 . . . "EXP"^^ . "A type of tryptic phosphopeptide mapping assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:29:38Z"^^ . "eco"^^ . "ECO:0001265"^^ . "tryptic phosphopeptide mapping assay evidence used in manual assertion"^^ . _:genid2689 . _:genid2689 . _:genid2689 . _:genid2689 . _:genid2689 "true"^^ . _:genid2690 . _:genid2690 . _:genid2690 . _:genid2690 "A type of tryptic phosphopeptide mapping assay evidence that is used in a manual assertion."^^ . _:genid2690 "ECO:MCC"^^ . . _:genid2691 . _:genid2692 . _:genid2694 _:genid2693 . _:genid2692 _:genid2694 . _:genid2693 . _:genid2693 . _:genid2693 . _:genid2694 . _:genid2691 _:genid2692 . _:genid2691 . . . "IMP"^^ . "A type of transgenic organism evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:29:41Z"^^ . "eco"^^ . "ECO:0001266"^^ . "transgenic organism evidence used in manual assertion"^^ . _:genid2695 . _:genid2695 . _:genid2695 . _:genid2695 . _:genid2695 "true"^^ . _:genid2696 . _:genid2696 . _:genid2696 . _:genid2696 "A type of transgenic organism evidence that is used in a manual assertion."^^ . _:genid2696 "ECO:MCC"^^ . . _:genid2697 . _:genid2698 . _:genid2700 _:genid2699 . _:genid2698 _:genid2700 . _:genid2699 . _:genid2699 . _:genid2699 . _:genid2700 . _:genid2697 _:genid2698 . _:genid2697 . . . "IDA"^^ . "A type of tissue microarray evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:29:45Z"^^ . "eco"^^ . "ECO:0001267"^^ . "tissue microarray evidence used in manual assertion"^^ . _:genid2701 . _:genid2701 . _:genid2701 . _:genid2701 . _:genid2701 "true"^^ . _:genid2702 . _:genid2702 . _:genid2702 . _:genid2702 "A type of tissue microarray evidence that is used in a manual assertion."^^ . _:genid2702 "ECO:MCC"^^ . . _:genid2703 . _:genid2704 . _:genid2706 _:genid2705 . _:genid2704 _:genid2706 . _:genid2705 . _:genid2705 . _:genid2705 . _:genid2706 . _:genid2703 _:genid2704 . _:genid2703 . . . "IDA"^^ . "A type of TACE activity assay evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:29:49Z"^^ . "Tumor necrosis factor - alpha converting enzyme activity assay evidence"^^ . "eco"^^ . "ECO:0001268"^^ . "TACE activity assay evidence used in manual assertion"^^ . _:genid2707 . _:genid2707 . _:genid2707 . _:genid2707 . _:genid2707 "true"^^ . _:genid2708 . _:genid2708 . _:genid2708 . _:genid2708 "A type of TACE activity assay evidence that is used in a manual assertion."^^ . _:genid2708 "ECO:MCC"^^ . . _:genid2709 . _:genid2710 . _:genid2712 _:genid2711 . _:genid2710 _:genid2712 . _:genid2711 . _:genid2711 . _:genid2711 . _:genid2712 . _:genid2709 _:genid2710 . _:genid2709 . . . "IPI"^^ . "A type of surface plasmon resonance evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:29:54Z"^^ . "SPR evidence"^^ . "eco"^^ . "ECO:0001269"^^ . "surface plasmon resonance evidence used in manual assertion"^^ . _:genid2713 . _:genid2713 . _:genid2713 . _:genid2713 . _:genid2713 "true"^^ . _:genid2714 . _:genid2714 . _:genid2714 . _:genid2714 "A type of surface plasmon resonance evidence that is used in a manual assertion."^^ . _:genid2714 "ECO:MCC"^^ . . _:genid2715 . _:genid2716 . _:genid2718 _:genid2717 . _:genid2716 _:genid2718 . _:genid2717 . _:genid2717 . _:genid2717 . _:genid2718 . _:genid2715 _:genid2716 . _:genid2715 . . . "EXP"^^ . "A type of restriction landmark genome scanning evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:29:58Z"^^ . "RLGS evidence"^^ . "restriction landmark genome scanning evidence"^^ . "eco"^^ . "ECO:0001270"^^ . "restriction landmark genomic scanning evidence used in manual assertion"^^ . _:genid2719 . _:genid2719 . _:genid2719 . _:genid2719 . _:genid2719 "true"^^ . _:genid2720 . _:genid2720 . _:genid2720 . _:genid2720 "A type of restriction landmark genome scanning evidence that is used in a manual assertion."^^ . _:genid2720 "ECO:MCC"^^ . . _:genid2721 . _:genid2722 . _:genid2724 _:genid2723 . _:genid2722 _:genid2724 . _:genid2723 . _:genid2723 . _:genid2723 . _:genid2724 . _:genid2721 _:genid2722 . _:genid2721 . . . "IDA"^^ . "A type of resonant mirror biosensor evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T20:30:02Z"^^ . "eco"^^ . "ECO:0001271"^^ . "resonant mirror biosensor evidence used in manual assertion"^^ . _:genid2725 . _:genid2725 . _:genid2725 . _:genid2725 . _:genid2725 "true"^^ . _:genid2726 . _:genid2726 . _:genid2726 . _:genid2726 "A type of resonant mirror biosensor evidence that is used in a manual assertion."^^ . _:genid2726 "ECO:MCC"^^ . . _:genid2727 . _:genid2728 . _:genid2730 _:genid2729 . _:genid2728 _:genid2730 . _:genid2729 . _:genid2729 . _:genid2729 . _:genid2730 . _:genid2727 _:genid2728 . _:genid2727 . . . "EXP"^^ . "A type of high-performance liquid chromatography evidence that is used in a manual assertion."^^ . "mchibucos"^^ . "2014-03-16T20:49:54Z"^^ . "HPLC evidence"^^ . "eco"^^ . "ECO:0001272"^^ . "high-performance liquid chromatography evidence used in manual assertion"^^ . _:genid2731 . _:genid2731 . _:genid2731 . _:genid2731 . _:genid2731 "true"^^ . _:genid2732 . _:genid2732 . _:genid2732 . _:genid2732 "A type of high-performance liquid chromatography evidence that is used in a manual assertion."^^ . _:genid2732 "ECO:MCC"^^ . . _:genid2733 . _:genid2734 . _:genid2736 _:genid2735 . _:genid2734 _:genid2736 . _:genid2735 . _:genid2735 . _:genid2735 . _:genid2736 . _:genid2733 _:genid2734 . _:genid2733 . . . "EXP"^^ . "A type of ectopic expression evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "mchibucos"^^ . "2014-03-17T22:34:56Z"^^ . "eco"^^ . "analysis of overexpression/ectopic expression phenotype"^^ . "ECO:0001273"^^ . "ectopic expression evidence used in manual assertion"^^ . _:genid2737 . _:genid2737 . _:genid2737 . _:genid2737 . _:genid2737 "true"^^ . _:genid2738 . _:genid2738 . _:genid2738 . _:genid2738 "A type of ectopic expression evidence that is used in a manual assertion."^^ . _:genid2738 "ECO:MCC"^^ . . . "A type of molecule detection assay evidence resulting from the detection and quantification of a small molecule (a low molecular weight (typically < 900 daltons) organic compound), such as lipids, sugars, animo acids, drugs, etc."^^ . "CollecTF"^^ . "jbmunro"^^ . "2018-11-09T12:00:00Z"^^ . "metabolite detection assay evidence"^^ . "eco"^^ . "ECO:0001522"^^ . "small molecule detection assay evidence"^^ . . . "A type of direct assay evidence in which the sub-cellular location of a protein or nucleic acid sequence is determined."^^ . "ECO_ExpGenomicCleanup"^^ . "jbmunro"^^ . "2018-05-17T12:00:00Z"^^ . "eco"^^ . "ECO:0001533"^^ . "localization evidence"^^ . . . "A type of localization evidence based on localization of a specific segment of DNA or RNA within tissue by the application of a complementary strand of nucleic acid to which a reporter molecule (i.e. either radio-, fluorescent- or antigen-labeled probe) is attached and quantified using either autoradiography, fluorescence microscopy, or immunohistochemistry."^^ . "ECO_ExpGenomicCleanup"^^ . "jbmunro"^^ . "2018-05-17T12:00:00Z"^^ . "eco"^^ . "ECO:0001534"^^ . "nucleic acid localization evidence"^^ . . . "A type of direct assay evidence where acetylated residues are detected in a protein."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001546"^^ . "acetylation assay evidence"^^ . _:genid2739 . _:genid2739 . _:genid2739 . _:genid2739 "A type of direct assay evidence where acetylated residues are detected in a protein."^^ . _:genid2739 "SIB:PG"^^ . _:genid2739 "url:http://www.perkinelmer.com/resources/technicalresources/applicationsupportknowledgebase/radiometric/acetylation.xhtml"^^ . . . "A type of direct assay evidence where the cleavage of a protein into protein fragments by a protease is detected."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001547"^^ . "cleavage assay evidence"^^ . _:genid2740 . _:genid2740 . _:genid2740 . _:genid2740 "A type of direct assay evidence where the cleavage of a protein into protein fragments by a protease is detected."^^ . _:genid2740 "PMID:21121091"^^ . _:genid2740 "PMID:22154596"^^ . . . "A type of direct assay evidence where the removal of acetyl groups are detected in a protein."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001548"^^ . "deacetylation assay evidence"^^ . _:genid2741 . _:genid2741 . _:genid2741 . _:genid2741 "A type of direct assay evidence where the removal of acetyl groups are detected in a protein."^^ . _:genid2741 "SIB:PG"^^ . _:genid2741 "url:http://www.perkinelmer.com/resources/technicalresources/applicationsupportknowledgebase/radiometric/acetylation.xhtml"^^ . . . "A type of direct assay evidence where the removal of farnesyl groups from a protein is detected."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001549"^^ . "defarnesylation assay evidence"^^ . _:genid2742 . _:genid2742 . _:genid2742 . _:genid2742 "A type of direct assay evidence where the removal of farnesyl groups from a protein is detected."^^ . _:genid2742 "PMID:15556768"^^ . _:genid2742 "PMID:16126733"^^ . _:genid2742 "PMID:16507103"^^ . _:genid2742 "SIB:PG"^^ . . . "A type of direct assay evidence where the removal of methyl groups from a substrate (RNA/DNA or protein) is detected."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001550"^^ . "demethylation assay evidence"^^ . _:genid2743 . _:genid2743 . _:genid2743 . _:genid2743 "A type of direct assay evidence where the removal of methyl groups from a substrate (RNA/DNA or protein) is detected."^^ . _:genid2743 "SIB:PG"^^ . _:genid2743 "url:http://en.wikipedia.org/wiki/Demethylation"^^ . . . "A type of direct assay evidence where the removal of sumo groups from a protein is detected."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001551"^^ . "desumoylation assay evidence"^^ . _:genid2744 . _:genid2744 . _:genid2744 . _:genid2744 "A type of direct assay evidence where the removal of sumo groups from a protein is detected."^^ . _:genid2744 "SIB:PG"^^ . _:genid2744 "url:http://www.enzolifesciences.com/BML-UW8955/sumoylation-kit/"^^ . . . "A type of direct assay evidence where the removal of ubiquitin groups from a protein is detected."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001552"^^ . "deubiquitination assay evidence"^^ . _:genid2745 . _:genid2745 . _:genid2745 . _:genid2745 "A type of direct assay evidence where the removal of ubiquitin groups from a protein is detected."^^ . _:genid2745 "PMID:19692941"^^ . _:genid2745 "SIB:PG"^^ . . . "A type of direct assay evidence where farnesylated residues in proteins are detected."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001553"^^ . "farnesylation assay evidence"^^ . _:genid2746 . _:genid2746 . _:genid2746 . _:genid2746 "A type of direct assay evidence where farnesylated residues in proteins are detected."^^ . _:genid2746 "PMID:9030603"^^ . _:genid2746 "SIB:PG"^^ . _:genid2746 "url:http://en.wikipedia.org/wiki/Farnesyltransferase"^^ . . . "A type of direct assay evidence where methylated residues of a substarte (RNA/DNA or protein) are detected."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001554"^^ . "methylation assay evidence"^^ . _:genid2747 . _:genid2747 . _:genid2747 . _:genid2747 "A type of direct assay evidence where methylated residues of a substarte (RNA/DNA or protein) are detected."^^ . _:genid2747 "SIB:PG"^^ . _:genid2747 "url:http://en.wikipedia.org/wiki/Methylation"^^ . . . "A type of direct assay evidence where palmitoylated residues in a protein are detected."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001555"^^ . "palmitoylation assay evidence"^^ . _:genid2748 . _:genid2748 . _:genid2748 . _:genid2748 "A type of direct assay evidence where palmitoylated residues in a protein are detected."^^ . _:genid2748 "PMID:10329400"^^ . _:genid2748 "PMID:17077383"^^ . _:genid2748 "SIB:PG"^^ . . . "A type of direct assay evidence where the removal of phosphatase groups from a protein is detected."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001556"^^ . "phosphatase assay evidence"^^ . _:genid2749 . _:genid2749 . _:genid2749 . _:genid2749 "A type of direct assay evidence where the removal of phosphatase groups from a protein is detected."^^ . _:genid2749 "SIB:PG"^^ . _:genid2749 "url:http://en.wikipedia.org/wiki/Phosphatase"^^ . . . "A type of direct assay evidence where ADP-ribosylated residues in proteins are detected."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001557"^^ . "polyADP-ribosylation assay evidence"^^ . _:genid2750 . _:genid2750 . _:genid2750 . _:genid2750 "A type of direct assay evidence where ADP-ribosylated residues in proteins are detected."^^ . _:genid2750 "PMID:21870253"^^ . _:genid2750 "PMID:2820766"^^ . _:genid2750 "SIB:PG"^^ . . . "A type of enzymatic activity assay evidence that measures transfer of a phosphate to a peptide or protein substrate by a protein kinase."^^ . "ECO_AssayCleanup"^^ . "jbmunro"^^ . "mchibucos"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001558"^^ . "protein kinase assay evidence"^^ . _:genid2751 . _:genid2751 . _:genid2751 . _:genid2751 "A type of enzymatic activity assay evidence that measures transfer of a phosphate to a peptide or protein substrate by a protein kinase."^^ . _:genid2751 "url:https://www.ncbi.nlm.nih.gov/books/NBK91991/"^^ . . . "A type of direct assay evidence where sumoylated residues on a protein are detected."^^ . "ECO_AssayCleanup"^^ . "jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001559"^^ . "sumoylation assay evidence"^^ . _:genid2752 . _:genid2752 . _:genid2752 . _:genid2752 "A type of direct assay evidence where sumoylated residues on a protein are detected."^^ . _:genid2752 "SIB:PG"^^ . _:genid2752 "url:http://www.enzolifesciences.com/BML-UW8955/sumoylation-kit/"^^ . . _:genid2753 . _:genid2754 . _:genid2756 _:genid2755 . _:genid2754 _:genid2756 . _:genid2755 . _:genid2755 . _:genid2755 . _:genid2756 . _:genid2753 _:genid2754 . _:genid2753 . . . "IEA"^^ . "A type of single cell RNA-sequencing evidence that is used in automatic assertion."^^ . "jbmunro"^^ . "2019-01-02T12:00:00Z"^^ . "eco"^^ . "ECO:000156"^^ . "single-cell RNA-sequencing evidence used in automatic assertion"^^ . _:genid2757 . _:genid2757 . _:genid2757 . _:genid2757 . _:genid2757 "true"^^ . . . "A type of RNA-sequencing evidence that uses a single cell as the source of the RNA."^^ . "Bgee"^^ . "jbmunro"^^ . "2019-01-02T12:00:00Z"^^ . "scRNA-seq evidence"^^ . "eco"^^ . "ECO:0001560"^^ . "single-cell RNA-sequencing evidence"^^ . . . "A type of direct assay evidence where de novo protein synthesis is detected."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001561"^^ . "translation assay evidence"^^ . _:genid2758 . _:genid2758 . _:genid2758 . _:genid2758 "A type of direct assay evidence where de novo protein synthesis is detected."^^ . _:genid2758 "PMID:18230759"^^ . _:genid2758 "PMID:24901308"^^ . _:genid2758 "SIB:PG"^^ . . . "A type of direct assay evidence where ubiquitinated residues on a protein are detected."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001562"^^ . "ubiquitination assay evidence"^^ . _:genid2759 . _:genid2759 . _:genid2759 . _:genid2759 "A type of direct assay evidence where ubiquitinated residues on a protein are detected."^^ . _:genid2759 "PMID:19692941"^^ . _:genid2759 "SIB:PG"^^ . . . _:genid2760 . _:genid2760 . _:genid2760 . _:genid2760 . _:genid2761 . _:genid2761 . _:genid2762 . _:genid2763 . _:genid2765 _:genid2764 . _:genid2763 _:genid2765 . _:genid2764 . _:genid2764 . _:genid2766 . _:genid2766 . _:genid2767 . _:genid2768 . _:genid2769 . _:genid2768 _:genid2769 . _:genid2769 . _:genid2767 _:genid2768 . _:genid2766 _:genid2767 . _:genid2764 _:genid2766 . _:genid2765 . _:genid2762 _:genid2763 . _:genid2761 _:genid2762 . _:genid2761 . _:genid2770 . _:genid2770 . _:genid2771 . _:genid2772 . _:genid2773 . _:genid2772 _:genid2773 . _:genid2773 . _:genid2771 _:genid2772 . _:genid2770 _:genid2771 . _:genid2770 . "However, as shown in Fig. 5A, the recombinant mycobacterial cells became sensitive to the anti-TB drugs isoniazid and streptomycin, as evidenced by their inhibited growth in the presence of 25 mug/mL of isoniazid or 0.5 mug/mL of streptomycin in the medium."^^ . "Similar growth profiles of these strains were observed in liquid media with the corresponding inducers (data not shown). These indicate that the expression of vapC10 alone led to growth arrest of E. coli, and the simultaneous expression of vapB10 could neutralize this growth-inhibition effect, suggesting that vapC10 encodes a TA toxin and vapB10 encodes the cognate antitoxin."^^ . "A type of direct assay evidence where biological cell development, i.e. an increase in cell mass and size are measured."^^ . "ECO_AssayCleanup"^^ . "mchibucos / jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001563"^^ . "cell growth assay evidence"^^ . _:genid2774 . _:genid2774 . _:genid2774 . _:genid2774 "However, as shown in Fig. 5A, the recombinant mycobacterial cells became sensitive to the anti-TB drugs isoniazid and streptomycin, as evidenced by their inhibited growth in the presence of 25 mug/mL of isoniazid or 0.5 mug/mL of streptomycin in the medium."^^ . _:genid2774 "PMID:20843371"^^ . _:genid2775 . _:genid2775 . _:genid2775 . _:genid2775 "Similar growth profiles of these strains were observed in liquid media with the corresponding inducers (data not shown). These indicate that the expression of vapC10 alone led to growth arrest of E. coli, and the simultaneous expression of vapB10 could neutralize this growth-inhibition effect, suggesting that vapC10 encodes a TA toxin and vapB10 encodes the cognate antitoxin."^^ . _:genid2775 "PMID:24260461"^^ . _:genid2776 . _:genid2776 . _:genid2776 . _:genid2776 "A type of direct assay evidence where biological cell development, i.e. an increase in cell mass and size are measured."^^ . _:genid2776 "GO:0016049"^^ . _:genid2776 "PMID:11057898"^^ . . . "A type of direct assay evidence resulting from the study of cells."^^ . "jbmunro"^^ . "2017-11-30T14:00:00Z"^^ . "eco"^^ . "ECO:0001565"^^ . "cell-based assay evidence"^^ . . . "The real-time RT-PCR validated that Zur repressed the first gene of each of the three operons, znuA, znuCB and ykgM-rpmJ2 (Additional file 5)."^^ . "A type of reverse transcription polymerase chain reaction evidence that combines reverse transcription polymerase chain reaction and real time polymerase chain reaction to quantitatively assay for the detection of RNA levels."^^ . "jbmunro"^^ . "2018-07-07T12:00:00Z"^^ . "RRT-PCR evidence"^^ . "RT-qPCR evidence"^^ . "qRT-PCR evidence"^^ . "quantitative RT-PCR evidence"^^ . "quantitative real-time RT-PCR evidence"^^ . "rRT-PCR evidence"^^ . "real-time RT-PCR evidence"^^ . "real-time qRT-PCR evidence"^^ . "real-time quantitative reverse transcription PCR evidence"^^ . "real-time reverse transcription polymerase chain reaction evidence"^^ . "eco"^^ . "ECO:0001566"^^ . "quantitative reverse transcription polymerase chain reaction evidence"^^ . _:genid2777 . _:genid2777 . _:genid2777 . _:genid2777 "The real-time RT-PCR validated that Zur repressed the first gene of each of the three operons, znuA, znuCB and ykgM-rpmJ2 (Additional file 5)."^^ . _:genid2777 "PMID:19552825"^^ . . _:genid2778 . _:genid2779 . _:genid2781 _:genid2780 . _:genid2779 _:genid2781 . _:genid2780 . _:genid2780 . _:genid2780 . _:genid2781 . _:genid2778 _:genid2779 . _:genid2778 . . . "EXP"^^ . "A type of quantitative reverse transcription polymerase chain reaction evidence used in manual assertion."^^ . "jbmunro"^^ . "2018-07-07T12:00:00Z"^^ . "eco"^^ . "ECO:0001567"^^ . "quantitative reverse transcription polymerase chain reaction evidence used in manual assertion"^^ . _:genid2782 . _:genid2782 . _:genid2782 . _:genid2782 . _:genid2782 "true"^^ . . _:genid2783 . _:genid2784 . _:genid2786 _:genid2785 . _:genid2784 _:genid2786 . _:genid2785 . _:genid2785 . _:genid2785 . _:genid2786 . _:genid2783 _:genid2784 . _:genid2783 . . . "IEA"^^ . "A type of quantitative reverse transcription polymerase chain reaction evidence used in automatic assertion."^^ . "jbmunro"^^ . "2018-07-07T12:00:00Z"^^ . "ECO:000156"^^ . "eco"^^ . "ECO:0001568"^^ . "quantitative reverse transcription polymerase chain reaction evidence used in automatic assertion."^^ . _:genid2787 . _:genid2787 . _:genid2787 . _:genid2787 . _:genid2787 "true"^^ . . _:genid2788 . _:genid2789 . _:genid2791 _:genid2790 . _:genid2789 _:genid2791 . _:genid2790 . _:genid2790 . _:genid2790 . _:genid2791 . _:genid2788 _:genid2789 . _:genid2788 . . . "EXP"^^ . "A type of colony diameter phenotype evidence that is used in manual assertion."^^ . "jbmunro"^^ . "2019-01-03T12:00:00Z"^^ . "eco"^^ . "ECO:000157"^^ . "colony diameter phenotype evidence used in manual assertion"^^ . _:genid2792 . _:genid2792 . _:genid2792 . _:genid2792 . _:genid2792 "true"^^ . . _:genid2793 . _:genid2794 . _:genid2796 _:genid2795 . _:genid2794 _:genid2796 . _:genid2795 . _:genid2795 . _:genid2795 . _:genid2796 . _:genid2793 _:genid2794 . _:genid2793 . . . "IEP"^^ . "A type of single cell RNA-sequencing evidence that is used in manual assertion."^^ . "jbmunro"^^ . "2019-01-02T12:00:00Z"^^ . "eco"^^ . "ECO:0001570"^^ . "single-cell RNA-sequencing evidence used in manual assertion"^^ . _:genid2797 . _:genid2797 . _:genid2797 . _:genid2797 . _:genid2797 "true"^^ . . . "A type of colony size phenotypic evidence resulting from measurement of a microbial colony's diameter."^^ . "OMP"^^ . "jbmunro"^^ . "2019-01-03T12:00:00Z"^^ . "eco"^^ . "ECO:0001571"^^ . "colony diameter phenotype evidence"^^ . . _:genid2798 . _:genid2799 . _:genid2801 _:genid2800 . _:genid2799 _:genid2801 . _:genid2800 . _:genid2800 . _:genid2800 . _:genid2801 . _:genid2798 _:genid2799 . _:genid2798 . . . "IEA"^^ . "A type of colony diameter phenotype evidence that is used in automatic assertion"^^ . "jbmunro"^^ . "2019-01-03T12:00:00Z"^^ . "eco"^^ . "ECO:0001572"^^ . "colony diameter phenotype evidence used in automatic assertion"^^ . _:genid2802 . _:genid2802 . _:genid2802 . _:genid2802 . _:genid2802 "true"^^ . . . "A type of direct assay evidence in which a broad variety of physiological processes are measured when two separate membranes merge into a single contiguous membrane."^^ . "jbmunro"^^ . "2019-03-01T12:00:00Z"^^ . "eco"^^ . "ECO:0001574"^^ . "Measurements can include but are not limited to: synaptic transmission, fertilization, and viral entry."^^ . "membrane fusion assay evidence"^^ . _:genid2803 . _:genid2803 . _:genid2803 . _:genid2803 "A type of direct assay evidence in which a broad variety of physiological processes are measured when two separate membranes merge into a single contiguous membrane."^^ . _:genid2803 "PMID:1836993"^^ . . _:genid2804 . _:genid2805 . _:genid2807 _:genid2806 . _:genid2805 _:genid2807 . _:genid2806 . _:genid2806 . _:genid2806 . _:genid2807 . _:genid2804 _:genid2805 . _:genid2804 . . . "IEA"^^ . "A type of membrane fusion assay evidence that is used in automatic assertion."^^ . "jbmunro"^^ . "2019-03-01T12:00:00Z"^^ . "eco"^^ . "ECO:0001575"^^ . "membrane fusion assay evidence used in automatic assertion"^^ . _:genid2808 . _:genid2808 . _:genid2808 . _:genid2808 . _:genid2808 "true"^^ . _:genid2809 . _:genid2809 . _:genid2809 . _:genid2809 . _:genid2809 "true"^^ . . _:genid2810 . _:genid2811 . _:genid2813 _:genid2812 . _:genid2811 _:genid2813 . _:genid2812 . _:genid2812 . _:genid2812 . _:genid2813 . _:genid2810 _:genid2811 . _:genid2810 . . . "IDA"^^ . "A type of membrane fusion assay evidence that is used in manual assertion."^^ . "jbmunro"^^ . "2019-03-01T12:00:00Z"^^ . "eco"^^ . "ECO:0001576"^^ . "membrane fusion assay evidence used in manual assertion"^^ . _:genid2814 . _:genid2814 . _:genid2814 . _:genid2814 . _:genid2814 "true"^^ . _:genid2815 . _:genid2815 . _:genid2815 . _:genid2815 . _:genid2815 "true"^^ . . . "A type of membrane fusion assay evidence based on the fusion of spheroplasts."^^ . "jbmunro"^^ . "2019-03-01T12:00:00Z"^^ . "eco"^^ . "ECO:0001577"^^ . "A spheroplast is a Gram-negative bacterium cell in which the cell wall has been almost completely removed."^^ . "spheroplast fusion assay evidence"^^ . _:genid2816 . _:genid2816 . _:genid2816 . _:genid2816 "A spheroplast is a Gram-negative bacterium cell in which the cell wall has been almost completely removed."^^ . _:genid2816 "PMID:25870259"^^ . . _:genid2817 . _:genid2818 . _:genid2820 _:genid2819 . _:genid2818 _:genid2820 . _:genid2819 . _:genid2819 . _:genid2819 . _:genid2820 . _:genid2817 _:genid2818 . _:genid2817 . . . "IEA"^^ . "A type of spheroplast fusion assay evidence used in automatic assertion."^^ . "jbmunro"^^ . "2019-03-01T12:00:00Z"^^ . "eco"^^ . "ECO:0001578"^^ . "spheroplast fusion assay evidence used in automatic assertion"^^ . _:genid2821 . _:genid2821 . _:genid2821 . _:genid2821 . _:genid2821 "true"^^ . _:genid2822 . _:genid2822 . _:genid2822 . _:genid2822 . _:genid2822 "true"^^ . . _:genid2823 . _:genid2824 . _:genid2826 _:genid2825 . _:genid2824 _:genid2826 . _:genid2825 . _:genid2825 . _:genid2825 . _:genid2826 . _:genid2823 _:genid2824 . _:genid2823 . . . "IDA"^^ . "A type of spheroplast fusion assay evidence that is used in manual assertion."^^ . "jbmunro"^^ . "2019-03-01T12:00:00Z"^^ . "eco"^^ . "ECO:0001579"^^ . "spheroplast fusion assay evidence used in manual assertion"^^ . _:genid2827 . _:genid2827 . _:genid2827 . _:genid2827 . _:genid2827 "true"^^ . _:genid2828 . _:genid2828 . _:genid2828 . _:genid2828 . _:genid2828 "true"^^ . . . "A type of mass spectrometry evidence where liquid chromatography is used to separate particles in solution, followed by fragmentation and measurement of the mass-to-charge ratio of the resulting particles to identify the amount and type of material entities present in a sample."^^ . "OMP"^^ . "jbmunro"^^ . "2019-03-26T12:00:00Z"^^ . "eco"^^ . "ECO:0001580"^^ . "liquid chromatography coupled with tandem mass spectrometry evidence"^^ . . _:genid2829 . _:genid2830 . _:genid2832 _:genid2831 . _:genid2830 _:genid2832 . _:genid2831 . _:genid2831 . _:genid2831 . _:genid2832 . _:genid2829 _:genid2830 . _:genid2829 . . . "IEA"^^ . "A type of liquid chromatography coupled with tandem mass spectrometry evidence that is used in an automatic assertion."^^ . "OMP"^^ . "jbmunro"^^ . "2019-03-26T12:00:00Z"^^ . "eco"^^ . "ECO:0001581"^^ . "liquid chromatography coupled with tandem mass spectrometry evidence used in automatic assertion"^^ . _:genid2833 . _:genid2833 . _:genid2833 . _:genid2833 . _:genid2833 "true"^^ . _:genid2834 . _:genid2834 . _:genid2834 . _:genid2834 . _:genid2834 "true"^^ . . _:genid2835 . _:genid2836 . _:genid2838 _:genid2837 . _:genid2836 _:genid2838 . _:genid2837 . _:genid2837 . _:genid2837 . _:genid2838 . _:genid2835 _:genid2836 . _:genid2835 . . . "EXP"^^ . "A type of liquid chromatography coupled with tandem mass spectrometry evidence that is used in a manual assertion."^^ . "OMP"^^ . "jbmunro"^^ . "2019-03-26T12:00:00Z"^^ . "ECO:0001582"^^ . "liquid chromatography coupled with tandem mass spectrometry evidence used in manual assertion"^^ . _:genid2839 . _:genid2839 . _:genid2839 . _:genid2839 . _:genid2839 "true"^^ . _:genid2840 . _:genid2840 . _:genid2840 . _:genid2840 . _:genid2840 "true"^^ . . . "A type of anti-sense experiment evidence where gene expression is disrupted through the introduction of double-stranded RNA molecules, 20-25 base pairs in length, which operate within the RNA interference pathway."^^ . "OMP"^^ . "jbmunro"^^ . "2019-04-03T12:00:00Z"^^ . "short interfering RNA"^^ . "siRNA"^^ . "silencing RNA"^^ . "eco"^^ . "ECO:0001583"^^ . "small interfering RNA knockdown evidence"^^ . . _:genid2841 . _:genid2842 . _:genid2844 _:genid2843 . _:genid2842 _:genid2844 . _:genid2843 . _:genid2843 . _:genid2843 . _:genid2844 . _:genid2841 _:genid2842 . _:genid2841 . . . "IEA"^^ . "A type of small interfering RNA knockdown evidence that is used in an automatic assertion."^^ . "OMP"^^ . "jbmunro"^^ . "2019-04-03T12:00:00Z"^^ . "eco"^^ . "ECO:0001584"^^ . "small interfering RNA knockdown evidence used in automatic assertion"^^ . _:genid2845 . _:genid2845 . _:genid2845 . _:genid2845 . _:genid2845 "true"^^ . . _:genid2846 . _:genid2847 . _:genid2849 _:genid2848 . _:genid2847 _:genid2849 . _:genid2848 . _:genid2848 . _:genid2848 . _:genid2849 . _:genid2846 _:genid2847 . _:genid2846 . . . "IMP"^^ . "A type of small interfering RNA knockdown evidence that is used in a manual assertion."^^ . "OMP"^^ . "jbmunro"^^ . "2019-04-03T12:00:00Z"^^ . "eco"^^ . "ECO:0001585"^^ . "small interfering RNA knockdown evidence used in manual assertion"^^ . _:genid2850 . _:genid2850 . _:genid2850 . _:genid2850 . _:genid2850 "true"^^ . . . "A type of mass spectrometry evidence where a combination of magnetic and/or electric fields are utilized to capture charged particles in tandem with mass spectrometry."^^ . "OMP"^^ . "jbmunro"^^ . "2019-04-15T12:00:00Z"^^ . "eco"^^ . "ECO:0001586"^^ . "ion trap mass spectrometry evidence"^^ . _:genid2851 . _:genid2851 . _:genid2851 . _:genid2851 "A type of mass spectrometry evidence where a combination of magnetic and/or electric fields are utilized to capture charged particles in tandem with mass spectrometry."^^ . _:genid2851 "PMID:1561330"^^ . . _:genid2852 . _:genid2853 . _:genid2855 _:genid2854 . _:genid2853 _:genid2855 . _:genid2854 . _:genid2854 . _:genid2854 . _:genid2855 . _:genid2852 _:genid2853 . _:genid2852 . . . "IEA"^^ . "A type of ion trap mass spectrometry evidence that is used in an automatic assertion."^^ . "OMP"^^ . "jbmunro"^^ . "2019-04-15T12:00:00Z"^^ . "eco"^^ . "ECO:0001587"^^ . "ion trap mass spectrometry evidence used in automatic assertion"^^ . _:genid2856 . _:genid2856 . _:genid2856 . _:genid2856 . _:genid2856 "true"^^ . . _:genid2857 . _:genid2858 . _:genid2860 _:genid2859 . _:genid2858 _:genid2860 . _:genid2859 . _:genid2859 . _:genid2859 . _:genid2860 . _:genid2857 _:genid2858 . _:genid2857 . . . "EXP"^^ . "A type of ion trap mass spectrometry evidence that is used in a manual assertion."^^ . "OMP"^^ . "jbmunro"^^ . "2019-04-15T12:00:00Z"^^ . "eco"^^ . "ECO:0001588"^^ . "ion trap mass spectrometry evidence used in manual assertion"^^ . _:genid2861 . _:genid2861 . _:genid2861 . _:genid2861 . _:genid2861 "true"^^ . . . "AFM revealed loop structures stabilized by multiple EspR dimer of dimers suggesting the presence of several distant EspR binding sites in the espACD upstream region." . "A type of microscopy evidence where a mechanical probe is applied to a sample (i.e. a type of scanning probe microscopy) which can result in production of an image (with resolution in the order of fractions of a nanometer), force measurement, or sample manipulation."^^ . "CollecTF"^^ . "jbmunro"^^ . "2019-04-15T12:00:00Z"^^ . "AFM"^^ . "SFM"^^ . "scanning force microscopy"^^ . "eco"^^ . "ECO:0001589"^^ . "Atomic force microscopy can be used for force measurement (force spectroscopy), imaging (rendering a three-dimensional shape (topography), and manipulation of the sample."^^ . "atomic force microscopy evidence"^^ . _:genid2862 . _:genid2862 . _:genid2862 . _:genid2862 "AFM revealed loop structures stabilized by multiple EspR dimer of dimers suggesting the presence of several distant EspR binding sites in the espACD upstream region." . _:genid2862 "PMID:22479184" . . . "A type of atomic force microscopy evidence that is used in an automatic assertion."^^ . "CollecTF"^^ . "jbmunro"^^ . "2019-04-15T12:00:00Z"^^ . "eco"^^ . "ECO:0001590"^^ . "atomic force microscopy evidence used in automatic assertion"^^ . . . "A type of atomic force microscopy evidence that is used in a manual assertion."^^ . "CollecTF"^^ . "jbmunro"^^ . "2019-04-15T12:00:00Z"^^ . "eco"^^ . "ECO:0001591"^^ . "atomic force microscopy evidence used in manual assertion"^^ . . . "A type of experimental evidence employed to study the associations between multiple ribosomes and mRNA that utilizes density gradient centrifugation to separate out the lysate of cells of interest with the objective of isolating polysomes/polyribosomes which are complexes of an mRNA molecule and two or more ribosomes that act to translate mRNA. The optical density of the fractions is then determined."^^ . "OMP"^^ . "jbmunro"^^ . "2019-04-15T12:00:00Z"^^ . "eco"^^ . "ECO:0001592"^^ . "Once isolated, gel electrophoresis, immunoblot, and other protein profiling techniques can be applied to garner more information."^^ . "polysome profiling evidence"^^ . _:genid2863 . _:genid2863 . _:genid2863 . _:genid2863 "A type of experimental evidence employed to study the associations between multiple ribosomes and mRNA that utilizes density gradient centrifugation to separate out the lysate of cells of interest with the objective of isolating polysomes/polyribosomes which are complexes of an mRNA molecule and two or more ribosomes that act to translate mRNA. The optical density of the fractions is then determined."^^ . _:genid2863 "PMID:30545912"^^ . . _:genid2864 . _:genid2865 . _:genid2867 _:genid2866 . _:genid2865 _:genid2867 . _:genid2866 . _:genid2866 . _:genid2866 . _:genid2867 . _:genid2864 _:genid2865 . _:genid2864 . . . "IEA"^^ . "A type of polysome profiling evidence that is used in an automatic assertion."^^ . "OMP"^^ . "jbmunro"^^ . "2019-04-15T12:00:00Z"^^ . "eco"^^ . "ECO:0001593"^^ . "polysome profiling evidence used in automatic assertion"^^ . _:genid2868 . _:genid2868 . _:genid2868 . _:genid2868 . _:genid2868 "true"^^ . . _:genid2869 . _:genid2870 . _:genid2872 _:genid2871 . _:genid2870 _:genid2872 . _:genid2871 . _:genid2871 . _:genid2871 . _:genid2872 . _:genid2869 _:genid2870 . _:genid2869 . . . "EXP"^^ . "A type of polysome profiling evidence that is used in a manual assertion."^^ . "OMP"^^ . "jbmunro"^^ . "2019-04-15T12:00:00Z"^^ . "eco"^^ . "ECO:0001594"^^ . "polysome profiling evidence used in manual assertion"^^ . _:genid2873 . _:genid2873 . _:genid2873 . _:genid2873 . _:genid2873 "true"^^ . . . "A type of nucleotide sequencing assay evidence in which DNA sequence variations within a specific set of genes (typically housekeeping genes) are used to characterizes strains by their unique allelic profiles."^^ . "CollecTF"^^ . "jbmunro"^^ . "2019-05-06T12:00:00Z"^^ . "MLST"^^ . "eco"^^ . "ECO:0001598"^^ . "See PMID:24713082 for use example."^^ . "multilocus sequence typing evidence"^^ . _:genid2874 . _:genid2874 . _:genid2874 . _:genid2874 "A type of nucleotide sequencing assay evidence in which DNA sequence variations within a specific set of genes (typically housekeeping genes) are used to characterizes strains by their unique allelic profiles."^^ . _:genid2874 "PMID:9501229"^^ . . _:genid2875 . _:genid2876 . _:genid2878 _:genid2877 . _:genid2876 _:genid2878 . _:genid2877 . _:genid2877 . _:genid2877 . _:genid2878 . _:genid2875 _:genid2876 . _:genid2875 . . . "IEA"^^ . "A type of multilocus sequence typing evidence that is used in an automatic assertion."^^ . "CollecTF"^^ . "jbmunro"^^ . "2019-05-06T12:00:00Z"^^ . "eco"^^ . "ECO:0001599"^^ . "multilocus sequence typing evidence used in automatic assertion"^^ . _:genid2879 . _:genid2879 . _:genid2879 . _:genid2879 . _:genid2879 "true"^^ . . _:genid2880 . _:genid2881 . _:genid2883 _:genid2882 . _:genid2881 _:genid2883 . _:genid2882 . _:genid2882 . _:genid2882 . _:genid2883 . _:genid2880 _:genid2881 . _:genid2880 . . . "EXP"^^ . "A type of multilocus sequence typing evidence that is used in a manual assertion"^^ . "CollecTF"^^ . "jbmunro"^^ . "2019-05-06T12:00:00Z"^^ . "eco"^^ . "ECO:0001600"^^ . "multilocus sequence typing evidence used in manual assertion"^^ . _:genid2884 . _:genid2884 . _:genid2884 . _:genid2884 . _:genid2884 "true"^^ . . . . _:genid2885 . _:genid2885 . _:genid2886 . _:genid2887 . _:genid2889 _:genid2888 . _:genid2887 _:genid2889 . _:genid2888 . _:genid2888 . _:genid2888 . _:genid2889 . _:genid2886 _:genid2887 . _:genid2885 _:genid2886 . _:genid2885 . _:genid2890 . _:genid2890 . _:genid2890 . _:genid2890 . _:genid2891 . _:genid2891 . _:genid2892 . _:genid2893 . _:genid2895 _:genid2894 . _:genid2893 _:genid2895 . _:genid2894 . _:genid2894 . _:genid2896 . _:genid2896 . _:genid2896 . _:genid2894 _:genid2896 . _:genid2895 . _:genid2892 _:genid2893 . _:genid2891 _:genid2892 . _:genid2891 . "A type of protein-binding evidence that detects binding of a tagged protein to an array of oligonucleotide probes representing potential binding sites."^^ . "swolfish"^^ . "2015-06-05T14:36:00Z"^^ . "PBM evidence"^^ . "eco"^^ . "ECO:0001601"^^ . "protein-oligonucleotide microarray binding evidence"^^ . _:genid2897 . _:genid2897 . _:genid2897 . _:genid2897 "A type of protein-binding evidence that detects binding of a tagged protein to an array of oligonucleotide probes representing potential binding sites."^^ . _:genid2897 "PMID:22146299"^^ . . . "A type of cell-based assay evidence in which living cells are stained with a vital stain, i.e. dye that can be used on living cells without causing cell death."^^ . "swolfish"^^ . "2015-06-08T11:51:37Z"^^ . "eco"^^ . "vital staining evidence"^^ . "ECO:0001603"^^ . "cell staining evidence"^^ . _:genid2898 . _:genid2898 . _:genid2898 . _:genid2898 "A type of cell-based assay evidence in which living cells are stained with a vital stain, i.e. dye that can be used on living cells without causing cell death."^^ . _:genid2898 "GOC:MAH"^^ . _:genid2899 . _:genid2899 . _:genid2899 . _:genid2899 "vital staining evidence"^^ . _:genid2899 "GOC:MAH"^^ . . . "A type of reporter gene assay evidence based on the fusion of selected genes with the phoA gene to express alkaline phosphatase in periplasmic space for protein tracing."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-10-29T15:53:45Z"^^ . "eco"^^ . "SEAP reporter assay"^^ . "Secreted Embryonic Alkaline Phosphatase reporter assay"^^ . "ECO:0001801"^^ . "Alkaline phosphatase reporter assay produces a hybrid protein with alkaline phosphatase activity following transportation across the cellular membrane."^^ . "alkaline phosphatase reporter gene assay evidence"^^ . _:genid2900 . _:genid2900 . _:genid2900 . _:genid2900 "A type of reporter gene assay evidence based on the fusion of selected genes with the phoA gene to express alkaline phosphatase in periplasmic space for protein tracing."^^ . _:genid2900 "ECO:SW"^^ . _:genid2900 "PMID:11823238"^^ . . . "For each of the three genes, there was a significant increase of beta-galactosidase activity in Deltazur compared to WT when they grew in TMH with the addition of zinc. Thus, Zur repressed the promoter activities of znuC, znuA and ykgM."^^ . "A type of reporter gene assay evidence based on the fusion of the lacZ gene to a specific promoter for the expression of beta-galactosidase which will appear blue when grown on a X-gal medium."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-10-29T15:57:10Z"^^ . "ECO:0000297"^^ . "LacZ transcript localization evidence"^^ . "beta-gal reporter gene assay"^^ . "beta-galactosidase assay evidence"^^ . "eco"^^ . "lacZ reporter gene assay"^^ . "ECO:0001802"^^ . "The assay is often performed using a plasmid borne construction on a lacZ strain."^^ . "beta-galactosidase reporter gene assay evidence"^^ . _:genid2901 . _:genid2901 . _:genid2901 . _:genid2901 "For each of the three genes, there was a significant increase of beta-galactosidase activity in Deltazur compared to WT when they grew in TMH with the addition of zinc. Thus, Zur repressed the promoter activities of znuC, znuA and ykgM."^^ . _:genid2901 "PMID:19552825"^^ . _:genid2902 . _:genid2902 . _:genid2902 . _:genid2902 "A type of reporter gene assay evidence based on the fusion of the lacZ gene to a specific promoter for the expression of beta-galactosidase which will appear blue when grown on a X-gal medium."^^ . _:genid2902 "ECO:SW"^^ . _:genid2902 "PMID:20439410"^^ . . . "A type of reporter gene assay evidence based on the fusion of the CAT gene to a specific promoter for the expression of chloramphenicol acetyltransferase which confers resistance to the chloramphenicol antibiotic."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-10-29T16:06:42Z"^^ . "CAT reporter gene assay"^^ . "eco"^^ . "ECO:0001803"^^ . "The amount of acetylated chloramphenicol is directly proportional to the amount of CAT enzyme present."^^ . "chloramphenicol acetyltransferase reporter gene assay evidence"^^ . _:genid2903 . _:genid2903 . _:genid2903 . _:genid2903 "A type of reporter gene assay evidence based on the fusion of the CAT gene to a specific promoter for the expression of chloramphenicol acetyltransferase which confers resistance to the chloramphenicol antibiotic."^^ . _:genid2903 "ECO:SW"^^ . _:genid2903 "PMID:1630936"^^ . _:genid2904 . _:genid2904 . _:genid2904 . _:genid2904 "CAT reporter gene assay"^^ . _:genid2904 "PMID:1630936"^^ . . . "A type of reporter gene assay evidence where the beta-glucuronidase enzyme from Escherichia coli is used as the reporter to transform non-fluorescent substrates into fluorescents for detection."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-10-29T16:11:02Z"^^ . "GUS reporter gene assay"^^ . "eco"^^ . "ECO:0001804"^^ . "beta-glucuronidase reporter gene assay evidence"^^ . _:genid2905 . _:genid2905 . _:genid2905 . _:genid2905 "A type of reporter gene assay evidence where the beta-glucuronidase enzyme from Escherichia coli is used as the reporter to transform non-fluorescent substrates into fluorescents for detection."^^ . _:genid2905 "ECO:SW"^^ . . . "A type of reporter gene assay evidence where luciferase, an oxidative enzyme, is used as the reporter to detect a gene product with bioluminescence."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-10-29T16:15:39Z"^^ . "eco"^^ . "ECO:0001805"^^ . "luciferase reporter gene assay evidence"^^ . _:genid2906 . _:genid2906 . _:genid2906 . _:genid2906 "A type of reporter gene assay evidence where luciferase, an oxidative enzyme, is used as the reporter to detect a gene product with bioluminescence."^^ . _:genid2906 "ECO:SW"^^ . _:genid2906 "PMID:17623934"^^ . . . _:genid2907 . _:genid2907 . _:genid2907 . _:genid2907 . "A type of chromatin immunoprecipitation evidence that uses gama-exonuclease to digest TF-unbound DNA after ChIP for the identification of transcription factor binding site locations with high-resolution data."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-10-29T16:37:36Z"^^ . "ChIP-exo"^^ . "eco"^^ . "ECO:0001806"^^ . "chromatin immunoprecipitation- exonuclease evidence"^^ . _:genid2908 . _:genid2908 . _:genid2908 . _:genid2908 "A type of chromatin immunoprecipitation evidence that uses gama-exonuclease to digest TF-unbound DNA after ChIP for the identification of transcription factor binding site locations with high-resolution data."^^ . _:genid2908 "ECO:SW"^^ . _:genid2908 "PMID:25249628"^^ . _:genid2909 . _:genid2909 . _:genid2909 . _:genid2909 "ChIP-exo"^^ . _:genid2909 "PMID:25249628"^^ . . _:genid2910 . _:genid2911 . _:genid2913 _:genid2912 . _:genid2911 _:genid2913 . _:genid2912 . _:genid2912 . _:genid2912 . _:genid2913 . _:genid2910 _:genid2911 . _:genid2910 . . . "IPI"^^ . "A type of electrophoretic mobility shift that is used in a manual assertion."^^ . "swolfish"^^ . "2015-11-03T12:13:17Z"^^ . "EMSA evidence"^^ . "electrophoretic mobility shift assay"^^ . "eco"^^ . "gel retardation assay"^^ . "ECO:0001807"^^ . "electrophoretic mobility shift assay evidence used in manual assertion"^^ . _:genid2914 . _:genid2914 . _:genid2914 . _:genid2914 . _:genid2914 "true"^^ . _:genid2915 . _:genid2915 . _:genid2915 . _:genid2915 "A type of electrophoretic mobility shift that is used in a manual assertion."^^ . _:genid2915 "ECO:SW"^^ . . _:genid2916 . _:genid2917 . _:genid2919 _:genid2918 . _:genid2917 _:genid2919 . _:genid2918 . _:genid2918 . _:genid2918 . _:genid2919 . _:genid2916 _:genid2917 . _:genid2916 . . . "EXP"^^ . "A type of reverse transcription polymerase chain reaction evidence that is used in a manual assertion."^^ . "swolfish"^^ . "2015-11-03T12:22:46Z"^^ . "eco"^^ . "ECO:0001808"^^ . "reverse transcription polymerase chain reaction evidence used in manual assertion"^^ . _:genid2920 . _:genid2920 . _:genid2920 . _:genid2920 . _:genid2920 "true"^^ . _:genid2921 . _:genid2921 . _:genid2921 . _:genid2921 "A type of reverse transcription polymerase chain reaction evidence that is used in a manual assertion."^^ . _:genid2921 "ECO:SW"^^ . . . _:genid2922 . _:genid2922 . _:genid2923 . _:genid2924 . _:genid2926 _:genid2925 . _:genid2924 _:genid2926 . _:genid2925 . _:genid2925 . _:genid2927 . _:genid2928 . _:genid2930 _:genid2929 . _:genid2928 _:genid2930 . _:genid2929 . _:genid2932 _:genid2931 . _:genid2931 . _:genid2931 . _:genid2931 . _:genid2934 _:genid2933 . _:genid2932 _:genid2934 . _:genid2933 . _:genid2933 . _:genid2933 . _:genid2934 . _:genid2929 _:genid2932 . _:genid2930 . _:genid2927 _:genid2928 . _:genid2925 _:genid2927 . _:genid2926 . _:genid2923 _:genid2924 . _:genid2922 _:genid2923 . _:genid2922 . "A type of chromatography evidence where immobilized promoter DNA is labeled and bound to a matrix through which a protein mixture is poured and then eluted to purify specific DNA binding proteins."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-03T13:48:49Z"^^ . "eco"^^ . "DNA affinity purification"^^ . "ECO:0001809"^^ . "Biotinylation is commonly used for labeling and beads are commonly used as the matrix. Bound protein will remain attached to the beads. Results can be detected through gel electrophoresis and then sequenced by mass-spectrometry. This technique can be used to demonstrate binding of a purified protein, or to purify the binding protein from crude extract or protein mixture."^^ . "DNA affinity chromatography evidence"^^ . _:genid2935 . _:genid2935 . _:genid2935 . _:genid2935 "A type of chromatography evidence where immobilized promoter DNA is labeled and bound to a matrix through which a protein mixture is poured and then eluted to purify specific DNA binding proteins."^^ . _:genid2935 "ECO:SW"^^ . _:genid2935 "PMID:11694305"^^ . _:genid2935 "PMID:11725488"^^ . . . "Subsequent DNase I footprinting experiments (Fig. 5d) indicated that His-PhoP protected a single region located from 102 to 47 bp upstream of rovA. This footprint was considered the PhoP site."^^ . "The subsequent DNase I footprinting experiments (Figure 3a) showed that His-OmpR-P protected a single region within the ompR promoter. Therefore, OmpR stimulated its own gene at the transcriptional level, which was mediated through the binding of OmpR-P to its own promoter."^^ . "To precisely determine the PhoP-binding sites of target genes, DNase I footprinting assay was performed on 17 PhoP-dependent promoter DNA regions (both coding and noncoding strands) (Additional file 6). DNase I footprinting results confirmed the direct binding of His-PhoP to these promoter regions in vitro."^^ . "We therefore pursued DNase I footprinting assays on several of the Crp-associated sequences that gave an unusual downshift in our initial EMSA trials, in an effort to identify a consensus binding sequence (see Fig. S2 in the supplemental material). We mapped sites upstream of crp itself, SCO4561 and SCO2977, and identified a consensus binding sequence [GTG(N)6GNCAC]; derivatives of this motif could be found in all of the secondary metabolism-associated target sequences, although notably, one-half of the palindrome seemed to be better conserved than the other [GTG(N)6GNGAN] (Fig. 2C; Table 1)."^^ . "A type of nucleic acid binding evidence where proteins that have been bound to DNA protect a binding site from enzymatic cleavage with DNAse, thereby detecting protein-DNA interactions."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-03T13:55:15Z"^^ . "eco"^^ . "DNase protection"^^ . "ECO:0001810"^^ . "In DNAse footingprinting amplified DNA combined with TF and DNAse is electrophoresed for fragment comparison with a non-TF control sample. TF-bound fragments do not appear in the gel. Such fragments can be isolated, purified, and sequenced. This technique is often used to identify the binding motif of a TF resolving the protected region to 50-100 bp which can be further examined for TF-binding sites."^^ . "DNAse footprinting evidence"^^ . _:genid2936 . _:genid2936 . _:genid2936 . _:genid2936 "Subsequent DNase I footprinting experiments (Fig. 5d) indicated that His-PhoP protected a single region located from 102 to 47 bp upstream of rovA. This footprint was considered the PhoP site."^^ . _:genid2936 "PMID:21966533"^^ . _:genid2937 . _:genid2937 . _:genid2937 . _:genid2937 "The subsequent DNase I footprinting experiments (Figure 3a) showed that His-OmpR-P protected a single region within the ompR promoter. Therefore, OmpR stimulated its own gene at the transcriptional level, which was mediated through the binding of OmpR-P to its own promoter."^^ . _:genid2937 "PMID:21345178"^^ . _:genid2938 . _:genid2938 . _:genid2938 . _:genid2938 "To precisely determine the PhoP-binding sites of target genes, DNase I footprinting assay was performed on 17 PhoP-dependent promoter DNA regions (both coding and noncoding strands) (Additional file 6). DNase I footprinting results confirmed the direct binding of His-PhoP to these promoter regions in vitro."^^ . _:genid2938 "PMID:18366809"^^ . _:genid2939 . _:genid2939 . _:genid2939 . _:genid2939 "We therefore pursued DNase I footprinting assays on several of the Crp-associated sequences that gave an unusual downshift in our initial EMSA trials, in an effort to identify a consensus binding sequence (see Fig. S2 in the supplemental material). We mapped sites upstream of crp itself, SCO4561 and SCO2977, and identified a consensus binding sequence [GTG(N)6GNCAC]; derivatives of this motif could be found in all of the secondary metabolism-associated target sequences, although notably, one-half of the palindrome seemed to be better conserved than the other [GTG(N)6GNGAN] (Fig. 2C; Table 1)."^^ . _:genid2939 "PMID:23232715"^^ . _:genid2940 . _:genid2940 . _:genid2940 . _:genid2940 "A type of nucleic acid binding evidence where proteins that have been bound to DNA protect a binding site from enzymatic cleavage with DNAse, thereby detecting protein-DNA interactions."^^ . _:genid2940 "ECO:SW"^^ . _:genid2940 "PMID:212715"^^ . _:genid2940 "PMID:22194258"^^ . . . _:genid2941 . _:genid2941 . _:genid2941 . _:genid2941 . _:genid2942 . _:genid2942 . _:genid2943 . _:genid2944 . _:genid2946 _:genid2945 . _:genid2944 _:genid2946 . _:genid2945 . _:genid2945 . _:genid2947 . _:genid2947 . _:genid2947 . _:genid2945 _:genid2947 . _:genid2946 . _:genid2943 _:genid2944 . _:genid2942 _:genid2943 . _:genid2942 . "Since these FA analyses are conducted with 300 nM scOhrR, this suggests that oxidation leads to at least a 100-fold reduction in DNA-binding affinity."^^ . "A type of fluorescence evidence based on rapid and quantitative analysis of diverse molecular interactions, enzyme activities, and nucleic acid hybridization which uses a fluorophore to measure the binding constants and kinetics of reactions that cause a change in the rotational time of the molecules."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-03T14:01:36Z"^^ . "FA"^^ . "eco"^^ . "FP"^^ . "Fluorescence polarization"^^ . "ECO:0001811"^^ . "The degree of polarization of a fluorophore is inversely related to its molecular rotation. When the fluorophore is bound to a small molecule, the rate at which it tumbles can decrease significantly from when it is bound tightly to a large protein. If the fluorophore is attached to the larger protein in a binding pair, the difference in polarization between bound and unbound states will be smaller and less accurate. The degree of binding is calculated by using the difference in anisotropy of the partially bound, free, and fully bound states measured by titrating the two binding partners. Fluorescence polarixation assays are homogeneous."^^ . "fluorescence anisotropy evidence"^^ . _:genid2948 . _:genid2948 . _:genid2948 . _:genid2948 "Since these FA analyses are conducted with 300 nM scOhrR, this suggests that oxidation leads to at least a 100-fold reduction in DNA-binding affinity."^^ . _:genid2948 "PMID:19129220"^^ . _:genid2949 . _:genid2949 . _:genid2949 . _:genid2949 "A type of fluorescence evidence based on rapid and quantitative analysis of diverse molecular interactions, enzyme activities, and nucleic acid hybridization which uses a fluorophore to measure the binding constants and kinetics of reactions that cause a change in the rotational time of the molecules."^^ . _:genid2949 "ECO:SW"^^ . _:genid2949 "PMID:20232898"^^ . _:genid2950 . _:genid2950 . _:genid2950 . _:genid2950 "FP"^^ . _:genid2950 "PMCID:3277431"^^ . _:genid2950 "PMID:20232898"^^ . _:genid2951 . _:genid2951 . _:genid2951 . _:genid2951 "Fluorescence polarization"^^ . _:genid2951 "PMCID:3277431"^^ . _:genid2951 "PMID:20232898"^^ . . . "A type of systematic evolution of ligands by exponential amplification evidence based on a restricted genomic DNA library to identify naturally occurring genomic aptamers and RNA-protein interaction networks with RNA-binding protein as bait and high-throughput sequencing."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-03T14:05:37Z"^^ . "genomic SELEX"^^ . "eco"^^ . "ECO:0001812"^^ . "The reported sequences should always be verified for presence in the genome sequence."^^ . "genomic systematic evolution of ligands by exponential amplification evidence"^^ . _:genid2952 . _:genid2952 . _:genid2952 . _:genid2952 "A type of systematic evolution of ligands by exponential amplification evidence based on a restricted genomic DNA library to identify naturally occurring genomic aptamers and RNA-protein interaction networks with RNA-binding protein as bait and high-throughput sequencing."^^ . _:genid2952 "ECO:SW"^^ . _:genid2952 "PMID:20541015"^^ . _:genid2952 "PMID:21720957"^^ . _:genid2953 . _:genid2953 . _:genid2953 . _:genid2953 "genomic SELEX"^^ . _:genid2953 "PMID:20541015"^^ . . . "A type of nuclear magnetic resonance spectroscopy evidence based on two-dimensional NMR for elucidation of the chemical structure of an isolated or synthesized chemical compound where the characteristic transfer magnetization of a proton to a nitrogen or carbon isotope is monitored by NMR, generating a specific peak in the spectrum."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-03T14:11:06Z"^^ . "HSQC"^^ . "eco"^^ . "ECO:0001813"^^ . "Chemical shifts in the spectrum indicating binding can be detected from analysis of a protein spectrum in the presence or absence of its cognate DNA binding site."^^ . "heteronuclear single quantum coherence spectroscopy evidence"^^ . _:genid2954 . _:genid2954 . _:genid2954 . _:genid2954 "A type of nuclear magnetic resonance spectroscopy evidence based on two-dimensional NMR for elucidation of the chemical structure of an isolated or synthesized chemical compound where the characteristic transfer magnetization of a proton to a nitrogen or carbon isotope is monitored by NMR, generating a specific peak in the spectrum."^^ . _:genid2954 "ECO:SW"^^ . _:genid2954 "PMID:19856946"^^ . _:genid2955 . _:genid2955 . _:genid2955 . _:genid2955 "HSQC"^^ . _:genid2955 "PMID:19856946"^^ . . . "A type of nucleic acid binding evidence where the synthetic molecule methidiumpropyl-EDTA (MPE) is used to cleave ligand-protected DNA, followed by analysis of the restriction fragments to generate a footprint (i.e. size and location) of small molecule binding sites on the DNA."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-03T14:24:04Z"^^ . "eco"^^ . "MPE Fe(II) footprinting"^^ . "MPE-EDTA Fe(II) footprinting"^^ . "Methidiumpropyl-EDTA Fe(II) footprinting"^^ . "ECO:0001814"^^ . "methidiumpropyl-ethylenediaminetetraacetic acid iron (II) footprinting evidence"^^ . _:genid2956 . _:genid2956 . _:genid2956 . _:genid2956 "A type of nucleic acid binding evidence where the synthetic molecule methidiumpropyl-EDTA (MPE) is used to cleave ligand-protected DNA, followed by analysis of the restriction fragments to generate a footprint (i.e. size and location) of small molecule binding sites on the DNA."^^ . _:genid2956 "ECO:SW"^^ . _:genid2956 "PMID:6225070"^^ . _:genid2957 . _:genid2957 . _:genid2957 . _:genid2957 "MPE Fe(II) footprinting"^^ . _:genid2957 "PMID:6225070"^^ . _:genid2958 . _:genid2958 . _:genid2958 . _:genid2958 "MPE-EDTA Fe(II) footprinting"^^ . _:genid2958 "PMID:6225070"^^ . _:genid2959 . _:genid2959 . _:genid2959 . _:genid2959 "Methidiumpropyl-EDTA Fe(II) footprinting"^^ . _:genid2959 "PMID:6225070"^^ . . . "A type of nucleic acid binding evidence where nucleic acid that has been bound to protein is cleaved with 1,10-phenanthroline-copper complex resulting in a high-resolution footprint of sequence-specific protein-DNA contacts."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-04T08:37:51Z"^^ . "1,10-Phenanthroline-copper footprinting"^^ . "eco"^^ . "OP-Cu Complex"^^ . "ECO:0001815"^^ . "copper-phenanthroline footprinting evidence"^^ . _:genid2960 . _:genid2960 . _:genid2960 . _:genid2960 "A type of nucleic acid binding evidence where nucleic acid that has been bound to protein is cleaved with 1,10-phenanthroline-copper complex resulting in a high-resolution footprint of sequence-specific protein-DNA contacts."^^ . _:genid2960 "ECO:SW"^^ . _:genid2960 "PMID:11691942"^^ . _:genid2961 . _:genid2961 . _:genid2961 . _:genid2961 "1,10-Phenanthroline-copper footprinting"^^ . _:genid2961 "PMID:1384472"^^ . _:genid2962 . _:genid2962 . _:genid2962 . _:genid2962 "OP-Cu Complex"^^ . _:genid2962 "PMID:1384472"^^ . . . "A type of reporter gene assay evidence based on the fusion of select genes with the green fluorescent protein (GFP) gene for detection with bioluminescence of the gene product when exposed to blue ultraviolet light."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-04T08:58:42Z"^^ . "ECO:0000296"^^ . "GFP reporter gene assay"^^ . "green fluorescent protein transcript localization evidence"^^ . "eco"^^ . "GFP promoter fusion"^^ . "green fluorescent protein promoter fusion"^^ . "ECO:0001816"^^ . "green fluorescent protein reporter gene assay evidence"^^ . _:genid2963 . _:genid2963 . _:genid2963 . _:genid2963 "A type of reporter gene assay evidence based on the fusion of select genes with the green fluorescent protein (GFP) gene for detection with bioluminescence of the gene product when exposed to blue ultraviolet light."^^ . _:genid2963 "ECO:SW"^^ . _:genid2963 "PMID:11989662"^^ . _:genid2964 . _:genid2964 . _:genid2964 . _:genid2964 "GFP reporter gene assay"^^ . _:genid2964 "PMID:11989662"^^ . . . _:genid2965 . _:genid2965 . _:genid2965 . _:genid2965 . _:genid2966 . _:genid2966 . _:genid2967 . _:genid2968 . _:genid2970 _:genid2969 . _:genid2968 _:genid2970 . _:genid2969 . _:genid2969 . _:genid2969 . _:genid2970 . _:genid2967 _:genid2968 . _:genid2966 _:genid2967 . _:genid2966 . "A type of bait-prey hybrid interaction evidence where a gene is fused with the GST gene and the resulting recombinant bait protein is captured on an immobilized Glutathione affinity ligand and incubated with prey protein to identify and characterize protein-protein interactions."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-04T09:05:56Z"^^ . "GST pull-down assay"^^ . "eco"^^ . "ECO:0001817"^^ . "The recombinant protein can also be eluted following the pull-down and analyzed further with qPCR or sequencing."^^ . "glutathione S-transferase pull-down assay evidence"^^ . _:genid2971 . _:genid2971 . _:genid2971 . _:genid2971 "A type of bait-prey hybrid interaction evidence where a gene is fused with the GST gene and the resulting recombinant bait protein is captured on an immobilized Glutathione affinity ligand and incubated with prey protein to identify and characterize protein-protein interactions."^^ . _:genid2971 "ECO:SW"^^ . _:genid2971 "PMID:26096507"^^ . _:genid2972 . _:genid2972 . _:genid2972 . _:genid2972 "GST pull-down assay"^^ . _:genid2972 "PMID:26096507"^^ . . . "A type of nucleic acid binding evidence used to identify protein-binding sites on the DNA molecule where DNA that has been bound to protein is digested with hydroxyl radical produced by reduction of hydrogen peroxide with iron (II), followed by separating the cleavage products on a denaturing electrophoresis gel."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-04T09:20:26Z"^^ . "eco"^^ . "ECO:0001818"^^ . "hydroxyl-radical footprinting evidence"^^ . _:genid2973 . _:genid2973 . _:genid2973 . _:genid2973 "A type of nucleic acid binding evidence used to identify protein-binding sites on the DNA molecule where DNA that has been bound to protein is digested with hydroxyl radical produced by reduction of hydrogen peroxide with iron (II), followed by separating the cleavage products on a denaturing electrophoresis gel."^^ . _:genid2973 "ECO:SW"^^ . _:genid2973 "PMID:18546600"^^ . _:genid2973 "PMID:19378159"^^ . _:genid2973 "PMID:3090544"^^ . . . "The primer extension assay (Fig. 6a) defined the transcription start sites the three sRNA genes qrr2 - 4, and this assay also indicated that the promoter activity of all the thee qrr genes was under the positive control of OpaR."^^ . "The primer extension assay detected two transcriptional start sites located at 343 and 78 bp upstream of rovA (Fig. 2); therefore, two promoters (named P2 and P1, respectively) were transcribed for rovA."^^ . "A type of transcript expression evidence used to determine expression levels of mRNA where a labeled synthetic oligonucleotide primer is annealed to mRNA downstream of the presumed transcription start site of a gene. The mRNA is extended with reverse transcriptase, producing cDNA which is electrophoresed, and the band size is enables determination of the 5' end of the mRNA (i.e. the transcription start site)."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-04T09:33:18Z"^^ . "eco"^^ . "ECO:0001819"^^ . "The most commonly used radiolabel is 32P."^^ . "primer extension assay evidence"^^ . _:genid2974 . _:genid2974 . _:genid2974 . _:genid2974 "The primer extension assay (Fig. 6a) defined the transcription start sites the three sRNA genes qrr2 - 4, and this assay also indicated that the promoter activity of all the thee qrr genes was under the positive control of OpaR."^^ . _:genid2974 "PMID:22506036"^^ . _:genid2975 . _:genid2975 . _:genid2975 . _:genid2975 "The primer extension assay detected two transcriptional start sites located at 343 and 78 bp upstream of rovA (Fig. 2); therefore, two promoters (named P2 and P1, respectively) were transcribed for rovA."^^ . _:genid2975 "PMID:21966533"^^ . _:genid2976 . _:genid2976 . _:genid2976 . _:genid2976 "A type of transcript expression evidence used to determine expression levels of mRNA where a labeled synthetic oligonucleotide primer is annealed to mRNA downstream of the presumed transcription start site of a gene. The mRNA is extended with reverse transcriptase, producing cDNA which is electrophoresed, and the band size is enables determination of the 5' end of the mRNA (i.e. the transcription start site)."^^ . _:genid2976 "ECO:SW"^^ . _:genid2976 "PMID:23378648"^^ . . . _:genid2977 . _:genid2977 . _:genid2978 . _:genid2979 . _:genid2981 _:genid2980 . _:genid2979 _:genid2981 . _:genid2980 . _:genid2980 . _:genid2980 . _:genid2981 . _:genid2978 _:genid2979 . _:genid2977 _:genid2978 . _:genid2977 . _:genid2982 . _:genid2982 . _:genid2983 . _:genid2984 . _:genid2986 _:genid2985 . _:genid2984 _:genid2986 . _:genid2985 . _:genid2985 . _:genid2987 . _:genid2987 . _:genid2987 . _:genid2985 _:genid2987 . _:genid2986 . _:genid2983 _:genid2984 . _:genid2982 _:genid2983 . _:genid2982 . _:genid2988 . _:genid2988 . _:genid2989 . _:genid2990 . _:genid2992 _:genid2991 . _:genid2990 _:genid2992 . _:genid2991 . _:genid2991 . _:genid2993 . _:genid2993 . _:genid2994 . _:genid2995 . _:genid2997 _:genid2996 . _:genid2995 _:genid2997 . _:genid2996 . _:genid2996 . _:genid2996 . _:genid2997 . _:genid2994 _:genid2995 . _:genid2993 _:genid2994 . _:genid2991 _:genid2993 . _:genid2992 . _:genid2989 _:genid2990 . _:genid2988 _:genid2989 . _:genid2988 . "5' RACE analysis was employed to localize the espR promoter using RNA extracted from Mtb H37Rv grown to mid-log phase. The espR transcript starts with a poly-G (7) sequence 144 bp upstream of the translational start codon."^^ . "The 5'-end of the espA mRNA was located 66 bp upstream of the translation start codon using 5' RACE (Fig. S3)."^^ . "Using 5' rapid amplification of cDNA ends (RACE), we mapped the transcriptional start sites of rpoQ and VF_A1016 (Fig. 4A). Neither start site was detected in the DeltarpoQ mutant, supporting the idea that transcription of rpoQ and VF_A1016 requires RpoQ (data not shown)."^^ . "A type of nucleotide sequencing assay evidence in which RT-PCR (cDNA synthesis) is first used to produce a cDNA copy of a region of the RNA transcript being investigated followed by PCR to capture either the unknown 5' or 3' end of the transcript for sequencing, depending on whether 5' RACE-PCR or 3' RACE-PCR are being undertaken."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-04T09:48:38Z"^^ . "3\u2019 RACE-PCR"^^ . "5\u2019 RACE-PCR"^^ . "RACE PCR"^^ . "eco"^^ . "ECO:0001820"^^ . "5' and 3' RACE-PCR utilize different protocols to amplify an unknown end using the known sequence of the center of the transcript. For cDNA synthesis, 5' RACE-PCR uses an anti-sense oligonucleotide primer (gene specific primer (GSP)) that recognizes a known sequence in the middle of the gene of interest and the reverse transcriptase to add base pairs to the 3' end of the primer. Next, terminal deoxynucleotidyl transferase (TdT) is used to add a string of identical nucleotides to the 3' end of the cDNA. A PCR reaction is then carried out, using a second anti-sense gene specific primer (GSP2) that binds to the known sequence, and a sense (forward) universal primer (UP) that binds the homopolymeric tail added to the 3' ends of the cDNAs to amplify a cDNA product from the 5' end. In contrast, 3' RACE-PCR utilizes the naturally occurring 3' polyA tail of the transcript and uses an Oligo-dT-adaptor primer (a primer with a short sequence of deoxy-thymine nucleotides) that complements the polyA tail and adds a special adaptor sequence to the 5' end of each cDNA. PCR is then used to amplify 3' cDNA from a known region using a sense GSP, and an anti-sense primer complementary to the adaptor sequence."^^ . "RACE PCR is frequently used to verify transcription start sites relevant to the function of transcription factor binding sites such as repression."^^ . "rapid amplification of cDNA ends polymerase chain reaction evidence"^^ . _:genid2998 . _:genid2998 . _:genid2998 . _:genid2998 "5' RACE analysis was employed to localize the espR promoter using RNA extracted from Mtb H37Rv grown to mid-log phase. The espR transcript starts with a poly-G (7) sequence 144 bp upstream of the translational start codon."^^ . _:genid2998 "PMID:22479184" . _:genid2999 . _:genid2999 . _:genid2999 . _:genid2999 "The 5'-end of the espA mRNA was located 66 bp upstream of the translation start codon using 5' RACE (Fig. S3)."^^ . _:genid2999 "PMID:22479184" . _:genid3000 . _:genid3000 . _:genid3000 . _:genid3000 "Using 5' rapid amplification of cDNA ends (RACE), we mapped the transcriptional start sites of rpoQ and VF_A1016 (Fig. 4A). Neither start site was detected in the DeltarpoQ mutant, supporting the idea that transcription of rpoQ and VF_A1016 requires RpoQ (data not shown)."^^ . _:genid3000 "PMID:22233679"^^ . _:genid3001 . _:genid3001 . _:genid3001 . _:genid3001 "A type of nucleotide sequencing assay evidence in which RT-PCR (cDNA synthesis) is first used to produce a cDNA copy of a region of the RNA transcript being investigated followed by PCR to capture either the unknown 5' or 3' end of the transcript for sequencing, depending on whether 5' RACE-PCR or 3' RACE-PCR are being undertaken."^^ . _:genid3001 "ECO:SW"^^ . _:genid3001 "PMID:17498297"^^ . _:genid3001 "PMID:7685466" . _:genid3002 . _:genid3002 . _:genid3002 . _:genid3002 "RACE PCR"^^ . _:genid3002 "PMI:17498297"^^ . . "CollecTF"^^ . "swolfish"^^ . "2015-11-04T10:15:57Z"^^ . "eco"^^ . "ECO:0001821"^^ . "Use ECO:0000295 (RNA-seq evidence) in place of this term."^^ . "RNA sequencing assay evidence"^^ . "true"^^ . . . _:genid3003 . _:genid3003 . _:genid3003 . _:genid3003 . _:genid3004 . _:genid3004 . _:genid3004 . _:genid3004 . "A type of knockout evidence based on the survival of an organism in a particular environment where a gene for an enzyme or regulator is knocked out and results are used as a natural reporter."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-04T10:48:59Z"^^ . "eco"^^ . "ECO:0001822"^^ . "survival rate analysis evidence"^^ . _:genid3005 . _:genid3005 . _:genid3005 . _:genid3005 "A type of knockout evidence based on the survival of an organism in a particular environment where a gene for an enzyme or regulator is knocked out and results are used as a natural reporter."^^ . _:genid3005 "ECO:SW"^^ . . . _:genid3006 . _:genid3006 . _:genid3006 . _:genid3006 . "A type of crystallography evidence where a purified sample at high concentration is crystallised and the crystals are exposed to an x ray beam to obtain three dimensional molecular structure of proteins and biological macromolecules."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-04T10:56:22Z"^^ . "eco"^^ . "ECO:0001823"^^ . "X-ray crystallography can be used for a crystal used to probe at the tridimensional structure of proteins. In some cases, it is possible to co-crystallize the protein bound to its DNA binding site, providing detail on the particular arrangement of the two components."^^ . "x-ray crystallography evidence"^^ . _:genid3007 . _:genid3007 . _:genid3007 . _:genid3007 "A type of crystallography evidence where a purified sample at high concentration is crystallised and the crystals are exposed to an x ray beam to obtain three dimensional molecular structure of proteins and biological macromolecules."^^ . _:genid3007 "ECO:SW"^^ . _:genid3007 "PMID:23135450"^^ . _:genid3007 "PMID:24648090"^^ . . . _:genid3008 . _:genid3008 . _:genid3008 . _:genid3008 . _:genid3009 . _:genid3009 . _:genid3010 . _:genid3011 . _:genid3013 _:genid3012 . _:genid3011 _:genid3013 . _:genid3012 . _:genid3012 . _:genid3014 . _:genid3014 . _:genid3014 . _:genid3012 _:genid3014 . _:genid3013 . _:genid3010 _:genid3011 . _:genid3009 _:genid3010 . _:genid3009 . _:genid3015 . _:genid3015 . _:genid3016 . _:genid3017 . _:genid3019 _:genid3018 . _:genid3017 _:genid3019 . _:genid3018 . _:genid3018 . _:genid3020 . _:genid3021 . _:genid3023 _:genid3022 . _:genid3021 _:genid3023 . _:genid3022 . _:genid3022 . _:genid3022 . _:genid3023 . _:genid3020 _:genid3021 . _:genid3018 _:genid3020 . _:genid3019 . _:genid3016 _:genid3017 . _:genid3015 _:genid3016 . _:genid3015 . "A type of affinity evidence used to identify DNA binding sites in eukaryotes where Escherichia coli DNA adenine methyltransferase (Dam) is fused to a transcription factor, co-factor, chromatin-associated protein, or nuclear-associated protein, followed by a methyl-dependent PCR to localize methyltransferase in the region of the binding site."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-05T15:56:13Z"^^ . "DamID"^^ . "eco"^^ . "ECO:0001824"^^ . "The methylation tag is detected with methylation-sensitive restriction enzymes, DpnI and DpnII."^^ . "DNA adenine methyltransferase identification evidence"^^ . _:genid3024 . _:genid3024 . _:genid3024 . _:genid3024 "A type of affinity evidence used to identify DNA binding sites in eukaryotes where Escherichia coli DNA adenine methyltransferase (Dam) is fused to a transcription factor, co-factor, chromatin-associated protein, or nuclear-associated protein, followed by a methyl-dependent PCR to localize methyltransferase in the region of the binding site."^^ . _:genid3024 "ECO:SW"^^ . _:genid3024 "PMID:16938559"^^ . _:genid3024 "PMID:17545983"^^ . _:genid3024 "PMID:19588092"^^ . _:genid3025 . _:genid3025 . _:genid3025 . _:genid3025 "DamID"^^ . _:genid3025 "PMID:19588092"^^ . . . _:genid3026 . _:genid3026 . _:genid3026 . _:genid3026 . _:genid3027 . _:genid3027 . _:genid3028 . _:genid3029 . _:genid3031 _:genid3030 . _:genid3029 _:genid3031 . _:genid3030 . _:genid3030 . _:genid3032 . _:genid3032 . _:genid3032 . _:genid3030 _:genid3032 . _:genid3031 . _:genid3028 _:genid3029 . _:genid3027 _:genid3028 . _:genid3027 . "A type of affinity evidence where the absorbed or released heat of a biomolecular binding event is directly measured in a reference cell and sample cell after the addition of a ligand using a microcalorimeter for a complete thermodynamic profile of the molecular interaction."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-05T16:06:20Z"^^ . "ITC"^^ . "eco"^^ . "ECO:0001825"^^ . "When ITC is used to study TF, the temperature of two identical cells containing a known concentration of TF is monitored. After the ligand is added to the cells in precisely measured aliquots, the temperature difference in each cell is observed to determine target binding. This value can be used to compute the energetics of the reaction and hence, binding affinity of the TF for the DNA fragment. The thermodynamic profile that is measured includes the values of binding constant (K(a)), stoichiometry (n), and the enthalpy of binding (DeltaH(b))."^^ . "isothermal titration calorimetry evidence"^^ . _:genid3033 . _:genid3033 . _:genid3033 . _:genid3033 "A type of affinity evidence where the absorbed or released heat of a biomolecular binding event is directly measured in a reference cell and sample cell after the addition of a ligand using a microcalorimeter for a complete thermodynamic profile of the molecular interaction."^^ . _:genid3033 "ECO:SW"^^ . _:genid3033 "PMID:10527727"^^ . _:genid3034 . _:genid3034 . _:genid3034 . _:genid3034 "ITC"^^ . _:genid3034 "PMID:10527727"^^ . . . "A type of nucleic acid binding evidence where DNA is non-specifically fragmented with ultraviolet light while protein-bound regions are protected from UV damage and strand breakage patterns are analyzed by PAGE and sequenced to detect protein-DNA contacts."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-05T16:13:36Z"^^ . "eco"^^ . "UV footprinting"^^ . "ultraviolet footprinting"^^ . "ECO:0001826"^^ . "ultraviolet light footprinting evidence"^^ . _:genid3035 . _:genid3035 . _:genid3035 . _:genid3035 "A type of nucleic acid binding evidence where DNA is non-specifically fragmented with ultraviolet light while protein-bound regions are protected from UV damage and strand breakage patterns are analyzed by PAGE and sequenced to detect protein-DNA contacts."^^ . _:genid3035 "ECO:SW"^^ . _:genid3035 "PMID:2842760"^^ . _:genid3035 "PMID:7602584"^^ . . . "A type of nucleic acid binding evidence used to identify protein binding sites on the DNA molecule where multiple copies of a DNA fragment containing a putative TF-binding site are randomly methylated with dimethyl sulfate (DMS) and cleaved at the methyl group, followed by separating the cleavage products on a denaturing electrophoresis gel."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-05T16:16:27Z"^^ . "methylation interference footprinting evidence"^^ . "eco"^^ . "ECO:0001827"^^ . "methylation interference footprinting evidence"^^ . _:genid3036 . _:genid3036 . _:genid3036 . _:genid3036 "A type of nucleic acid binding evidence used to identify protein binding sites on the DNA molecule where multiple copies of a DNA fragment containing a putative TF-binding site are randomly methylated with dimethyl sulfate (DMS) and cleaved at the methyl group, followed by separating the cleavage products on a denaturing electrophoresis gel."^^ . _:genid3036 "ECO:SW"^^ . _:genid3036 "PMID:1583685"^^ . . _:genid3037 . _:genid3038 . _:genid3040 _:genid3039 . _:genid3038 _:genid3040 . _:genid3039 . _:genid3039 . _:genid3039 . _:genid3040 . _:genid3037 _:genid3038 . _:genid3037 . . . "A type of inference of sequence features from visual inspection that is used in a manual assertion."^^ . "swolfish"^^ . "2015-11-10T14:40:16Z"^^ . "visual sequence inspection evidence" . "eco"^^ . "ECO:0001828"^^ . "inference of sequence features from visual inspection used in manual assertion"^^ . _:genid3041 . _:genid3041 . _:genid3041 . _:genid3041 . _:genid3041 "true"^^ . _:genid3042 . _:genid3042 . _:genid3042 . _:genid3042 . _:genid3042 "true"^^ . _:genid3043 . _:genid3043 . _:genid3043 . _:genid3043 "A type of inference of sequence features from visual inspection that is used in a manual assertion."^^ . _:genid3043 "ECO:RCJ"^^ . . . _:genid3044 . _:genid3044 . _:genid3044 . _:genid3044 . _:genid3045 . _:genid3045 . _:genid3046 . _:genid3047 . _:genid3049 _:genid3048 . _:genid3047 _:genid3049 . _:genid3048 . _:genid3048 . _:genid3050 . _:genid3050 . _:genid3050 . _:genid3048 _:genid3050 . _:genid3049 . _:genid3046 _:genid3047 . _:genid3045 _:genid3046 . _:genid3045 . "A type of reporter gene assay evidence used to locate and isolate Fur sites where a plasmid library is created and cloned into a cell line with a ferric uptake regulator (Fur)-repressed reporter and the Fur protein is titrated away from its binding site on the reporter, after which the cell is isolated and plasmid extracted for further sequence analysis."^^ . "CollecTF"^^ . "swolfish"^^ . "2015-11-10T14:55:36Z"^^ . "FURTA"^^ . "eco"^^ . "Fluorescence polarization"^^ . "ECO:0001829"^^ . "ferric uptake regulator titration assay evidence"^^ . _:genid3051 . _:genid3051 . _:genid3051 . _:genid3051 "A type of reporter gene assay evidence used to locate and isolate Fur sites where a plasmid library is created and cloned into a cell line with a ferric uptake regulator (Fur)-repressed reporter and the Fur protein is titrated away from its binding site on the reporter, after which the cell is isolated and plasmid extracted for further sequence analysis."^^ . _:genid3051 "ECO:SW"^^ . _:genid3051 "PMID:10713425"^^ . _:genid3051 "PMID:7642488"^^ . _:genid3051 "PMID:8107138"^^ . _:genid3052 . _:genid3052 . _:genid3052 . _:genid3052 "FURTA"^^ . _:genid3052 "PMID:10713425"^^ . _:genid3053 . _:genid3053 . _:genid3053 . _:genid3053 "Fluorescence polarization"^^ . _:genid3053 "PMID:15689115"^^ . . . "A type of experimental evidence in which the colonization or adhesion capacity is measured."^^ . "CollecTF"^^ . "jbmunro"^^ . "2019-05-06T12:00:00Z"^^ . "adhesion assay evidence"^^ . "eco"^^ . "ECO:0001830"^^ . "Has to do with the ability of the bacterium or virus to bind to a host."^^ . "host colonization assay evidence"^^ . . _:genid3054 . _:genid3055 . _:genid3057 _:genid3056 . _:genid3055 _:genid3057 . _:genid3056 . _:genid3056 . _:genid3056 . _:genid3057 . _:genid3054 _:genid3055 . _:genid3054 . . . "IEA"^^ . "A type of host colonization assay evidence that is used in an automatic assertion."^^ . "CollecTF"^^ . "jbmunro"^^ . "2019-05-06T12:00:00Z"^^ . "eco"^^ . "ECO:0001831"^^ . "host colonization assay evidence used in automatic assertion"^^ . _:genid3058 . _:genid3058 . _:genid3058 . _:genid3058 . _:genid3058 "true"^^ . . _:genid3059 . _:genid3060 . _:genid3062 _:genid3061 . _:genid3060 _:genid3062 . _:genid3061 . _:genid3061 . _:genid3061 . _:genid3062 . _:genid3059 _:genid3060 . _:genid3059 . . . "EXP"^^ . "A type of host colonization assay evidence that is used in a manual assertion."^^ . "CollecTF"^^ . "jbmunro"^^ . "2019-05-06T12:00:00Z"^^ . "eco"^^ . "ECO:0001832"^^ . "host colonization assay evidence used in manual assertion"^^ . _:genid3063 . _:genid3063 . _:genid3063 . _:genid3063 . _:genid3063 "true"^^ . . . "A type of host colonization assay evidence in which the infection capacity is measured by assessing changes in the host."^^ . "CollecTF"^^ . "jbmunro"^^ . "2019-05-06T12:00:00Z"^^ . "eco"^^ . "ECO:0001833"^^ . "Has to do with the outcome of a bacterial or viral / host interaction, be it a measure of cell death, cytotoxicity, invasion, etc."^^ . "infection assay evidence"^^ . . _:genid3064 . _:genid3065 . _:genid3067 _:genid3066 . _:genid3065 _:genid3067 . _:genid3066 . _:genid3066 . _:genid3066 . _:genid3067 . _:genid3064 _:genid3065 . _:genid3064 . . . "IEA"^^ . "A type of infection assay evidence that is used in an automatic assertion."^^ . "CollecTF"^^ . "jbmunro"^^ . "2019-05-06T12:00:00Z"^^ . "eco"^^ . "ECO:0001834"^^ . "infection assay evidence used in automatic assertion"^^ . _:genid3068 . _:genid3068 . _:genid3068 . _:genid3068 . _:genid3068 "true"^^ . . _:genid3069 . _:genid3070 . _:genid3072 _:genid3071 . _:genid3070 _:genid3072 . _:genid3071 . _:genid3071 . _:genid3071 . _:genid3072 . _:genid3069 _:genid3070 . _:genid3069 . . . "EXP"^^ . "A type of infection assay evidence that is used in a manual assertion."^^ . "CollecTF"^^ . "jbmunro"^^ . "2019-05-06T12:00:00Z"^^ . "eco"^^ . "ECO:0001835"^^ . "infection assay evidence used in manual assertion"^^ . _:genid3073 . _:genid3073 . _:genid3073 . _:genid3073 . _:genid3073 "true"^^ . . . "A type of expression pattern evidence in which single-stranded DNA or RNA (probe) are annealed to complementary DNA or RNA in a portion or section of tissue."^^ . "planarian anatomy ontology (PLANA)"^^ . "jbmunro"^^ . "2019-09-26T12:00:00Z"^^ . "eco"^^ . "ECO:0001836"^^ . "in situ hybridization evidence"^^ . . _:genid3074 . _:genid3075 . _:genid3077 _:genid3076 . _:genid3075 _:genid3077 . _:genid3076 . _:genid3076 . _:genid3076 . _:genid3077 . _:genid3074 _:genid3075 . _:genid3074 . . . "IEA"^^ . "A type of in situ hybridization evidence that is used in an automatic assertion."^^ . "jbmunro"^^ . "2019-09-26T12:00:00Z"^^ . "eco"^^ . "ECO:0001837"^^ . "in situ hybridization evidence used in automatic assertion"^^ . _:genid3078 . _:genid3078 . _:genid3078 . _:genid3078 . _:genid3078 "true"^^ . . _:genid3079 . _:genid3080 . _:genid3082 _:genid3081 . _:genid3080 _:genid3082 . _:genid3081 . _:genid3081 . _:genid3081 . _:genid3082 . _:genid3079 _:genid3080 . _:genid3079 . . . "IEP"^^ . "A type of in situ hybridization evidence that is used in a manual assertion."^^ . "jbmunro"^^ . "2019-09-26T12:00:00Z"^^ . "eco"^^ . "ECO:0001838"^^ . "in situ hybridization evidence used in manual assertion"^^ . _:genid3083 . _:genid3083 . _:genid3083 . _:genid3083 . _:genid3083 "true"^^ . . . "A type of nucleic acid localization evidence and in situ hybridization evidence resulting from the use of colorimetric probes to detect complementary sequences of nucleic acids."^^ . "planarian anatomy ontology (PLANA)"^^ . "jbmunro"^^ . "2019-09-26T12:00:00Z"^^ . "eco"^^ . "ECO:0001839"^^ . "colorimetric in situ hybridization evidence"^^ . _:genid3084 . _:genid3084 . _:genid3084 . _:genid3084 "A type of nucleic acid localization evidence and in situ hybridization evidence resulting from the use of colorimetric probes to detect complementary sequences of nucleic acids."^^ . _:genid3084 "PMID:23497040"^^ . . _:genid3085 . _:genid3086 . _:genid3088 _:genid3087 . _:genid3086 _:genid3088 . _:genid3087 . _:genid3087 . _:genid3087 . _:genid3088 . _:genid3085 _:genid3086 . _:genid3085 . . . "IEA"^^ . "A type of colorimetric in situ hybridization evidence that is used in an automatic assertion."^^ . "jbmunro"^^ . "2019-09-26T12:00:00Z"^^ . "eco"^^ . "ECO:0001840"^^ . "colorimetric in situ hybridization evidence used in automatic assertion"^^ . _:genid3089 . _:genid3089 . _:genid3089 . _:genid3089 . _:genid3089 "true"^^ . . _:genid3090 . _:genid3091 . _:genid3093 _:genid3092 . _:genid3091 _:genid3093 . _:genid3092 . _:genid3092 . _:genid3092 . _:genid3093 . _:genid3090 _:genid3091 . _:genid3090 . . . "IEP"^^ . "A type of colorimetric in situ hybridization evidence that is used in a manual assertion."^^ . "jbmunro"^^ . "2019-09-26T12:00:00Z"^^ . "eco"^^ . "ECO:0001841"^^ . "colorimetric in situ hybridization evidence used in manual assertion"^^ . _:genid3094 . _:genid3094 . _:genid3094 . _:genid3094 . _:genid3094 "true"^^ . . . "A type of random mutagenesis phenotypic evidence resulting from the random mutation of a specifically targeted region of DNA."^^ . "ECO"^^ . "jbmunro"^^ . "2019-12-09T12:00:00Z"^^ . "eco"^^ . "ECO:0001842"^^ . "random mutagenesis of specific target DNA evidence"^^ . . _:genid3095 . _:genid3096 . _:genid3098 _:genid3097 . _:genid3096 _:genid3098 . _:genid3097 . _:genid3097 . _:genid3097 . _:genid3098 . _:genid3095 _:genid3096 . _:genid3095 . . . "IEA"^^ . "A type of random mutagenesis of specific target DNA evidence that is used in an automatic assertion."^^ . "ECO"^^ . "jbmunro"^^ . "2019-12-09T12:00:00Z"^^ . "eco"^^ . "ECO:0001843"^^ . "random mutagenesis of specific target DNA evidence used in automatic assertion"^^ . _:genid3099 . _:genid3099 . _:genid3099 . _:genid3099 . _:genid3099 "true"^^ . . _:genid3100 . _:genid3101 . _:genid3103 _:genid3102 . _:genid3101 _:genid3103 . _:genid3102 . _:genid3102 . _:genid3102 . _:genid3103 . _:genid3100 _:genid3101 . _:genid3100 . . . "IMP"^^ . "A type of random mutagenesis of specific target DNA evidence that is used in a manual assertion."^^ . "ECO"^^ . "jbmunro"^^ . "2019-12-09T12:00:00Z"^^ . "eco"^^ . "ECO:0001844"^^ . "random mutagenesis of specific target DNA evidence used in manual assertion"^^ . _:genid3104 . _:genid3104 . _:genid3104 . _:genid3104 . _:genid3104 "true"^^ . . . "A type of cell-based assay evidence in which optical density is used to measure some aspect of a population of cells. Examples of aspects that can affect optical density measurements include, but are not limited to, cell number and cell shape."^^ . "CACAO"^^ . "jbmunro"^^ . "2020-01-28T12:00:00Z"^^ . "eco"^^ . "ECO:0001845"^^ . "cell population optical density evidence"^^ . . . "A type of cell population optical density evidence that is used in an automatic assertion."^^ . "CACAO"^^ . "jbmunro"^^ . "2020-01-28T12:00:00Z"^^ . "eco"^^ . "ECO:0001846"^^ . "cell population optical density evidence used in automatic assertion"^^ . . . "A type of cell population optical density evidence that is used in a manual assertion."^^ . "CACAO"^^ . "jbmunro"^^ . "2020-01-28T12:00:00Z"^^ . "eco"^^ . "ECO:0001847"^^ . "cell population optical density evidence used in manual assertion"^^ . . . _:genid3105 . _:genid3105 . _:genid3105 . _:genid3105 . _:genid3106 . _:genid3106 . _:genid3106 . _:genid3106 . _:genid3107 . _:genid3107 . _:genid3108 . _:genid3109 . _:genid3111 _:genid3110 . _:genid3109 _:genid3111 . _:genid3110 . _:genid3110 . _:genid3110 . _:genid3111 . _:genid3108 _:genid3109 . _:genid3107 _:genid3108 . _:genid3107 . _:genid3112 . _:genid3112 . _:genid3113 . _:genid3114 . _:genid3116 _:genid3115 . _:genid3114 _:genid3116 . _:genid3115 . _:genid3115 . _:genid3117 . _:genid3117 . _:genid3117 . _:genid3115 _:genid3117 . _:genid3116 . _:genid3113 _:genid3114 . _:genid3112 _:genid3113 . _:genid3112 . "A type of cell-based assay evidence resulting from analyzing the ability of cells to survive or live successfully."^^ . "snadendla"^^ . "2015-02-13T12:08:01Z"^^ . "eco"^^ . "ECO:0005004"^^ . "cell viability assay evidence"^^ . _:genid3118 . _:genid3118 . _:genid3118 . _:genid3118 "A type of cell-based assay evidence resulting from analyzing the ability of cells to survive or live successfully."^^ . _:genid3118 "NBK:144065"^^ . . . _:genid3119 . _:genid3119 . _:genid3119 . _:genid3119 . _:genid3120 . _:genid3120 . _:genid3120 . _:genid3120 . _:genid3121 . _:genid3121 . _:genid3122 . _:genid3123 . _:genid3125 _:genid3124 . _:genid3123 _:genid3125 . _:genid3124 . _:genid3124 . _:genid3126 . _:genid3126 . _:genid3126 . _:genid3124 _:genid3126 . _:genid3125 . _:genid3122 _:genid3123 . _:genid3121 _:genid3122 . _:genid3121 . "A type of cell-based assay evidence resulting from the measurement of the number of cells, which is a reflection of the balance between cell division and cell loss through cell differentiation or cell death."^^ . "snadendla"^^ . "2015-02-11T16:27:13Z"^^ . "eco"^^ . "ECO:0005007"^^ . "cell proliferation assay evidence"^^ . _:genid3127 . _:genid3127 . _:genid3127 . _:genid3127 "A type of cell-based assay evidence resulting from the measurement of the number of cells, which is a reflection of the balance between cell division and cell loss through cell differentiation or cell death."^^ . _:genid3127 "ECO:RCT"^^ . _:genid3127 "GO:0008283"^^ . _:genid3127 "PMID:11057898"^^ . . . _:genid3128 . _:genid3128 . _:genid3128 . _:genid3128 . "A type of cell proliferation assay evidence resulting from the measure of DNA synthesis in the presece of a label."^^ . "snadendla"^^ . "2015-02-11T16:30:10Z"^^ . "eco"^^ . "ECO:0005008"^^ . "DNA synthesis cell proliferation assay evidence"^^ . _:genid3129 . _:genid3129 . _:genid3129 . _:genid3129 "A type of cell proliferation assay evidence resulting from the measure of DNA synthesis in the presece of a label."^^ . _:genid3129 "PMC:3908118"^^ . . . _:genid3130 . _:genid3130 . _:genid3130 . _:genid3130 . "A type of cell viability assay evidence resulting from the analysis of ATP concentration (by measuring light intensity) when luciferase catalyzes the oxidation of luciferin in the presence of ATP, magnesium ions and molecular oxygen."^^ . "snadendla"^^ . "2015-02-11T16:47:30Z"^^ . "eco"^^ . "ECO:0005011"^^ . "ATP bioluminescence assay evidence"^^ . _:genid3131 . _:genid3131 . _:genid3131 . _:genid3131 "A type of cell viability assay evidence resulting from the analysis of ATP concentration (by measuring light intensity) when luciferase catalyzes the oxidation of luciferin in the presence of ATP, magnesium ions and molecular oxygen."^^ . _:genid3131 "PMID:15344559"^^ . . . _:genid3132 . _:genid3132 . _:genid3132 . _:genid3132 . _:genid3133 . _:genid3133 . _:genid3133 . _:genid3133 . _:genid3134 . _:genid3134 . _:genid3135 . _:genid3136 . _:genid3138 _:genid3137 . _:genid3136 _:genid3138 . _:genid3137 . _:genid3137 . _:genid3139 . _:genid3139 . _:genid3139 . _:genid3137 _:genid3139 . _:genid3138 . _:genid3135 _:genid3136 . _:genid3134 _:genid3135 . _:genid3134 . "A type of cell-based assay evidence resulting from the ability of an agent to induce cellular necrosis or apoptosis and the subsequent analysis of cell death mechanism."^^ . "snadendla"^^ . "2015-02-12T11:39:35Z"^^ . "eco"^^ . "ECO:0005012"^^ . "cytotoxicity assay evidence"^^ . . "snadendla"^^ . "2015-02-12T13:26:55Z"^^ . "eco"^^ . "ECO:0005014"^^ . "Use children of ECO:0001565 (cell-based assay evidence) in place of this term."^^ . "in vitro cell based assay evidence"^^ . "true"^^ . . . _:genid3140 . _:genid3140 . _:genid3141 . _:genid3142 . _:genid3144 _:genid3143 . _:genid3142 _:genid3144 . _:genid3143 . _:genid3143 . _:genid3143 . _:genid3144 . _:genid3141 _:genid3142 . _:genid3140 _:genid3141 . _:genid3140 . "A type of direct assay evidence resulting from the use of stains or dyes to aid in analysis of a microscopic image."^^ . "snadendla"^^ . "2015-02-19T11:48:57Z"^^ . "eco"^^ . "ECO:0005019"^^ . "staining evidence"^^ . _:genid3145 . _:genid3145 . _:genid3145 . _:genid3145 "A type of direct assay evidence resulting from the use of stains or dyes to aid in analysis of a microscopic image."^^ . _:genid3145 "ECO:RCT"^^ . . . _:genid3146 . _:genid3146 . _:genid3146 . _:genid3146 . _:genid3147 . _:genid3147 . _:genid3147 . _:genid3147 . _:genid3148 . _:genid3148 . _:genid3149 . _:genid3150 . _:genid3152 _:genid3151 . _:genid3150 _:genid3152 . _:genid3151 . _:genid3151 . _:genid3151 . _:genid3152 . _:genid3149 _:genid3150 . _:genid3148 _:genid3149 . _:genid3148 . _:genid3153 . _:genid3153 . _:genid3154 . _:genid3155 . _:genid3157 _:genid3156 . _:genid3155 _:genid3157 . _:genid3156 . _:genid3156 . _:genid3158 . _:genid3158 . _:genid3158 . _:genid3156 _:genid3158 . _:genid3157 . _:genid3154 _:genid3155 . _:genid3153 _:genid3154 . _:genid3153 . "A type of cell-based assay evidence resulting from the evaluation of chemotactic ability (i.e. the movement, or lack of movement, in response to a chemical stimulus) of prokaryotic or eukaryotic cells."^^ . "snadendla"^^ . "2015-02-19T13:10:20Z"^^ . "eco"^^ . "ECO:0005021"^^ . "chemotaxis assay evidence"^^ . _:genid3159 . _:genid3159 . _:genid3159 . _:genid3159 "A type of cell-based assay evidence resulting from the evaluation of chemotactic ability (i.e. the movement, or lack of movement, in response to a chemical stimulus) of prokaryotic or eukaryotic cells."^^ . _:genid3159 "PMC:3667641"^^ . . . _:genid3160 . _:genid3160 . _:genid3161 . _:genid3162 . _:genid3164 _:genid3163 . _:genid3162 _:genid3164 . _:genid3163 . _:genid3163 . _:genid3163 . _:genid3164 . _:genid3161 _:genid3162 . _:genid3160 _:genid3161 . _:genid3160 . _:genid3165 . _:genid3165 . _:genid3166 . _:genid3167 . _:genid3169 _:genid3168 . _:genid3167 _:genid3169 . _:genid3168 . _:genid3168 . _:genid3170 . _:genid3170 . _:genid3170 . _:genid3168 _:genid3170 . _:genid3169 . _:genid3166 _:genid3167 . _:genid3165 _:genid3166 . _:genid3165 . "A type of mutant phenotype evidence resulting from the conversion of one genotype into another by the introduction of exogenous DNA."^^ . "snadendla"^^ . "2015-03-16T15:33:50Z"^^ . "eco"^^ . "ECO:0005027"^^ . "genetic transformation evidence"^^ . _:genid3171 . _:genid3171 . _:genid3171 . _:genid3171 "A type of mutant phenotype evidence resulting from the conversion of one genotype into another by the introduction of exogenous DNA."^^ . _:genid3171 "ECO:RCT"^^ . . . _:genid3172 . _:genid3172 . _:genid3173 . _:genid3174 . _:genid3176 _:genid3175 . _:genid3174 _:genid3176 . _:genid3175 . _:genid3175 . _:genid3177 . _:genid3177 . _:genid3178 . _:genid3179 . _:genid3181 _:genid3180 . _:genid3179 _:genid3181 . _:genid3180 . _:genid3180 . _:genid3182 . _:genid3183 . _:genid3184 . _:genid3183 _:genid3184 . _:genid3184 . _:genid3182 _:genid3183 . _:genid3180 _:genid3182 . _:genid3181 . _:genid3178 _:genid3179 . _:genid3177 _:genid3178 . _:genid3175 _:genid3177 . _:genid3176 . _:genid3173 _:genid3174 . _:genid3172 _:genid3173 . _:genid3172 . "The secondary structure of VapC10 (Figure S2), predicted with the 3DJIGSAW prediction tool [36] and the DALI server [37], exhibited homology with several well studied VapC toxins, such as the first PIN domain structure for the protein PAE2754 from the archae bacterium Pyrobaculum aerophilum (30)."^^ . "A type of experimental evidence resulting from the visualization and examination of chemical and/or molecular structures."^^ . "snadendla"^^ . "2015-03-20T12:16:17Z"^^ . "eco"^^ . "ECO:0005031"^^ . "structure determination evidence"^^ . _:genid3185 . _:genid3185 . _:genid3185 . _:genid3185 "The secondary structure of VapC10 (Figure S2), predicted with the 3DJIGSAW prediction tool [36] and the DALI server [37], exhibited homology with several well studied VapC toxins, such as the first PIN domain structure for the protein PAE2754 from the archae bacterium Pyrobaculum aerophilum (30)."^^ . _:genid3185 "PMID:24260461"^^ . _:genid3186 . _:genid3186 . _:genid3186 . _:genid3186 "A type of experimental evidence resulting from the visualization and examination of chemical and/or molecular structures."^^ . _:genid3186 "ECO:RCT"^^ . . . . _:genid3187 . _:genid3187 . _:genid3187 . _:genid3187 . "Electron micrographs showed that all the cells are rod-shaped and those of the parent strain Ye9 and the envZ mutant strain EZ10 are flagellated, but the ompR mutant cells lack flagella."^^ . "A type of microscopy evidence and structure determination evidence resulting from an electron beam utilized to create an image."^^ . "snadendla"^^ . "2015-03-20T12:21:48Z"^^ . "eco"^^ . "ECO:0005033"^^ . "electron microscopy evidence"^^ . _:genid3188 . _:genid3188 . _:genid3188 . _:genid3188 "Electron micrographs showed that all the cells are rod-shaped and those of the parent strain Ye9 and the envZ mutant strain EZ10 are flagellated, but the ompR mutant cells lack flagella."^^ . _:genid3188 "PMID:20830609"^^ . _:genid3189 . _:genid3189 . _:genid3189 . _:genid3189 "A type of microscopy evidence and structure determination evidence resulting from an electron beam utilized to create an image."^^ . _:genid3189 "ECO:RCT"^^ . . . _:genid3190 . _:genid3190 . _:genid3190 . _:genid3190 . _:genid3191 . _:genid3191 . _:genid3191 . _:genid3191 . _:genid3192 . _:genid3192 . _:genid3193 . _:genid3194 . _:genid3196 _:genid3195 . _:genid3194 _:genid3196 . _:genid3195 . _:genid3195 . _:genid3197 . _:genid3197 . _:genid3197 . _:genid3195 _:genid3197 . _:genid3196 . _:genid3193 _:genid3194 . _:genid3192 _:genid3193 . _:genid3192 . "A type of cell-based assay evidence resulting from the occurrence, visualization, and/or analysis of apoptosis."^^ . "snadendla"^^ . "2015-04-07T21:58:24Z"^^ . "eco"^^ . "ECO:0005034"^^ . "apoptotic assay evidence"^^ . _:genid3198 . _:genid3198 . _:genid3198 . _:genid3198 "A type of cell-based assay evidence resulting from the occurrence, visualization, and/or analysis of apoptosis."^^ . _:genid3198 "ECO:RCT"^^ . . . "A type of polyADP-ribosylation assay evidence used in an in vivo experiment."^^ . "snadendla"^^ . "2015-06-15T15:35:05Z"^^ . "eco"^^ . "ECO:0005500"^^ . "in vivo polyADP-ribosylation assay evidence"^^ . _:genid3199 . _:genid3199 . _:genid3199 . _:genid3199 "A type of polyADP-ribosylation assay evidence used in an in vivo experiment."^^ . _:genid3199 "ECO:SN"^^ . _:genid3199 "PMID:2820766"^^ . _:genid3199 "SIB:PG"^^ . . _:genid3200 . _:genid3201 . _:genid3203 _:genid3202 . _:genid3201 _:genid3203 . _:genid3202 . _:genid3202 . _:genid3202 . _:genid3203 . _:genid3200 _:genid3201 . _:genid3200 . . . "IDA"^^ . "A type of in vivo polyADP-ribosylation assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2015-06-15T15:37:23Z"^^ . "eco"^^ . "ECO:0005501"^^ . "in vivo polyADP-ribosylation assay evidence used in manual assertion"^^ . _:genid3204 . _:genid3204 . _:genid3204 . _:genid3204 . _:genid3204 "true"^^ . _:genid3205 . _:genid3205 . _:genid3205 . _:genid3205 "A type of in vivo polyADP-ribosylation assay evidence that is used in a manual assertion."^^ . _:genid3205 "ECO:SN"^^ . . . _:genid3206 . _:genid3206 . _:genid3206 . _:genid3206 . _:genid3207 . _:genid3207 . _:genid3208 . _:genid3209 . _:genid3211 _:genid3210 . _:genid3209 _:genid3211 . _:genid3210 . _:genid3210 . _:genid3212 . _:genid3212 . _:genid3212 . _:genid3210 _:genid3212 . _:genid3211 . _:genid3208 _:genid3209 . _:genid3207 _:genid3208 . _:genid3207 . "A type of direct assay evidence derived by studying an organ, tissues, or cells taken from an organism and studied in an external environment with the minimum alteration of natural conditions."^^ . "snadendla"^^ . "2015-06-26T11:46:15Z"^^ . "eco"^^ . "ECO:0005502"^^ . "ex vivo assay evidence"^^ . _:genid3213 . _:genid3213 . _:genid3213 . _:genid3213 "A type of direct assay evidence derived by studying an organ, tissues, or cells taken from an organism and studied in an external environment with the minimum alteration of natural conditions."^^ . _:genid3213 "ECO:SN"^^ . _:genid3213 "PMID:16305312"^^ . _:genid3213 "url:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2305722/pdf/nihms42807.pdf"^^ . . . _:genid3214 . _:genid3214 . _:genid3215 . _:genid3216 . _:genid3218 _:genid3217 . _:genid3216 _:genid3218 . _:genid3217 . _:genid3217 . _:genid3219 . _:genid3220 . _:genid3222 _:genid3221 . _:genid3220 _:genid3222 . _:genid3221 . _:genid3221 . _:genid3221 . _:genid3222 . _:genid3219 _:genid3220 . _:genid3217 _:genid3219 . _:genid3218 . _:genid3215 _:genid3216 . _:genid3214 _:genid3215 . _:genid3214 . "A type of gel electrophoresis evidence that involves one dimension electrophoresis where biomolecules are electrophoresed on a low percentage polyacrylamide gel to be separated in proportion to their mass or isoelectric point, followed by high voltage electrophoresis on a higher percentage gel in the presence of ethidium bromide to alter non-linear molecular shape."^^ . "CollecTF"^^ . "snadendla"^^ . "2015-10-01T16:23:20Z"^^ . "2D PAGE"^^ . "2D-PAGE"^^ . "eco"^^ . "ECO:0005503"^^ . "Two-dimensional polyacrylamide gel electrophoresis is commonly employed to establish a proteome for an organism and demonstrate expression changes."^^ . "two-dimensional polyacrylamide gel electrophoresis evidence"^^ . _:genid3223 . _:genid3223 . _:genid3223 . _:genid3223 "A type of gel electrophoresis evidence that involves one dimension electrophoresis where biomolecules are electrophoresed on a low percentage polyacrylamide gel to be separated in proportion to their mass or isoelectric point, followed by high voltage electrophoresis on a higher percentage gel in the presence of ethidium bromide to alter non-linear molecular shape."^^ . _:genid3223 "ECO:SW"^^ . _:genid3223 "url:http://www.nature.com/nmeth/journal/v2/n1/full/nmeth0105-83.html"^^ . . . "A type of experimental evidence resulting from the use of a spectrometer."^^ . "snadendla"^^ . "2015-08-14T15:48:08Z"^^ . "eco"^^ . "ECO:0005504"^^ . "spectrometry evidence"^^ . _:genid3224 . _:genid3224 . _:genid3224 . _:genid3224 "A type of experimental evidence resulting from the use of a spectrometer."^^ . _:genid3224 "ECO:RCT"^^ . . . "A type of motif similarity evidence where the motif, a local alignment of sequences, is represented by a regular expression, which captures the variability of nucleotides at each position in a discrete form and can then be used to search genetic sequences by identifying matches to the regular expression."^^ . "CollecTF"^^ . "snadendla"^^ . "2015-10-09T13:51:52Z"^^ . "eco"^^ . "ECO:0005505"^^ . "Regular expression is a computational tool used for determining whether a given genome contains a DNA region resembling a transcription factor binding motif. For example A/T=W indicates A or T may be present in a column of the alignment. (PMID: 20708667)."^^ . "regular expression motif search evidence"^^ . _:genid3225 . _:genid3225 . _:genid3225 . _:genid3225 "A type of motif similarity evidence where the motif, a local alignment of sequences, is represented by a regular expression, which captures the variability of nucleotides at each position in a discrete form and can then be used to search genetic sequences by identifying matches to the regular expression."^^ . _:genid3225 "ECO:SW"^^ . _:genid3225 "PMID:17337630"^^ . . . "A type of point mutation phenotypic evidence resulting from a change in a base (or bases) causing the substitution of one amino acid for another."^^ . "snadendla"^^ . "2015-09-18T16:52:34Z"^^ . "missense mutation evidence"^^ . "eco"^^ . "ECO:0005506"^^ . "missense mutation phenotypic evidence"^^ . _:genid3226 . _:genid3226 . _:genid3226 . _:genid3226 "A type of point mutation phenotypic evidence resulting from a change in a base (or bases) causing the substitution of one amino acid for another."^^ . _:genid3226 "SO:0001583"^^ . . . "A type of point mutation phenotypic evidence resulting in an incomplete and usually nonfunctional protein product because of a premature stop codon."^^ . "snadendla"^^ . "2015-09-18T16:55:32Z"^^ . "nonsense mutation evidence"^^ . "eco"^^ . "ECO:0005507"^^ . "nonsense mutation phenotypic evidence"^^ . _:genid3227 . _:genid3227 . _:genid3227 . _:genid3227 "A type of point mutation phenotypic evidence resulting in an incomplete and usually nonfunctional protein product because of a premature stop codon."^^ . _:genid3227 "url:https://ghr.nlm.nih.gov/primer/mutationsanddisorders/possiblemutations"^^ . . . "A type of point mutation phenotypic evidence resulting from the change of a DNA nucleotide that does not cause any changes in the amino acid sequence."^^ . "snadendla"^^ . "2015-09-18T17:01:12Z"^^ . "eco"^^ . "ECO:0005508"^^ . "silent mutation evidence"^^ . _:genid3228 . _:genid3228 . _:genid3228 . _:genid3228 "A type of point mutation phenotypic evidence resulting from the change of a DNA nucleotide that does not cause any changes in the amino acid sequence."^^ . _:genid3228 "url:http://www.sciencemag.org/news/2006/12/sound-silent-mutation"^^ . . . "A type of mutant phenotype evidence resulting from a mutation in which there is an insertion of one or more contiguous nucleotides."^^ . "snadendla"^^ . "2015-09-18T17:02:03Z"^^ . "insertion mutation evidence"^^ . "eco"^^ . "ECO:0005509"^^ . "insertion mutation phenotypic evidence"^^ . _:genid3229 . _:genid3229 . _:genid3229 . _:genid3229 "A type of mutant phenotype evidence resulting from a mutation in which there is an insertion of one or more contiguous nucleotides."^^ . _:genid3229 "GO:0070705"^^ . . . "A type of experimental phenotypic evidence resulting from a mutation in which inserted nucleotide(s) have a sequence identical to, or derived from, adjacent nucleotides."^^ . "snadendla"^^ . "2015-09-18T17:03:25Z"^^ . "eco"^^ . "ECO:0005511"^^ . "duplication mutation evidence"^^ . _:genid3230 . _:genid3230 . _:genid3230 . _:genid3230 "A type of experimental phenotypic evidence resulting from a mutation in which inserted nucleotide(s) have a sequence identical to, or derived from, adjacent nucleotides."^^ . _:genid3230 "SO:1000035"^^ . . . "A type of mutant phenotype evidence resulting from any mutation that causes an insertion or deletion of nucleotides in a DNA sequence that is not divisible by three and therefore changes the codon reading frame and the translated amino acids."^^ . "snadendla"^^ . "2015-09-18T17:05:49Z"^^ . "frameshift mutation evidence"^^ . "eco"^^ . "ECO:0005512"^^ . "frameshift mutation phenotypic evidence"^^ . _:genid3231 . _:genid3231 . _:genid3231 . _:genid3231 "A type of mutant phenotype evidence resulting from any mutation that causes an insertion or deletion of nucleotides in a DNA sequence that is not divisible by three and therefore changes the codon reading frame and the translated amino acids."^^ . _:genid3231 "url:https://ghr.nlm.nih.gov/primer/mutationsanddisorders/possiblemutations"^^ . . . "A type of mutant phenotype evidence resulting from a mutation that increases the number of times that a DNA sequence is repeated."^^ . "snadendla"^^ . "2015-09-18T17:06:34Z"^^ . "repeat expansion mutation evidence"^^ . "eco"^^ . "ECO:0005513"^^ . "repeat expansion mutation phenotypic evidence"^^ . _:genid3232 . _:genid3232 . _:genid3232 . _:genid3232 "A type of mutant phenotype evidence resulting from a mutation that increases the number of times that a DNA sequence is repeated."^^ . _:genid3232 "PMID:9397685"^^ . _:genid3232 "url:https://ghr.nlm.nih.gov/primer/mutationsanddisorders/possiblemutations"^^ . . . "A type of mutant phenotype evidence resulting from a mutation in which there is a change in nucleotides at a splice site."^^ . "snadendla"^^ . "2015-09-18T17:07:29Z"^^ . "splice site mutation evidence"^^ . "eco"^^ . "ECO:0005514"^^ . "splice site mutation phenotypic evidence"^^ . _:genid3233 . _:genid3233 . _:genid3233 . _:genid3233 "A type of mutant phenotype evidence resulting from a mutation in which there is a change in nucleotides at a splice site."^^ . _:genid3233 "ECO:RCT"^^ . . . "A type of mutant phenotype evidence resulting from a mutation in which a region of a chromosome is transferred to a nonhomologous chromosome."^^ . "snadendla"^^ . "2015-09-18T17:08:01Z"^^ . "translocation mutation evidence"^^ . "eco"^^ . "ECO:0005515"^^ . "translocation mutation phenotypic evidence"^^ . _:genid3234 . _:genid3234 . _:genid3234 . _:genid3234 "A type of mutant phenotype evidence resulting from a mutation in which a region of a chromosome is transferred to a nonhomologous chromosome."^^ . _:genid3234 "ECO:RCT"^^ . . . _:genid3235 . _:genid3235 . _:genid3235 . _:genid3235 . "A type of experimental evidence resulting from the detection and analysis of molecular markers."^^ . "snadendla"^^ . "2015-09-24T15:54:21Z"^^ . "eco"^^ . "ECO:0005516"^^ . "molecule detection assay evidence"^^ . _:genid3236 . _:genid3236 . _:genid3236 . _:genid3236 "A type of experimental evidence resulting from the detection and analysis of molecular markers."^^ . _:genid3236 "ECO:RCT"^^ . . . "A type of molecule detection assay evidence resulting from the detection and quantification of a protein, or multiple proteins."^^ . "snadendla"^^ . "2015-09-25T14:27:40Z"^^ . "eco"^^ . "ECO:0005517"^^ . "protein detection assay evidence"^^ . _:genid3237 . _:genid3237 . _:genid3237 . _:genid3237 "A type of molecule detection assay evidence resulting from the detection and quantification of a protein, or multiple proteins."^^ . _:genid3237 "ECO:RCT"^^ . . . _:genid3238 . _:genid3238 . _:genid3238 . _:genid3238 . _:genid3239 . _:genid3239 . _:genid3240 . _:genid3241 . _:genid3243 _:genid3242 . _:genid3241 _:genid3243 . _:genid3242 . _:genid3242 . _:genid3244 . _:genid3244 . _:genid3244 . _:genid3242 _:genid3244 . _:genid3243 . _:genid3240 _:genid3241 . _:genid3239 _:genid3240 . _:genid3239 . _:genid3245 . _:genid3245 . _:genid3246 . _:genid3247 . _:genid3248 . _:genid3247 _:genid3248 . _:genid3248 . _:genid3246 _:genid3247 . _:genid3245 _:genid3246 . _:genid3245 . "A type of molecule detection assay evidence resulting from the detection of specific RNAs."^^ . "snadendla"^^ . "2015-09-25T14:43:53Z"^^ . "eco"^^ . "ECO:0005518"^^ . "RNA detection assay evidence"^^ . _:genid3249 . _:genid3249 . _:genid3249 . _:genid3249 "A type of molecule detection assay evidence resulting from the detection of specific RNAs."^^ . _:genid3249 "ECO:RCT"^^ . . . _:genid3250 . _:genid3250 . _:genid3251 . _:genid3252 . _:genid3254 _:genid3253 . _:genid3252 _:genid3254 . _:genid3253 . _:genid3253 . _:genid3255 . _:genid3256 . _:genid3258 _:genid3257 . _:genid3256 _:genid3258 . _:genid3257 . _:genid3257 . _:genid3257 . _:genid3258 . _:genid3255 _:genid3256 . _:genid3253 _:genid3255 . _:genid3254 . _:genid3251 _:genid3252 . _:genid3250 _:genid3251 . _:genid3250 . "A type of molecule detection assay evidence resulting from the detection and visualization of a sequence of DNA."^^ . "snadendla"^^ . "2015-09-25T19:33:25Z"^^ . "eco"^^ . "ECO:0005519"^^ . "DNA detection assay evidence"^^ . _:genid3259 . _:genid3259 . _:genid3259 . _:genid3259 "A type of molecule detection assay evidence resulting from the detection and visualization of a sequence of DNA."^^ . _:genid3259 "ECO:RCT"^^ . . . "A type of molecule detection assay evidence based on changes in surface-reflected light due to ligand binding on the surface of a semi-transparent substrate to detect proteins, DNA, and other biological material in a multiplexed, high-throughput microarray format without labels."^^ . "CollecTF"^^ . "snadendla"^^ . "2015-09-28T16:01:01Z"^^ . "IRIS"^^ . "SRIB"^^ . "Spectral Reflectance Imaging Biosensor"^^ . "eco"^^ . "ECO:0005520"^^ . "Differences in the optical path lengths between a surface layer and a buried silica layer can be measured very precisely allowing optical height information to be converted to accumulated mass on the surface. For the purpose of TF-binding site identification, IRIS is coupled with DNA-arrays with immobilized potential binding regions exposed to the protein of interest and eluted. Protein-bound fragments exhibit changes in reflectance that can be used to gauge binding quantitatively."^^ . "interferometric reflectance imaging sensor evidence"^^ . _:genid3260 . _:genid3260 . _:genid3260 . _:genid3260 "A type of molecule detection assay evidence based on changes in surface-reflected light due to ligand binding on the surface of a semi-transparent substrate to detect proteins, DNA, and other biological material in a multiplexed, high-throughput microarray format without labels."^^ . _:genid3260 "ECO:SW"^^ . _:genid3260 "PMID:21587155"^^ . _:genid3260 "PMID:24271115"^^ . . . _:genid3261 . _:genid3261 . _:genid3262 . _:genid3263 . _:genid3265 _:genid3264 . _:genid3263 _:genid3265 . _:genid3264 . _:genid3264 . _:genid3264 . _:genid3265 . _:genid3262 _:genid3263 . _:genid3261 _:genid3262 . _:genid3261 . "A type of nuclease protection assay evidence where RNA is hybridized with complementary DNA probes and exposed to S1 nuclease for unbound RNA degradation after which the intact RNA is run on a gel for probe size determination and RNA identification to detect and map specific RNAs in a complex mixture of total cellular RNA."^^ . "CollecTF"^^ . "snadendla"^^ . "2015-09-28T17:16:56Z"^^ . "eco"^^ . "ECO:0005521"^^ . "S1 nuclease protection assay evidence"^^ . _:genid3266 . _:genid3266 . _:genid3266 . _:genid3266 "A type of nuclease protection assay evidence where RNA is hybridized with complementary DNA probes and exposed to S1 nuclease for unbound RNA degradation after which the intact RNA is run on a gel for probe size determination and RNA identification to detect and map specific RNAs in a complex mixture of total cellular RNA."^^ . _:genid3266 "ECO:SW"^^ . _:genid3266 "PMID:21390683"^^ . . . _:genid3267 . _:genid3267 . _:genid3268 . _:genid3269 . _:genid3271 _:genid3270 . _:genid3269 _:genid3271 . _:genid3270 . _:genid3270 . _:genid3270 . _:genid3271 . _:genid3268 _:genid3269 . _:genid3267 _:genid3268 . _:genid3267 . _:genid3272 . _:genid3272 . _:genid3273 . _:genid3274 . _:genid3276 _:genid3275 . _:genid3274 _:genid3276 . _:genid3275 . _:genid3275 . _:genid3277 . _:genid3277 . _:genid3277 . _:genid3275 _:genid3277 . _:genid3276 . _:genid3273 _:genid3274 . _:genid3272 _:genid3273 . _:genid3272 . _:genid3278 . _:genid3278 . _:genid3279 . _:genid3280 . _:genid3282 _:genid3281 . _:genid3280 _:genid3282 . _:genid3281 . _:genid3281 . _:genid3281 . _:genid3282 . _:genid3279 _:genid3280 . _:genid3278 _:genid3279 . _:genid3278 . "A type of DNA detection assay evidence resulting from evaluation of the relative abundance of target sequences hybridizing to DNA samples that are immobilized on a nitrocellulose or nylon membrane."^^ . "snadendla"^^ . "2015-09-30T10:03:03Z"^^ . "eco"^^ . "ECO:0005522"^^ . "DNA dot blot assay evidence"^^ . _:genid3283 . _:genid3283 . _:genid3283 . _:genid3283 "A type of DNA detection assay evidence resulting from evaluation of the relative abundance of target sequences hybridizing to DNA samples that are immobilized on a nitrocellulose or nylon membrane."^^ . _:genid3283 "PMID:18265189"^^ . . _:genid3284 . _:genid3285 . _:genid3287 _:genid3286 . _:genid3285 _:genid3287 . _:genid3286 . _:genid3286 . _:genid3286 . _:genid3287 . _:genid3284 _:genid3285 . _:genid3284 . . . "EXP"^^ . "A type of DNA dot blot assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2015-09-30T10:04:00Z"^^ . "eco"^^ . "ECO:0005523"^^ . "DNA dot blot assay evidence used in manual assertion"^^ . _:genid3288 . _:genid3288 . _:genid3288 . _:genid3288 . _:genid3288 "true"^^ . _:genid3289 . _:genid3289 . _:genid3289 . _:genid3289 "A type of DNA dot blot assay evidence that is used in a manual assertion."^^ . _:genid3289 "ECO:SN"^^ . _:genid3289 "ECO:SW"^^ . . . "A type of protein detection assay evidence where soft ionization is used for the analysis of biomolecules for mass determination in a three step process of plate preparation, radiation, and ionization with high throughput technology."^^ . "CollecTF"^^ . "snadendla"^^ . "2015-09-30T10:51:56Z"^^ . "MALDI-TOF Mass Spectrometry"^^ . "MALDI-TOF-MS"^^ . "eco"^^ . "ECO:0005526"^^ . "MALDI-TOF MS is commonly used for protein identification in constructing a proteome where protein fingerprints obtained by microbial cells are compared with a database of reference spectra by means of various algorithms integrated in systems recently made commercially available."^^ . "matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evidence"^^ . _:genid3290 . _:genid3290 . _:genid3290 . _:genid3290 "A type of protein detection assay evidence where soft ionization is used for the analysis of biomolecules for mass determination in a three step process of plate preparation, radiation, and ionization with high throughput technology."^^ . _:genid3290 "ECO:SW"^^ . _:genid3290 "PMID:21964792"^^ . _:genid3290 "PMID:25354905"^^ . . _:genid3291 . _:genid3292 . _:genid3294 _:genid3293 . _:genid3292 _:genid3294 . _:genid3293 . _:genid3293 . _:genid3293 . _:genid3294 . _:genid3291 _:genid3292 . _:genid3291 . . . "EXP"^^ . "A type of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2015-09-30T10:58:51Z"^^ . "MALDI-TOF mass spectrometry evidence"^^ . "MALDI-TOF-MS evidence"^^ . "eco"^^ . "ECO:0005527"^^ . "matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evidence used in manual assertion"^^ . _:genid3295 . _:genid3295 . _:genid3295 . _:genid3295 . _:genid3295 "true"^^ . _:genid3296 . _:genid3296 . _:genid3296 . _:genid3296 "A type of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evidence that is used in a manual assertion."^^ . _:genid3296 "ECO:SN"^^ . _:genid3296 "ECO:SW"^^ . . . _:genid3297 . _:genid3297 . _:genid3298 . _:genid3299 . _:genid3301 _:genid3300 . _:genid3299 _:genid3301 . _:genid3300 . _:genid3300 . _:genid3300 . _:genid3301 . _:genid3298 _:genid3299 . _:genid3297 _:genid3298 . _:genid3297 . _:genid3302 . _:genid3302 . _:genid3303 . _:genid3304 . _:genid3306 _:genid3305 . _:genid3304 _:genid3306 . _:genid3305 . _:genid3305 . _:genid3307 . _:genid3307 . _:genid3307 . _:genid3305 _:genid3307 . _:genid3306 . _:genid3303 _:genid3304 . _:genid3302 _:genid3303 . _:genid3302 . "If the AGAA sequence is mutated CTCC (Pxyn2aM, see Table 1), no DNA-protein complex is formed under either repressing or inducing conditions (Figure 1). This result indicates that this part of the xyn2 promoter is essential for binding a transcription factor under repressing conditions."^^ . "To identify key residues required for specific GlnR binding we mutated the highly conserved AC-n9-AC and AT-n9-AC DNA binding motifs. Figure 4 shows that the highly conserved adenosine residues in the motif are critical as GlnR binding is abolished when these residues are mutated."^^ . "We also tested a hyaS promoter in which one (highest score) of the three putative AdpA-binding sites was mutated (at position -134 to -129, see Additional file 3: Figure S1a): the affinity of AdpA for this promoter region was reduced and one protein-DNA complex disappeared (Additional file 3: Figure S1b). These results suggest that one dimer of AdpA binds the adjacent sites -129 and -123 of S. lividans hyaS promoter and another dimer binds the -100 site resulting in the formation of the two DNA-AdpA complexes depicted in Figure 2."^^ . "A type of mutant phenotype phenotype evidence based on target-specified mutagenesis for the characterization of various gene and protein interactions, structures, and functions where oligonucleotide primers are used to alter a nucleotide sequence."^^ . "CollecTF"^^ . "snadendla"^^ . "2015-09-30T11:34:41Z"^^ . "site directed mutagenesis"^^ . "site-directed mutagenesis evidence"^^ . "eco"^^ . "ECO:0005528"^^ . "Site-directed mutagenesis is often performed in tandem with EMSA. It is often implemented only in conserved motif positions or serially through all positions of a site."^^ . "site-directed mutagenesis phenotypic evidence"^^ . _:genid3308 . _:genid3308 . _:genid3308 . _:genid3308 "If the AGAA sequence is mutated CTCC (Pxyn2aM, see Table 1), no DNA-protein complex is formed under either repressing or inducing conditions (Figure 1). This result indicates that this part of the xyn2 promoter is essential for binding a transcription factor under repressing conditions."^^ . _:genid3308 "PMID:21087492"^^ . _:genid3309 . _:genid3309 . _:genid3309 . _:genid3309 "To identify key residues required for specific GlnR binding we mutated the highly conserved AC-n9-AC and AT-n9-AC DNA binding motifs. Figure 4 shows that the highly conserved adenosine residues in the motif are critical as GlnR binding is abolished when these residues are mutated."^^ . _:genid3309 "PMID:23642041"^^ . _:genid3310 . _:genid3310 . _:genid3310 . _:genid3310 "We also tested a hyaS promoter in which one (highest score) of the three putative AdpA-binding sites was mutated (at position -134 to -129, see Additional file 3: Figure S1a): the affinity of AdpA for this promoter region was reduced and one protein-DNA complex disappeared (Additional file 3: Figure S1b). These results suggest that one dimer of AdpA binds the adjacent sites -129 and -123 of S. lividans hyaS promoter and another dimer binds the -100 site resulting in the formation of the two DNA-AdpA complexes depicted in Figure 2."^^ . _:genid3310 "PMID:24694298"^^ . _:genid3311 . _:genid3311 . _:genid3311 . _:genid3311 "A type of mutant phenotype phenotype evidence based on target-specified mutagenesis for the characterization of various gene and protein interactions, structures, and functions where oligonucleotide primers are used to alter a nucleotide sequence."^^ . _:genid3311 "ECO:SW"^^ . _:genid3311 "PMID:21204030"^^ . _:genid3311 "PMID:24011050"^^ . _:genid3311 "PMID:3541892"^^ . . . _:genid3312 . _:genid3312 . _:genid3313 . _:genid3314 . _:genid3316 _:genid3315 . _:genid3314 _:genid3316 . _:genid3315 . _:genid3315 . _:genid3315 . _:genid3316 . _:genid3313 _:genid3314 . _:genid3312 _:genid3313 . _:genid3312 . _:genid3317 . _:genid3317 . _:genid3318 . _:genid3319 . _:genid3321 _:genid3320 . _:genid3319 _:genid3321 . _:genid3320 . _:genid3320 . _:genid3322 . _:genid3322 . _:genid3322 . _:genid3320 _:genid3322 . _:genid3321 . _:genid3318 _:genid3319 . _:genid3317 _:genid3318 . _:genid3317 . "A type of mutant phenotype evidence where a mutagenic product or process is used to alter the nucleotide sequence and thus induce genetic mutation. Examples include, but are not limited to mutagenic compounds, irradiation, PCR w/ degenerate primers, etc."^^ . "CollecTF"^^ . "snadendla"^^ . "2015-09-30T11:55:03Z"^^ . "random mutagenesis evidence"^^ . "eco"^^ . "ECO:0005529"^^ . "Random mutagenesis is not often used in TF-binding site determination; however, it is sometimes used to investigate the effect of mutations in TF binding domains in conjunction with expression assays. Random mutations can also be introduced via chemicals, error-prone PCR (EP-PCR), degenerate oligonucleotides-Pfu(DOP), UV irradiation, mutator strains, nucleotide analogs, or DNA recombination."^^ . "random mutagenesis phenotypic evidence"^^ . _:genid3323 . _:genid3323 . _:genid3323 . _:genid3323 "A type of mutant phenotype evidence where a mutagenic product or process is used to alter the nucleotide sequence and thus induce genetic mutation. Examples include, but are not limited to mutagenic compounds, irradiation, PCR w/ degenerate primers, etc."^^ . _:genid3323 "ECO:SW"^^ . _:genid3323 "PMID:15153637"^^ . _:genid3323 "PMID:18265275"^^ . . _:genid3324 . _:genid3325 . _:genid3327 _:genid3326 . _:genid3325 _:genid3327 . _:genid3326 . _:genid3326 . _:genid3326 . _:genid3327 . _:genid3324 _:genid3325 . _:genid3324 . . . "IMP"^^ . "A type of random mutagenesis phenotypic evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2015-09-30T11:57:00Z"^^ . "eco"^^ . "ECO:0005530"^^ . "random mutagenesis evidence used in manual assertion"^^ . _:genid3328 . _:genid3328 . _:genid3328 . _:genid3328 . _:genid3328 "true"^^ . . . "A sequence alignment of the phlA gene promoter region from strain 2P24 with other well-studied 2,4-DAPG producing Pseudomonas strains revealed a very well conserved palindromic sequence GAAACN5GTTTC (Fig. S1)." . "In order to identify a potential regulatory motif for KstR2, we used the promoter regions of the kstR2 orthologues as a training set for the motif identification program MEME (Bailey & Elkan, 1994). This identified a potential regulatory sequence that contains a 14 bp inverted palindromic motif AnCAAGnnCTTGnT (Fig. 2)."^^ . "We mapped sites upstream of crp itself, SCO4561 and SCO2977, and identified a consensus binding sequence [GTG(N)6GNCAC]; derivatives of this motif could be found in all of the secondary metabolism-associated target sequences, although notably, one-half of the palindrome seemed to be better conserved than the other [GTG(N)6GNGAN] (Fig. 2C; Table 1)."^^ . "A type of multiple sequence alignment evidence based on a set of algorithms that infer over-represented motifs from a set of biological sequences returning one or more local multiple sequence alignment defining the inferred motifs."^^ . "CollecTF"^^ . "snadendla"^^ . "2015-09-30T15:04:45Z"^^ . "eco"^^ . "ECO:0005531"^^ . "Relationship type between sequences (e.g. orthologs from multiple genomes or co-expressed genes in the same genome) is not necessarily assumed. The local multiple sequence alignment is typically ungapped. A common application of motif discovery is to infer the binding motif of a given transcription factor (TF). This can be based on the results of a whole-genome expression analysis, assuming that co-expressed genes are co-regulated by the same TF, from peaks in ChIP-seq experiments with the TF, or from the comparative genomics analysis of the promoter regions of orthologs."^^ . "motif discovery evidence"^^ . _:genid3329 . _:genid3329 . _:genid3329 . _:genid3329 "A sequence alignment of the phlA gene promoter region from strain 2P24 with other well-studied 2,4-DAPG producing Pseudomonas strains revealed a very well conserved palindromic sequence GAAACN5GTTTC (Fig. S1)." . _:genid3329 "PMID:23209661" . _:genid3330 . _:genid3330 . _:genid3330 . _:genid3330 "In order to identify a potential regulatory motif for KstR2, we used the promoter regions of the kstR2 orthologues as a training set for the motif identification program MEME (Bailey & Elkan, 1994). This identified a potential regulatory sequence that contains a 14 bp inverted palindromic motif AnCAAGnnCTTGnT (Fig. 2)."^^ . _:genid3330 "PMID:20167624"^^ . _:genid3331 . _:genid3331 . _:genid3331 . _:genid3331 "We mapped sites upstream of crp itself, SCO4561 and SCO2977, and identified a consensus binding sequence [GTG(N)6GNCAC]; derivatives of this motif could be found in all of the secondary metabolism-associated target sequences, although notably, one-half of the palindrome seemed to be better conserved than the other [GTG(N)6GNGAN] (Fig. 2C; Table 1)."^^ . _:genid3331 "PMID:23232715"^^ . _:genid3332 . _:genid3332 . _:genid3332 . _:genid3332 "A type of multiple sequence alignment evidence based on a set of algorithms that infer over-represented motifs from a set of biological sequences returning one or more local multiple sequence alignment defining the inferred motifs."^^ . _:genid3332 "ECO:SW"^^ . _:genid3332 "PMID:10812473"^^ . _:genid3332 "PMID:16845028"^^ . _:genid3332 "PMID:8211139"^^ . _:genid3333 . _:genid3333 . _:genid3333 . _:genid3333 "Relationship type between sequences (e.g. orthologs from multiple genomes or co-expressed genes in the same genome) is not necessarily assumed. The local multiple sequence alignment is typically ungapped. A common application of motif discovery is to infer the binding motif of a given transcription factor (TF). This can be based on the results of a whole-genome expression analysis, assuming that co-expressed genes are co-regulated by the same TF, from peaks in ChIP-seq experiments with the TF, or from the comparative genomics analysis of the promoter regions of orthologs."^^ . _:genid3333 "PMID:19892760"^^ . _:genid3333 "PMID:23032607"^^ . . . "A type of motif similarity evidence where the motif is represented by a consensus sequence which incorporates the most frequent nucleotide at each position acting as a generic representative for the sequences in the alignment, and is compared to the genetic sequence for a perfect or imperfect match."^^ . "CollecTF"^^ . "snadendla"^^ . "2015-10-09T14:12:54Z"^^ . "eco"^^ . "ECO:0005532"^^ . "This technique is used to identify transcription factor binding sites by searching a bacterial genome for DNA regions resembling a given TF-binding motif. PMID: 17085555."^^ . "consensus search evidence"^^ . _:genid3334 . _:genid3334 . _:genid3334 . _:genid3334 "A type of motif similarity evidence where the motif is represented by a consensus sequence which incorporates the most frequent nucleotide at each position acting as a generic representative for the sequences in the alignment, and is compared to the genetic sequence for a perfect or imperfect match."^^ . _:genid3334 "ECO:SW"^^ . _:genid3334 "PMID:15130839"^^ . . . "A type of motif discovery evidence based on a set of algorithms that infer motifs in non-coding DNA sequences from the conservation of functional regulatory sites through evolution at a higher rate than their local surroundings for the identification of an evolutionary 'footprint'."^^ . "CollecTF"^^ . "snadendla"^^ . "2015-09-30T16:23:02Z"^^ . "eco"^^ . "ECO:0005533"^^ . "The name derives to experimental footprinting techniques where transcription factor (TF)-binding sites are identified by sequencing the region of DNA protected from biochemical agents by the bound TF. This technique is used to identify or verify transcription factor-binding motifs, most commonly in the Eukaryota (PMID: 11997340)."^^ . "phylogenetic footprinting evidence"^^ . _:genid3335 . _:genid3335 . _:genid3335 . _:genid3335 "A type of motif discovery evidence based on a set of algorithms that infer motifs in non-coding DNA sequences from the conservation of functional regulatory sites through evolution at a higher rate than their local surroundings for the identification of an evolutionary 'footprint'."^^ . _:genid3335 "ECO:SW"^^ . _:genid3335 "PMID:16477324"^^ . _:genid3335 "PMID:3199442"^^ . . . "A type of motif similarity evidence based on comparative genomics which uses a search method to scan a set of genomes for instances of a specific motif, and then applies a comparative criterion to analyze the collective strength of these predictions, based on the assumption that functional instances of the motif will be preserved by natural selection and their prediction will therefore be consistent across genomes."^^ . "CollecTF"^^ . "snadendla"^^ . "2015-10-09T14:30:38Z"^^ . "eco"^^ . "ECO:0005534"^^ . "This technique is used to predict transcription factor binding sites in gene promoter regions by identifying conserved DNA regions across multiple genomes. PMID: 22305460. Orthology is a typical comparative criterion used."^^ . "comparative genomics motif search evidence"^^ . _:genid3336 . _:genid3336 . _:genid3336 . _:genid3336 "A type of motif similarity evidence based on comparative genomics which uses a search method to scan a set of genomes for instances of a specific motif, and then applies a comparative criterion to analyze the collective strength of these predictions, based on the assumption that functional instances of the motif will be preserved by natural selection and their prediction will therefore be consistent across genomes."^^ . _:genid3336 "ECO:SW"^^ . _:genid3336 "PMID:10854408"^^ . . . "A type of match to sequence model evidence which captures the application of a broad suite of supervised and unsupervised machine learning algorithms trained on known motif instances and applied to the prediction of novel putative instances of a motif in a set of biological sequences."^^ . "CollecTF"^^ . "snadendla"^^ . "2015-10-01T11:58:36Z"^^ . "eco"^^ . "ECO:0005535"^^ . "Machine learning algorithms include, but are not limited to artificial neural networks, random-forest, k-means clustering, hidden Markov models. This suite of methods can be used to identify or verify transcription factor-binding sites in genomic sequences (PMID: 15703297)."^^ . "machine learning prediction of motif instance evidence"^^ . _:genid3337 . _:genid3337 . _:genid3337 . _:genid3337 "A type of match to sequence model evidence which captures the application of a broad suite of supervised and unsupervised machine learning algorithms trained on known motif instances and applied to the prediction of novel putative instances of a motif in a set of biological sequences."^^ . _:genid3337 "ECO:SW"^^ . _:genid3337 "PMID:17117497"^^ . _:genid3337 "PMID:2014171"^^ . . . "A type of motif similarity evidence where the motif is represented by a position-specific frequency matrix (PSFM) that specifies the frequency of each base at each position of the motif, from which a position-specific scoring matrix (PSSM) can be derived under the framework of a log-likelihood ratio providing a scoring system based on the likelihood of a sequence given the motif, versus a genomic-frequency based null hypothesis."^^ . "CollecTF"^^ . "snadendla"^^ . "2015-10-09T15:04:35Z"^^ . "PSSM motif search"^^ . "PSSM"^^ . "eco"^^ . "ECO:0005536"^^ . "This technique is used to predict transcription factor binding sites in gene promoter regions by using a position weight matrix approach. (PMID: 15604457)."^^ . "position-specific scoring matrix motif search evidence"^^ . _:genid3338 . _:genid3338 . _:genid3338 . _:genid3338 "A type of motif similarity evidence where the motif is represented by a position-specific frequency matrix (PSFM) that specifies the frequency of each base at each position of the motif, from which a position-specific scoring matrix (PSSM) can be derived under the framework of a log-likelihood ratio providing a scoring system based on the likelihood of a sequence given the motif, versus a genomic-frequency based null hypothesis."^^ . _:genid3338 "ECO:SW"^^ . _:genid3338 "PMID:10812473"^^ . . . "A type of reporter gene assay evidence based on the fusion of the xylE gene to a specific promoter for the expression of catechol 2,3-dioxygenase that converts the colorless catechol substrate to yellow 2-hydroxymuconic semialdehyde for identification of the expression of a particular gene."^^ . "CollecTF"^^ . "snadendla"^^ . "2015-10-28T15:31:28Z"^^ . "eco"^^ . "ECO:0005537"^^ . "xylE reporter gene assay evidence"^^ . _:genid3339 . _:genid3339 . _:genid3339 . _:genid3339 "A type of reporter gene assay evidence based on the fusion of the xylE gene to a specific promoter for the expression of catechol 2,3-dioxygenase that converts the colorless catechol substrate to yellow 2-hydroxymuconic semialdehyde for identification of the expression of a particular gene."^^ . _:genid3339 "ECO:SW"^^ . _:genid3339 "PMID:2592344"^^ . . "snadendla"^^ . "2015-11-17T15:15:50Z"^^ . "eco"^^ . "ECO:0005538"^^ . "computationally derived logical inference"^^ . "true"^^ . . "snadendla"^^ . "2015-11-17T15:17:47Z"^^ . "eco"^^ . "ECO:0005539"^^ . "computationally derived logical inference used in automatic assertion"^^ . "true"^^ . . "snadendla"^^ . "2015-11-17T15:24:42Z"^^ . "eco"^^ . "ECO:0005540"^^ . "computationally derived logical inference from automatic assertion used in automatic assertion"^^ . "true"^^ . . "snadendla"^^ . "2015-11-17T15:32:03Z"^^ . "eco"^^ . "ECO:0005541"^^ . "computationally derived logical inference from manual assertion used in automatic assertion"^^ . "true"^^ . . _:genid3340 . _:genid3341 . _:genid3343 _:genid3342 . _:genid3341 _:genid3343 . _:genid3342 . _:genid3342 . _:genid3342 . _:genid3343 . _:genid3340 _:genid3341 . _:genid3340 . . . "A type of biological system reconstruction evidence by experimental evidence from single species that is used in a manual assertion."^^ . "snadendla"^^ . "2015-12-16T15:32:41Z"^^ . "eco"^^ . "ECO:0005542"^^ . "Processes, pathways and complexes shown by a single experiment should not be annotated with this term but with ECO:0000353 or a child thereof."^^ . "biological system reconstruction evidence by experimental evidence from single species used in manual assertion"^^ . _:genid3344 . _:genid3344 . _:genid3344 . _:genid3344 . _:genid3344 "true"^^ . _:genid3345 . _:genid3345 . _:genid3345 . _:genid3345 "A type of biological system reconstruction evidence by experimental evidence from single species that is used in a manual assertion."^^ . _:genid3345 "ECO:SN"^^ . _:genid3345 "PMID:19450514"^^ . . _:genid3346 . _:genid3347 . _:genid3349 _:genid3348 . _:genid3347 _:genid3349 . _:genid3348 . _:genid3348 . _:genid3348 . _:genid3349 . _:genid3346 _:genid3347 . _:genid3346 . . . "A type of biological system reconstruction evidence by experimental evidence from mixed species that is used in a manual assertion."^^ . "snadendla"^^ . "2015-12-16T15:45:01Z"^^ . "eco"^^ . "ECO:0005543"^^ . "Inference is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. The evidence may originate from a combination of several experiments."^^ . "biological system reconstruction evidence by experimental evidence from mixed species used in manual assertion"^^ . _:genid3350 . _:genid3350 . _:genid3350 . _:genid3350 . _:genid3350 "true"^^ . _:genid3351 . _:genid3351 . _:genid3351 . _:genid3351 "A type of biological system reconstruction evidence by experimental evidence from mixed species that is used in a manual assertion."^^ . _:genid3351 "ECO:SN"^^ . _:genid3351 "PMID:22232657"^^ . . _:genid3352 . _:genid3353 . _:genid3355 _:genid3354 . _:genid3353 _:genid3355 . _:genid3354 . _:genid3354 . _:genid3354 . _:genid3355 . _:genid3352 _:genid3353 . _:genid3352 . . . "A type of biological system reconstruction evidence based on orthology evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2015-12-18T16:20:49Z"^^ . "eco"^^ . "ECO:0005544"^^ . "Inference is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. Evidence may originate from a combination of several experiments."^^ . "biological system reconstruction evidence based on orthology evidence used in manual assertion"^^ . _:genid3356 . _:genid3356 . _:genid3356 . _:genid3356 "A type of biological system reconstruction evidence based on orthology evidence that is used in a manual assertion."^^ . _:genid3356 "ECO:SN"^^ . . . "A type of biological system reconstruction evidence based on homology evidence where the evidence is inferred by orthology from an existing experimentally supported model to a process, pathway or complex in another species."^^ . "snadendla"^^ . "2015-12-16T15:57:37Z"^^ . "eco"^^ . "ECO:0005545"^^ . "Inference is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. Evidence may originate from a combination of several experiments."^^ . "biological system reconstruction evidence based on orthology evidence"^^ . _:genid3357 . _:genid3357 . _:genid3357 . _:genid3357 "A type of biological system reconstruction evidence based on homology evidence where the evidence is inferred by orthology from an existing experimentally supported model to a process, pathway or complex in another species."^^ . _:genid3357 "ECO:SN"^^ . _:genid3357 "PMID:15660128"^^ . . _:genid3358 . _:genid3359 . _:genid3361 _:genid3360 . _:genid3359 _:genid3361 . _:genid3360 . _:genid3360 . _:genid3360 . _:genid3361 . _:genid3358 _:genid3359 . _:genid3358 . . . "A type of biological system reconstruction evidence based on paralogy evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2015-12-16T16:05:15Z"^^ . "eco"^^ . "ECO:0005546"^^ . "Inference is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. Evidence may originate from a combination of several experiments."^^ . "biological system reconstruction evidence based on paralogy evidence used in manual assertion"^^ . _:genid3362 . _:genid3362 . _:genid3362 . _:genid3362 "A type of biological system reconstruction evidence based on paralogy evidence that is used in a manual assertion."^^ . _:genid3362 "ECO:SN"^^ . _:genid3362 "PMID:15660128"^^ . . _:genid3363 . _:genid3364 . _:genid3366 _:genid3365 . _:genid3364 _:genid3366 . _:genid3365 . _:genid3365 . _:genid3365 . _:genid3366 . _:genid3363 _:genid3364 . _:genid3363 . . . "A type of biological system reconstruction evidence based on inference from background scientific knowledge that is used in a manual assertion."^^ . "snadendla"^^ . "2015-12-16T16:07:42Z"^^ . "eco"^^ . "ECO:0005547"^^ . "Functional studies or ligand binding evidence are often used for the reconstruction of biological systems. It does not provide physical interaction evidence but uses proxies such a ligand binding evidences to infer the presence or absence of the complex components."^^ . "biological system reconstruction evidence based on inference from background scientific knowledge used in manual assertion"^^ . _:genid3367 . _:genid3367 . _:genid3367 . _:genid3367 . _:genid3367 "true"^^ . _:genid3368 . _:genid3368 . _:genid3368 . _:genid3368 "A type of biological system reconstruction evidence based on inference from background scientific knowledge that is used in a manual assertion."^^ . _:genid3368 "ECO:SN"^^ . _:genid3368 "PMID:17876790"^^ . . . "A type of biological system reconstruction based solely on background scientific knowledge of that biological system."^^ . "snadendla"^^ . "2015-12-18T15:32:15Z"^^ . "eco"^^ . "ECO:0005548"^^ . "The available knowledge is usually a combination of partial or weak experimental evidence where either some components are missing or no physical interaction evidence can be found but the system is inferred by similarity to related systems in taxonomically-disparate organisms with experimental evidence. Functional studies or ligand binding evidence are often used for the reconstruction of biological systems. It does not provide physical interaction evidence but uses proxies such a ligand binding evidences to infer the presence or absence of the complex components."^^ . "biological system reconstruction evidence based on inference from background scientific knowledge"^^ . _:genid3369 . _:genid3369 . _:genid3369 . _:genid3369 "A type of biological system reconstruction based solely on background scientific knowledge of that biological system."^^ . _:genid3369 "ECO:SN"^^ . _:genid3369 "PMID:17876790"^^ . . . "A type of biological system reconstruction where the evidence is inferred by homology based on conservation of sequence, function, and composition from an existing experimentally supported model to a process, pathway, or complex."^^ . "snadendla"^^ . "2015-12-18T15:49:46Z"^^ . "eco"^^ . "ECO:0005549"^^ . "Inference may be based on paralogy and/or orthology of the genome-encoded components and is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. Evidence may originate from a combination of several experiments in the same or another species."^^ . "biological system reconstruction evidence based on homology evidence"^^ . _:genid3370 . _:genid3370 . _:genid3370 . _:genid3370 "A type of biological system reconstruction where the evidence is inferred by homology based on conservation of sequence, function, and composition from an existing experimentally supported model to a process, pathway, or complex."^^ . _:genid3370 "ECO:SN"^^ . _:genid3370 "PMID:15660128"^^ . . . "A type of biological system reconstruction evidence based on homology evidence where the evidence is inferred by paralogy from an existing experimentally supported model to a process, pathway, or complex in the same species."^^ . "snadendla"^^ . "2015-12-18T16:24:08Z"^^ . "eco"^^ . "ECO:0005550"^^ . "Inference is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. Evidence may originate from a combination of several experiments."^^ . "biological system reconstruction evidence based on paralogy evidence"^^ . _:genid3371 . _:genid3371 . _:genid3371 . _:genid3371 "A type of biological system reconstruction evidence based on homology evidence where the evidence is inferred by paralogy from an existing experimentally supported model to a process, pathway, or complex in the same species."^^ . _:genid3371 "ECO:SN"^^ . _:genid3371 "PMID:15660128"^^ . . . "A type of biological system reconstruction evidence that uses experimental evidence as support."^^ . "snadendla"^^ . "2015-12-18T16:34:13Z"^^ . "eco"^^ . "ECO:0005551"^^ . "biological system reconstruction evidence by experimental evidence"^^ . _:genid3372 . _:genid3372 . _:genid3372 . _:genid3372 "A type of biological system reconstruction evidence that uses experimental evidence as support."^^ . _:genid3372 "ECO:SN"^^ . _:genid3372 "PMID:19450514"^^ . _:genid3372 "PMID:22232657"^^ . . . "A type of biological system reconstruction evidence where the experimental evidence is derived by using a mix of species used in the same experiment."^^ . "snadendla"^^ . "2015-12-18T16:35:13Z"^^ . "eco"^^ . "ECO:0005552"^^ . "Inference is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. The evidence may originate from a combination of several experiments."^^ . "biological system reconstruction evidence by experimental evidence from mixed species"^^ . _:genid3373 . _:genid3373 . _:genid3373 . _:genid3373 "A type of biological system reconstruction evidence where the experimental evidence is derived by using a mix of species used in the same experiment."^^ . _:genid3373 "ECO:SN"^^ . _:genid3373 "PMID:22232657"^^ . . . "A type of biological system reconstruction where the experimental evidence is derived by using multiple experiments in a single species."^^ . "snadendla"^^ . "2015-12-18T16:36:44Z"^^ . "eco"^^ . "ECO:0005553"^^ . "Processes, pathways and complexes shown by a single experiment should not be annotated with this term but with ECO:0000353 or a child thereof."^^ . "biological system reconstruction evidence by experimental evidence from single species"^^ . _:genid3374 . _:genid3374 . _:genid3374 . _:genid3374 "A type of biological system reconstruction where the experimental evidence is derived by using multiple experiments in a single species."^^ . _:genid3374 "ECO:SN"^^ . . . "A type of sequence alignment evidence where two sequences are aligned to identify regions of similarity that may indicate functional, structural and/or evolutionary relationships between two biological sequences (protein or nucleic acid)."^^ . "snadendla"^^ . "2016-02-08T14:30:46Z"^^ . "eco"^^ . "ECO:0005554"^^ . "pairwise sequence alignment evidence"^^ . _:genid3375 . _:genid3375 . _:genid3375 . _:genid3375 "A type of sequence alignment evidence where two sequences are aligned to identify regions of similarity that may indicate functional, structural and/or evolutionary relationships between two biological sequences (protein or nucleic acid)."^^ . _:genid3375 "ECO:SN"^^ . _:genid3375 "url:http://www.ebi.ac.uk/Tools/psa/"^^ . . . "A type of sequence alignment evidence where three or more biological sequences (protein or nucleic acid) of similar length are aligned to infer homology and the evolutionary relationships between the sequences studied."^^ . "CollecTF"^^ . "snadendla"^^ . "2016-02-08T14:31:24Z"^^ . "eco"^^ . "ECO:0005555"^^ . "multiple sequence alignment evidence"^^ . _:genid3376 . _:genid3376 . _:genid3376 . _:genid3376 "A type of sequence alignment evidence where three or more biological sequences (protein or nucleic acid) of similar length are aligned to infer homology and the evolutionary relationships between the sequences studied."^^ . _:genid3376 "ECO:SN"^^ . _:genid3376 "url:http://www.ebi.ac.uk/Tools/msa/"^^ . . _:genid3377 . _:genid3378 . _:genid3380 _:genid3379 . _:genid3378 _:genid3380 . _:genid3379 . _:genid3379 . _:genid3379 . _:genid3380 . _:genid3377 _:genid3378 . _:genid3377 . . . "ISA"^^ . "A type of multiple sequence alignment evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-02-08T14:59:18Z"^^ . "eco"^^ . "ECO:0005556"^^ . "multiple sequence alignment evidence used in manual assertion"^^ . _:genid3381 . _:genid3381 . _:genid3381 . _:genid3381 . _:genid3381 "true"^^ . _:genid3382 . _:genid3382 . _:genid3382 . _:genid3382 "A type of multiple sequence alignment evidence that is used in a manual assertion."^^ . _:genid3382 "ECO:SN"^^ . . _:genid3383 . _:genid3384 . _:genid3386 _:genid3385 . _:genid3384 _:genid3386 . _:genid3385 . _:genid3385 . _:genid3385 . _:genid3386 . _:genid3383 _:genid3384 . _:genid3383 . . . "IEA"^^ . "A type of multiple sequence alignment evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-02-08T15:00:50Z"^^ . "eco"^^ . "ECO:0005557"^^ . "multiple sequence alignment evidence used in automatic assertion"^^ . _:genid3387 . _:genid3387 . _:genid3387 . _:genid3387 . _:genid3387 "true"^^ . _:genid3388 . _:genid3388 . _:genid3388 . _:genid3388 "A type of multiple sequence alignment evidence that is used in an automatic assertion."^^ . _:genid3388 "ECO:SN"^^ . . _:genid3389 . _:genid3390 . _:genid3392 _:genid3391 . _:genid3390 _:genid3392 . _:genid3391 . _:genid3391 . _:genid3391 . _:genid3392 . _:genid3389 _:genid3390 . _:genid3389 . . . "ISA"^^ . "A type of motif discovery evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-02-08T15:07:47Z"^^ . "eco"^^ . "ECO:0005558"^^ . "motif discovery evidence used in manual assertion"^^ . _:genid3393 . _:genid3393 . _:genid3393 . _:genid3393 . _:genid3393 "true"^^ . _:genid3394 . _:genid3394 . _:genid3394 . _:genid3394 "A type of motif discovery evidence that is used in a manual assertion."^^ . _:genid3394 "ECO:SN"^^ . . _:genid3395 . _:genid3396 . _:genid3398 _:genid3397 . _:genid3396 _:genid3398 . _:genid3397 . _:genid3397 . _:genid3397 . _:genid3398 . _:genid3395 _:genid3396 . _:genid3395 . . . "IEA"^^ . "A type of motif discovery evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-02-08T15:08:19Z"^^ . "eco"^^ . "ECO:0005559"^^ . "motif discovery evidence used in automatic assertion"^^ . _:genid3399 . _:genid3399 . _:genid3399 . _:genid3399 . _:genid3399 "true"^^ . _:genid3400 . _:genid3400 . _:genid3400 . _:genid3400 "A type of motif discovery evidence that is used in an automatic assertion."^^ . _:genid3400 "ECO:SN"^^ . . _:genid3401 . _:genid3402 . _:genid3404 _:genid3403 . _:genid3402 _:genid3404 . _:genid3403 . _:genid3403 . _:genid3403 . _:genid3404 . _:genid3401 _:genid3402 . _:genid3401 . . . "ISA"^^ . "A type of pairwise sequence alignment evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-02-08T15:17:05Z"^^ . "eco"^^ . "ECO:0005560"^^ . "pairwise sequence alignment evidence used in manual assertion"^^ . _:genid3405 . _:genid3405 . _:genid3405 . _:genid3405 . _:genid3405 "true"^^ . _:genid3406 . _:genid3406 . _:genid3406 . _:genid3406 "A type of pairwise sequence alignment evidence that is used in a manual assertion."^^ . _:genid3406 "ECO:SN"^^ . . _:genid3407 . _:genid3408 . _:genid3410 _:genid3409 . _:genid3408 _:genid3410 . _:genid3409 . _:genid3409 . _:genid3409 . _:genid3410 . _:genid3407 _:genid3408 . _:genid3407 . . . "IEA"^^ . "A type of pairwise sequence alignment evidence that is used in an automatic evidence."^^ . "snadendla"^^ . "2016-02-08T15:17:52Z"^^ . "eco"^^ . "ECO:0005561"^^ . "pairwise sequence alignment evidence used in automatic assertion"^^ . _:genid3411 . _:genid3411 . _:genid3411 . _:genid3411 . _:genid3411 "true"^^ . _:genid3412 . _:genid3412 . _:genid3412 . _:genid3412 "A type of pairwise sequence alignment evidence that is used in an automatic evidence."^^ . _:genid3412 "ECO:SN"^^ . . . "A type of protein kinase assay evidence resulting from the evaluation of the phosphorylation activity of kinase on a gel-incorporated kinase substrate."^^ . "snadendla"^^ . "2016-02-09T12:05:29Z"^^ . "eco"^^ . "ECO:0005562"^^ . "in-gel protein kinase assay evidence"^^ . _:genid3413 . _:genid3413 . _:genid3413 . _:genid3413 "A type of protein kinase assay evidence resulting from the evaluation of the phosphorylation activity of kinase on a gel-incorporated kinase substrate."^^ . _:genid3413 "PMID:12372853"^^ . . . _:genid3414 . _:genid3414 . _:genid3414 . _:genid3414 . _:genid3415 . _:genid3415 . _:genid3415 . _:genid3415 . "A type of voltage clamp recording evidence that involves recording trace of the current (pA) going through the analyzed ion channels determined from voltage clamp current recording."^^ . "snadendla"^^ . "2016-02-09T12:40:03Z"^^ . "eco"^^ . "ECO:0005563"^^ . "macroscopic current trace evidence"^^ . _:genid3416 . _:genid3416 . _:genid3416 . _:genid3416 "A type of voltage clamp recording evidence that involves recording trace of the current (pA) going through the analyzed ion channels determined from voltage clamp current recording."^^ . _:genid3416 "ECO:SN"^^ . _:genid3416 "PMID:17938230"^^ . _:genid3416 "url:http://www.utdallas.edu/~tres/microelectrode/microelectrodes_ch03.pdf"^^ . . . _:genid3417 . _:genid3417 . _:genid3417 . _:genid3417 . _:genid3418 . _:genid3418 . _:genid3418 . _:genid3418 . "A type of electrophysiology assay evidence that involves measuring the amount of current (pA) going through the ion channels per unit of membrane."^^ . "snadendla"^^ . "2016-02-09T12:43:07Z"^^ . "eco"^^ . "ECO:0005564"^^ . "current density evidence"^^ . _:genid3419 . _:genid3419 . _:genid3419 . _:genid3419 "A type of electrophysiology assay evidence that involves measuring the amount of current (pA) going through the ion channels per unit of membrane."^^ . _:genid3419 "ECO:SN"^^ . _:genid3419 "url:http://circres.ahajournals.org/content/102/11/1298.full"^^ . _:genid3419 "url:http://www.bem.fi/book/04/04.htm"^^ . . "snadendla"^^ . "2016-02-09T12:45:42Z"^^ . "eco"^^ . "ECO:0005565"^^ . "single channel conductance evidence"^^ . "true"^^ . . . _:genid3420 . _:genid3420 . _:genid3420 . _:genid3420 . _:genid3421 . _:genid3421 . _:genid3421 . _:genid3421 . "A type of electrophysiology assay evidence that involves the measurement of the current that persists after the fast and slow inactivation of the analyzed channels."^^ . "snadendla"^^ . "2016-02-09T12:46:54Z"^^ . "eco"^^ . "ECO:0005566"^^ . "sustained current evidence"^^ . _:genid3422 . _:genid3422 . _:genid3422 . _:genid3422 "A type of electrophysiology assay evidence that involves the measurement of the current that persists after the fast and slow inactivation of the analyzed channels."^^ . _:genid3422 "ECO:SN"^^ . _:genid3422 "url:http://www.nature.com/ncomms/journal/v3/n2/full/ncomms1717.html"^^ . . "snadendla"^^ . "2016-02-09T12:48:17Z"^^ . "eco"^^ . "ECO:0005567"^^ . "steady state activation curve evidence"^^ . "true"^^ . . "snadendla"^^ . "2016-02-09T12:50:45Z"^^ . "eco"^^ . "ECO:0005568"^^ . "steady state inactivation curve evidence"^^ . "true"^^ . . "snadendla"^^ . "2016-02-09T12:57:16Z"^^ . "eco"^^ . "ECO:0005569"^^ . "window current trace evidence"^^ . "true"^^ . . . "A type of electrophysiology assay evidence in which the amount of current remaining after a series of depolarization at different frequencies described as the normalized current related to the time course."^^ . "snadendla"^^ . "2016-02-09T12:58:18Z"^^ . "eco"^^ . "ECO:0005570"^^ . "use dependence of inactivation evidence"^^ . _:genid3423 . _:genid3423 . _:genid3423 . _:genid3423 "A type of electrophysiology assay evidence in which the amount of current remaining after a series of depolarization at different frequencies described as the normalized current related to the time course."^^ . _:genid3423 "ECO:SN"^^ . _:genid3423 "url:http://circres.ahajournals.org/content/89/8/700.full"^^ . . . "A type of electrophysiology assay evidence that involves recording the change in membrane potential caused by applying specific current to the cell."^^ . "snadendla"^^ . "2016-02-12T13:58:32Z"^^ . "birnlex:2278"^^ . "current clamp voltage recording evidence"^^ . "eco"^^ . "ECO:0005571"^^ . "current clamp recording evidence"^^ . _:genid3424 . _:genid3424 . _:genid3424 . _:genid3424 "A type of electrophysiology assay evidence that involves recording the change in membrane potential caused by applying specific current to the cell."^^ . _:genid3424 "ECO:SN"^^ . _:genid3424 "url:http://www.nature.com/nprot/journal/v4/n8/full/nprot.2009.91.html"^^ . _:genid3425 . _:genid3425 . _:genid3425 . _:genid3425 "birnlex:2278"^^ . _:genid3425 "current clamp voltage recording protocol"^^ . . . _:genid3426 . _:genid3426 . _:genid3426 . _:genid3426 . _:genid3427 . _:genid3427 . _:genid3428 . _:genid3429 . _:genid3431 _:genid3430 . _:genid3429 _:genid3431 . _:genid3430 . _:genid3430 . _:genid3430 . _:genid3431 . _:genid3428 _:genid3429 . _:genid3427 _:genid3428 . _:genid3427 . "A type of voltage clamp recording evidence that involves direct measurement of ionic current across a membrane while controlling the membrane potential by maintaining the voltage."^^ . "snadendla"^^ . "2016-02-12T14:06:40Z"^^ . "birnlex:2281"^^ . "eco"^^ . "ECO:0005572"^^ . "whole-cell voltage clamp recording evidence"^^ . _:genid3432 . _:genid3432 . _:genid3432 . _:genid3432 "A type of voltage clamp recording evidence that involves direct measurement of ionic current across a membrane while controlling the membrane potential by maintaining the voltage."^^ . _:genid3432 "ECO:SN"^^ . _:genid3432 "url:http://circres.ahajournals.org/content/72/1/91.full.pdf"^^ . _:genid3433 . _:genid3433 . _:genid3433 . _:genid3433 "birnlex:2281"^^ . _:genid3433 "whole-cell voltage clamp recording protocol"^^ . . . _:genid3434 . _:genid3434 . _:genid3434 . _:genid3434 . "A type of patch-clamp recording evidence that involves isolation of a patch of membrane electrically from the external solution and to record current flowing into the patch and this is achieved by pressing a fire-polished glass pipette, which has been filled with a suitable electrolyte solution, against the surface of a cell and applying light suction."^^ . "snadendla"^^ . "2016-02-12T14:07:39Z"^^ . "birnlex:2283"^^ . "cell-attached patch-clamp recording evidence"^^ . "eco"^^ . "ECO:0005573"^^ . "cell-attached single-channel recording evidence"^^ . _:genid3435 . _:genid3435 . _:genid3435 . _:genid3435 "A type of patch-clamp recording evidence that involves isolation of a patch of membrane electrically from the external solution and to record current flowing into the patch and this is achieved by pressing a fire-polished glass pipette, which has been filled with a suitable electrolyte solution, against the surface of a cell and applying light suction."^^ . _:genid3435 "ECO:SN"^^ . _:genid3435 "url:http://www.utdallas.edu/~tres/microelectrode/microelectrodes_ch04.pdf"^^ . _:genid3436 . _:genid3436 . _:genid3436 . _:genid3436 "birnlex:2283"^^ . _:genid3436 "cell-attached single-channel recording protocol"^^ . . . _:genid3437 . _:genid3437 . _:genid3437 . _:genid3437 . "A type of patch-clamp recording evidence that involves study of individual ion channels by gently pulling the patch of membrane away from the cell, and the patch remains attached to the pipette with its cytoplasmic surface exposed to the bathing solution."^^ . "snadendla"^^ . "2016-02-12T14:16:53Z"^^ . "birnlex:2286"^^ . "cell-detached inside-out patch-clamp recording evidence"^^ . "eco"^^ . "ECO:0005574"^^ . "cell-detached inside-out single-channel recording evidence"^^ . _:genid3438 . _:genid3438 . _:genid3438 . _:genid3438 "A type of patch-clamp recording evidence that involves study of individual ion channels by gently pulling the patch of membrane away from the cell, and the patch remains attached to the pipette with its cytoplasmic surface exposed to the bathing solution."^^ . _:genid3438 "ECO:SN"^^ . _:genid3438 "url:http://www.acnp.org/g4/GN401000005/CH005.html"^^ . _:genid3439 . _:genid3439 . _:genid3439 . _:genid3439 "birnlex:2286"^^ . _:genid3439 "cell-detached inside-out single-channel recording protocol"^^ . . . "A type of patch-clamp reocrding evidence that involves ion channel analysis by incorporating the ion channels into liposomes suitable for patch-clamping which allows isolation and study of a specific population of channels into that bilayer membrane."^^ . "snadendla"^^ . "2016-02-12T14:17:46Z"^^ . "birnlex:2287"^^ . "eco"^^ . "ECO:0005575"^^ . "reconstituted bilayer single-channel patch recording evidence"^^ . _:genid3440 . _:genid3440 . _:genid3440 . _:genid3440 "A type of patch-clamp reocrding evidence that involves ion channel analysis by incorporating the ion channels into liposomes suitable for patch-clamping which allows isolation and study of a specific population of channels into that bilayer membrane."^^ . _:genid3440 "ECO:SN"^^ . _:genid3440 "url:http://nanion.de/images/stories/papers/Bilayers_lab-on-a-chip08.pdf"^^ . _:genid3441 . _:genid3441 . _:genid3441 . _:genid3441 "birnlex:2287"^^ . _:genid3441 "reconstituted bilayer single-channel patch recording protocol"^^ . . . "A type of electrophysiology assay evidence that involves recording membrane potential by controlling the membrane voltage and measuring the transmembrane current required to maintain that voltage."^^ . "snadendla"^^ . "2016-02-12T14:18:36Z"^^ . "birnlex:2279"^^ . "voltage clamp current recording evidence"^^ . "eco"^^ . "ECO:0005576"^^ . "voltage clamp recording evidence"^^ . _:genid3442 . _:genid3442 . _:genid3442 . _:genid3442 "A type of electrophysiology assay evidence that involves recording membrane potential by controlling the membrane voltage and measuring the transmembrane current required to maintain that voltage."^^ . _:genid3442 "ECO:SN"^^ . _:genid3442 "url:http://neurobio.drexelmed.edu/GaoWeb/Resources/Recording%20_Techniques.pdf"^^ . _:genid3442 "url:http://www.acnp.org/g4/GN401000005/CH005.html"^^ . _:genid3443 . _:genid3443 . _:genid3443 . _:genid3443 "birnlex:2279"^^ . _:genid3443 "voltage clamp current recording protocol"^^ . . . _:genid3444 . _:genid3444 . _:genid3444 . _:genid3444 . _:genid3445 . _:genid3445 . _:genid3445 . _:genid3445 . _:genid3446 . _:genid3446 . _:genid3447 . _:genid3448 . _:genid3450 _:genid3449 . _:genid3448 _:genid3450 . _:genid3449 . _:genid3449 . _:genid3451 . _:genid3451 . _:genid3452 . _:genid3453 . _:genid3454 . _:genid3453 _:genid3454 . _:genid3454 . _:genid3452 _:genid3453 . _:genid3451 _:genid3452 . _:genid3449 _:genid3451 . _:genid3450 . _:genid3447 _:genid3448 . _:genid3446 _:genid3447 . _:genid3446 . "A type of electrophysiology assay evidence that involves recording the electrical activity of the brain by means of electrodes placed on the surface of the head."^^ . "snadendla"^^ . "2016-02-12T14:19:21Z"^^ . "birnlex:2293"^^ . "eco"^^ . "ECO:0005577"^^ . "electroencephalography recording evidence"^^ . _:genid3455 . _:genid3455 . _:genid3455 . _:genid3455 "A type of electrophysiology assay evidence that involves recording the electrical activity of the brain by means of electrodes placed on the surface of the head."^^ . _:genid3455 "ECO:SN"^^ . _:genid3455 "url:http://www.jove.com/science-education/5420/electro-encephalography-eeg"^^ . _:genid3456 . _:genid3456 . _:genid3456 . _:genid3456 "birnlex:2293"^^ . _:genid3456 "electroencephalography recording protocol"^^ . . . _:genid3457 . _:genid3457 . _:genid3457 . _:genid3457 . "A type of microscopy evidence where the images are taken with a higher resolution than the diffraction limit that help in studying nanoscopic sub-cellular structures."^^ . "snadendla"^^ . "2016-02-12T15:20:47Z"^^ . "eco"^^ . "ECO:0005578"^^ . "super-resolution microscopy evidence"^^ . _:genid3458 . _:genid3458 . _:genid3458 . _:genid3458 "A type of microscopy evidence where the images are taken with a higher resolution than the diffraction limit that help in studying nanoscopic sub-cellular structures."^^ . _:genid3458 "ECO:SN"^^ . _:genid3458 "url:http://journal.frontiersin.org/article/10.3389/fncel.2015.00007/full"^^ . . _:genid3459 . _:genid3460 . _:genid3462 _:genid3461 . _:genid3460 _:genid3462 . _:genid3461 . _:genid3461 . _:genid3461 . _:genid3462 . _:genid3459 _:genid3460 . _:genid3459 . . . "IDA"^^ . "A type of immunogold labelling evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-02-12T15:38:03Z"^^ . "immunogold labelling"^^ . "eco"^^ . "ECO:0005579"^^ . "immunogold labelling evidence used in manual assertion"^^ . _:genid3463 . _:genid3463 . _:genid3463 . _:genid3463 . _:genid3463 "true"^^ . _:genid3464 . _:genid3464 . _:genid3464 . _:genid3464 "A type of immunogold labelling evidence that is used in a manual assertion."^^ . _:genid3464 "ECO:SN"^^ . . _:genid3465 . _:genid3466 . _:genid3468 _:genid3467 . _:genid3466 _:genid3468 . _:genid3467 . _:genid3467 . _:genid3467 . _:genid3468 . _:genid3465 _:genid3466 . _:genid3465 . . . "IDA"^^ . "A type of flow cytometry evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-02-12T16:04:23Z"^^ . "FCM"^^ . "eco"^^ . "ECO:0005580"^^ . "flow cytometry evidence used in manual assertion"^^ . _:genid3469 . _:genid3469 . _:genid3469 . _:genid3469 . _:genid3469 "true"^^ . _:genid3470 . _:genid3470 . _:genid3470 . _:genid3470 "A type of flow cytometry evidence that is used in a manual assertion."^^ . _:genid3470 "ECO:SN"^^ . . _:genid3471 . _:genid3472 . _:genid3474 _:genid3473 . _:genid3472 _:genid3474 . _:genid3473 . _:genid3473 . _:genid3473 . _:genid3474 . _:genid3471 _:genid3472 . _:genid3471 . . . "EXP"^^ . "A type of enzyme-linked immunoabsorbent assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-02-12T16:23:38Z"^^ . "ELISA evidence|enzyme-linked immunosorbent assay evidence"^^ . "eco"^^ . "ECO:0005581"^^ . "enzyme-linked immunoabsorbent assay evidence used in manual assertion"^^ . _:genid3475 . _:genid3475 . _:genid3475 . _:genid3475 . _:genid3475 "true"^^ . _:genid3476 . _:genid3476 . _:genid3476 . _:genid3476 "A type of enzyme-linked immunoabsorbent assay evidence that is used in a manual assertion."^^ . _:genid3476 "ECO:SN"^^ . . . _:genid3477 . _:genid3477 . _:genid3477 . _:genid3477 . "A type of patch-clamp recording evidence where a part of cellular membrane is detached from the cell and whose external face is exposed to the extracellular medium which allows isolating and studying a single or at least a small number of channels into that fragment (patch)."^^ . "snadendla"^^ . "2016-03-02T10:47:25Z"^^ . "cell-detached outside-out patch-clamp evidence"^^ . "eco"^^ . "ECO:0005582"^^ . "cell-detached outside-out single-channel recording evidence"^^ . _:genid3478 . _:genid3478 . _:genid3478 . _:genid3478 "A type of patch-clamp recording evidence where a part of cellular membrane is detached from the cell and whose external face is exposed to the extracellular medium which allows isolating and studying a single or at least a small number of channels into that fragment (patch)."^^ . _:genid3478 "ECO:SN"^^ . _:genid3478 "url:http://www.nature.com/nprot/journal/v2/n11/full/nprot.2007.403.html"^^ . . . "A type of voltage clamp recording evidence that involves inserting the oocyte in a chamber that separates the surface into 3 regions where the top portion of the oocyte membrane is the region that is clamped from which currents are actually recorded while the bottom portion is the region of the oocyte that is cut-open, making it possible to inject current intracellularly through a low resistance pathway."^^ . "snadendla"^^ . "2016-03-02T11:29:32Z"^^ . "eco"^^ . "ECO:0005583"^^ . "cut-open oocyte voltage clamp recording evidence"^^ . _:genid3479 . _:genid3479 . _:genid3479 . _:genid3479 "A type of voltage clamp recording evidence that involves inserting the oocyte in a chamber that separates the surface into 3 regions where the top portion of the oocyte membrane is the region that is clamped from which currents are actually recorded while the bottom portion is the region of the oocyte that is cut-open, making it possible to inject current intracellularly through a low resistance pathway."^^ . _:genid3479 "ECO:SN"^^ . _:genid3479 "PMID:9711615"^^ . . . _:genid3480 . _:genid3480 . _:genid3480 . _:genid3480 . _:genid3481 . _:genid3481 . _:genid3482 . _:genid3483 . _:genid3485 _:genid3484 . _:genid3483 _:genid3485 . _:genid3484 . _:genid3484 . _:genid3484 . _:genid3485 . _:genid3482 _:genid3483 . _:genid3481 _:genid3482 . _:genid3481 . "A type of voltage clamp recording evidence where recording is done on a fragment of the cell membrane (attached to or detached from the cell) using a large tip diameter pipette that allows isolating and studying a small number of channels into that fragment (patch)."^^ . "snadendla"^^ . "2016-03-02T11:33:48Z"^^ . "eco"^^ . "ECO:0005584"^^ . "macropatch voltage clamp recording evidence"^^ . _:genid3486 . _:genid3486 . _:genid3486 . _:genid3486 "A type of voltage clamp recording evidence where recording is done on a fragment of the cell membrane (attached to or detached from the cell) using a large tip diameter pipette that allows isolating and studying a small number of channels into that fragment (patch)."^^ . _:genid3486 "ECO:SN"^^ . _:genid3486 "url:http://jxb.oxfordjournals.org/content/50/Special_Issue/1037.full.pdf"^^ . . . "A type of mass spectrometry evidence where mass-to-charge ratio (m/z) of gas-phase ions is measured which is used to identify and quantify molecules in complex solutions within the framework of high throughput studies."^^ . "snadendla"^^ . "2016-03-02T12:33:07Z"^^ . "eco"^^ . "ECO:0005585"^^ . "There are significant differences in data analysis and data evaluation if to compare a HTP mass-spec and a regular mass-spec. The regular mass spec method is quite a reliable technique for identifying a protein molecular weight and analysing its post-modifications, other mass-spec applications might require the additional quality controls and more stringent data evaluation. More complex sample mixture is processed, more quality questions should be addressed, such as a sample contamination and sensitivity of the mass spectrometer while using HTP mass-spec.\nFor HTP mass-spec, the analysis of the small data sets allows to manually assign the spectra to proteins or peptides, but for large data sets only the statistical tools can be used instead."^^ . "high throughput mass spectrometry evidence"^^ . _:genid3487 . _:genid3487 . _:genid3487 . _:genid3487 "A type of mass spectrometry evidence where mass-to-charge ratio (m/z) of gas-phase ions is measured which is used to identify and quantify molecules in complex solutions within the framework of high throughput studies."^^ . _:genid3487 "ECO:SN"^^ . _:genid3487 "PMID:20805795"^^ . . _:genid3488 . _:genid3489 . _:genid3491 _:genid3490 . _:genid3489 _:genid3491 . _:genid3490 . _:genid3490 . _:genid3490 . _:genid3491 . _:genid3488 _:genid3489 . _:genid3488 . . . "EXP"^^ . "A type of high throughput mass spectrometry evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-03-02T12:50:02Z"^^ . "eco"^^ . "ECO:0005586"^^ . "high throughput mass spectrometry evidence used in manual assertion"^^ . _:genid3492 . _:genid3492 . _:genid3492 . _:genid3492 . _:genid3492 "true"^^ . _:genid3493 . _:genid3493 . _:genid3493 . _:genid3493 "A type of high throughput mass spectrometry evidence that is used in a manual assertion."^^ . _:genid3493 "ECO:SN"^^ . . . _:genid3494 . _:genid3494 . _:genid3495 . _:genid3496 . _:genid3498 _:genid3497 . _:genid3496 _:genid3498 . _:genid3497 . _:genid3497 . _:genid3497 . _:genid3498 . _:genid3495 _:genid3496 . _:genid3494 _:genid3495 . _:genid3494 . "A type of microscopy evidence where sharp images are taken by excluding most of the light from the specimen that is not from the microscope's focal plane, thus allowing better contrast and less haze, which makes it possible to build three-dimensional reconstructions of a volume of the specimen by assembling a series of thin slices taken along the vertical axis."^^ . "snadendla"^^ . "2016-03-17T12:29:45Z"^^ . "eco"^^ . "ECO:0005587"^^ . "confocal microscopy evidence"^^ . _:genid3499 . _:genid3499 . _:genid3499 . _:genid3499 "A type of microscopy evidence where sharp images are taken by excluding most of the light from the specimen that is not from the microscope's focal plane, thus allowing better contrast and less haze, which makes it possible to build three-dimensional reconstructions of a volume of the specimen by assembling a series of thin slices taken along the vertical axis."^^ . _:genid3499 "ECO:SN"^^ . _:genid3499 "url:http://www.physics.emory.edu/faculty/weeks//lab/papers/ebbe05.pdf"^^ . . . "A type of microscopy evidence where imaging of a thin cell or a tissue specimen is performed by full aperture emission of light gathered by the microscope's objective, which maximizes the recorded signal and simultaneously minimizes the required exposure times."^^ . "snadendla"^^ . "2016-03-17T12:30:27Z"^^ . "eco"^^ . "ECO:0005588"^^ . "wide-field microscopy evidence"^^ . _:genid3500 . _:genid3500 . _:genid3500 . _:genid3500 "A type of microscopy evidence where imaging of a thin cell or a tissue specimen is performed by full aperture emission of light gathered by the microscope's objective, which maximizes the recorded signal and simultaneously minimizes the required exposure times."^^ . _:genid3500 "ECO:SN"^^ . _:genid3500 "url:http://jcb.rupress.org/content/172/1/9.full"^^ . _:genid3500 "url:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3048960/"^^ . _:genid3500 "url:http://zeiss-campus.magnet.fsu.edu/articles/livecellimaging/techniques.html"^^ . . _:genid3501 . _:genid3502 . _:genid3504 _:genid3503 . _:genid3502 _:genid3504 . _:genid3503 . _:genid3503 . _:genid3503 . _:genid3504 . _:genid3501 _:genid3502 . _:genid3501 . . . "IDA"^^ . "A type confocal microscopy evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-03-17T12:32:24Z"^^ . "eco"^^ . "ECO:0005589"^^ . "confocal microscopy evidence used in manual assertion"^^ . _:genid3505 . _:genid3505 . _:genid3505 . _:genid3505 . _:genid3505 "true"^^ . _:genid3506 . _:genid3506 . _:genid3506 . _:genid3506 "A type confocal microscopy evidence that is used in a manual assertion."^^ . _:genid3506 "ECO:SN"^^ . . _:genid3507 . _:genid3508 . _:genid3510 _:genid3509 . _:genid3508 _:genid3510 . _:genid3509 . _:genid3509 . _:genid3509 . _:genid3510 . _:genid3507 _:genid3508 . _:genid3507 . . . "IDA"^^ . "A type of wide-field microscopy evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-03-17T12:34:42Z"^^ . "eco"^^ . "ECO:0005590"^^ . "wide-field microscopy evidence used in manual assertion"^^ . _:genid3511 . _:genid3511 . _:genid3511 . _:genid3511 . _:genid3511 "true"^^ . _:genid3512 . _:genid3512 . _:genid3512 . _:genid3512 "A type of wide-field microscopy evidence that is used in a manual assertion."^^ . _:genid3512 "ECO:SN"^^ . . . . _:genid3513 . _:genid3513 . _:genid3514 . _:genid3515 . _:genid3517 _:genid3516 . _:genid3515 _:genid3517 . _:genid3516 . _:genid3519 _:genid3518 . _:genid3518 . _:genid3518 . _:genid3518 . _:genid3521 _:genid3520 . _:genid3519 _:genid3521 . _:genid3520 . _:genid3520 . _:genid3520 . _:genid3521 . _:genid3516 _:genid3519 . _:genid3517 . _:genid3514 _:genid3515 . _:genid3513 _:genid3514 . _:genid3513 . "A type of immunogold labelling evidence where electron microscopy technique is used to detect the location of the antibodies labeled with colloidal gold particles."^^ . "snadendla"^^ . "2016-03-17T15:43:00Z"^^ . "eco"^^ . "ECO:0005591"^^ . "immunogold labelling electron microscopy assay evidence"^^ . _:genid3522 . _:genid3522 . _:genid3522 . _:genid3522 "A type of immunogold labelling evidence where electron microscopy technique is used to detect the location of the antibodies labeled with colloidal gold particles."^^ . _:genid3522 "ECO:SN"^^ . _:genid3522 "PMID:4110101"^^ . . _:genid3523 . _:genid3524 . _:genid3526 _:genid3525 . _:genid3524 _:genid3526 . _:genid3525 . _:genid3525 . _:genid3525 . _:genid3526 . _:genid3523 _:genid3524 . _:genid3523 . . . . "IDA"^^ . "A type of immunogold labelling electron microscopy assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-03-17T16:39:37Z"^^ . "eco"^^ . "ECO:0005592"^^ . "immunogold labelling electron microscopy assay evidence used in manual assertion"^^ . _:genid3527 . _:genid3527 . _:genid3527 . _:genid3527 . _:genid3527 "true"^^ . _:genid3528 . _:genid3528 . _:genid3528 . _:genid3528 . _:genid3528 "true"^^ . _:genid3529 . _:genid3529 . _:genid3529 . _:genid3529 "A type of immunogold labelling electron microscopy assay evidence that is used in a manual assertion."^^ . _:genid3529 "ECO:SN"^^ . . . _:genid3530 . _:genid3530 . _:genid3530 . _:genid3530 . _:genid3531 . _:genid3531 . _:genid3531 . _:genid3531 . _:genid3532 . _:genid3532 . _:genid3533 . _:genid3534 . _:genid3536 _:genid3535 . _:genid3534 _:genid3536 . _:genid3535 . _:genid3535 . _:genid3537 . _:genid3538 . _:genid3540 _:genid3539 . _:genid3538 _:genid3540 . _:genid3539 . _:genid3539 . _:genid3539 . _:genid3540 . _:genid3537 _:genid3538 . _:genid3535 _:genid3537 . _:genid3536 . _:genid3533 _:genid3534 . _:genid3532 _:genid3533 . _:genid3532 . "A type of direct assay evidence that involves the use of antibodies to detect biomolecules."^^ . "snadendla"^^ . "2016-03-17T17:07:33Z"^^ . "eco"^^ . "ECO:0005593"^^ . "immunodetection assay evidence"^^ . _:genid3541 . _:genid3541 . _:genid3541 . _:genid3541 "A type of direct assay evidence that involves the use of antibodies to detect biomolecules."^^ . _:genid3541 "ECO:SN"^^ . . . "A type of immunolocalization evidence involving enzymatic detection of a peroxidase tagged antibody."^^ . "snadendla"^^ . "2016-03-17T17:11:34Z"^^ . "eco"^^ . "ECO:0005594"^^ . "immunoperoxidase immunolocalization evidence"^^ . _:genid3542 . _:genid3542 . _:genid3542 . _:genid3542 "A type of immunolocalization evidence involving enzymatic detection of a peroxidase tagged antibody."^^ . _:genid3542 "ECO:SN"^^ . . _:genid3543 . _:genid3544 . _:genid3546 _:genid3545 . _:genid3544 _:genid3546 . _:genid3545 . _:genid3545 . _:genid3545 . _:genid3546 . _:genid3543 _:genid3544 . _:genid3543 . . . "IDA"^^ . "A type of immunoperoxidase immunolocalization evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-03-17T17:14:05Z"^^ . "eco"^^ . "ECO:0005595"^^ . "immunoperoxidase immunolocalization evidence used in manual assertion"^^ . _:genid3547 . _:genid3547 . _:genid3547 . _:genid3547 . _:genid3547 "true"^^ . _:genid3548 . _:genid3548 . _:genid3548 . _:genid3548 "A type of immunoperoxidase immunolocalization evidence that is used in a manual assertion."^^ . _:genid3548 "ECO:SN"^^ . . . . _:genid3549 . _:genid3549 . _:genid3550 . _:genid3551 . _:genid3552 . _:genid3551 _:genid3552 . _:genid3552 . _:genid3550 _:genid3551 . _:genid3549 _:genid3550 . _:genid3549 . "A type of immunoperoxidase immunolocalization evidence where electron microscopy technique is used for enzymatic detection of a peroxidase tagged antibody."^^ . "snadendla"^^ . "2016-03-17T17:16:38Z"^^ . "Immunoperoxidase labelling electron microscopy"^^ . "eco"^^ . "ECO:0005596"^^ . "immunoperoxidase immunolocalization electron microscopy evidence"^^ . _:genid3553 . _:genid3553 . _:genid3553 . _:genid3553 "A type of immunoperoxidase immunolocalization evidence where electron microscopy technique is used for enzymatic detection of a peroxidase tagged antibody."^^ . _:genid3553 "ECO:SN"^^ . . _:genid3554 . _:genid3555 . _:genid3557 _:genid3556 . _:genid3555 _:genid3557 . _:genid3556 . _:genid3556 . _:genid3556 . _:genid3557 . _:genid3554 _:genid3555 . _:genid3554 . . . . "IDA"^^ . "A type of immunoperoxidase immunolocalization electron microscopy evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-03-17T17:23:56Z"^^ . "immunoperoxidase labelling electron microscopy evidence"^^ . "eco"^^ . "ECO:0005597"^^ . "immunoperoxidase immunolocalization electron microscopy evidence used in manual assertion"^^ . _:genid3558 . _:genid3558 . _:genid3558 . _:genid3558 . _:genid3558 "true"^^ . _:genid3559 . _:genid3559 . _:genid3559 . _:genid3559 . _:genid3559 "true"^^ . _:genid3560 . _:genid3560 . _:genid3560 . _:genid3560 "A type of immunoperoxidase immunolocalization electron microscopy evidence that is used in a manual assertion."^^ . _:genid3560 "ECO:SN"^^ . . . "A type of wide-field microscopy evidence where pure white and ultraviolet light are produced by a mercury lamp, passed through an optical filter (excitation filter), and directed to a sample via a dichroic mirror, followed by detection of the fluorescent light by a camera after it passes through an emission filter."^^ . "snadendla"^^ . "2016-03-18T11:53:56Z"^^ . "eco"^^ . "ECO:0005598"^^ . "The optical filter is used to select the wavelength of excitation light. The detection camera is typically a CCD camera. Both topographical and dynamic information of a sample are obtained."^^ . "wide-field fluorescence microscopy evidence"^^ . _:genid3561 . _:genid3561 . _:genid3561 . _:genid3561 "A type of wide-field microscopy evidence where pure white and ultraviolet light are produced by a mercury lamp, passed through an optical filter (excitation filter), and directed to a sample via a dichroic mirror, followed by detection of the fluorescent light by a camera after it passes through an emission filter."^^ . _:genid3561 "ECO:SN"^^ . _:genid3561 "url:http://www.bristol.ac.uk/synaptic/research/techniques/widefield.html"^^ . . . . "A type of wide-field fluorescence microscopy evidence where fluorescently tagged antibodies are imaged that are used to bind to their antigens."^^ . "snadendla"^^ . "2016-03-18T11:55:40Z"^^ . "wide-field epifluorescence microscopy"^^ . "eco"^^ . "ECO:0005599"^^ . "immunofluorescence wide-field microscopy evidence"^^ . _:genid3562 . _:genid3562 . _:genid3562 . _:genid3562 "A type of wide-field fluorescence microscopy evidence where fluorescently tagged antibodies are imaged that are used to bind to their antigens."^^ . _:genid3562 "ECO:SN"^^ . _:genid3562 "url:http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0057135"^^ . . . . _:genid3563 . _:genid3563 . _:genid3564 . _:genid3565 . _:genid3567 _:genid3566 . _:genid3565 _:genid3567 . _:genid3566 . _:genid3568 . _:genid3570 _:genid3569 . _:genid3568 _:genid3570 . _:genid3569 . _:genid3569 . _:genid3569 . _:genid3570 . _:genid3566 _:genid3568 . _:genid3567 . _:genid3564 _:genid3565 . _:genid3563 _:genid3564 . _:genid3563 . "The endogenous protein expression and localization for WalR and WalK was also checked using confocal immunofluorescence microscopy. WalR could be localized to the cytoplasm of B. anthracis but WalK could not be detected once again (data not shown)."^^ . "A type of confocal microscopy evidence where light passes through immunofluorescent-stained tissue sections or cells and then the emitted light passes through the dichroic mirror and is focused onto the pinhole for subsequent detection."^^ . "snadendla"^^ . "2016-03-18T12:48:42Z"^^ . "eco"^^ . "ECO:0005600"^^ . "This allows visualization of sub cellular distribution of biomolecules of interest."^^ . "immunofluorescence confocal microscopy evidence"^^ . _:genid3571 . _:genid3571 . _:genid3571 . _:genid3571 "The endogenous protein expression and localization for WalR and WalK was also checked using confocal immunofluorescence microscopy. WalR could be localized to the cytoplasm of B. anthracis but WalK could not be detected once again (data not shown)."^^ . _:genid3571 "PMID:24490131"^^ . _:genid3572 . _:genid3572 . _:genid3572 . _:genid3572 "A type of confocal microscopy evidence where light passes through immunofluorescent-stained tissue sections or cells and then the emitted light passes through the dichroic mirror and is focused onto the pinhole for subsequent detection."^^ . _:genid3572 "ECO:SN"^^ . _:genid3572 "url:http://www.physics.emory.edu/faculty/weeks/confocal/"^^ . _:genid3572 "url:https://www.hycultbiotech.com/media/wysiwyg/protocol_Immunofluorescence.pdf"^^ . . _:genid3573 . _:genid3574 . _:genid3576 _:genid3575 . _:genid3574 _:genid3576 . _:genid3575 . _:genid3575 . _:genid3575 . _:genid3576 . _:genid3573 _:genid3574 . _:genid3573 . . . . "IDA"^^ . "A type of immunofluorescence confocal microscopy evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-03-18T12:52:04Z"^^ . "eco"^^ . "ECO:0005601"^^ . "immunofluorescence confocal microscopy evidence used in manual assertion"^^ . _:genid3577 . _:genid3577 . _:genid3577 . _:genid3577 . _:genid3577 "true"^^ . _:genid3578 . _:genid3578 . _:genid3578 . _:genid3578 . _:genid3578 "true"^^ . _:genid3579 . _:genid3579 . _:genid3579 . _:genid3579 "A type of immunofluorescence confocal microscopy evidence that is used in a manual assertion."^^ . _:genid3579 "ECO:SN"^^ . . . "A type of mass spectrometry evidence where one or more protein analyses are performed."^^ . "snadendla"^^ . "2016-03-18T13:11:37Z"^^ . "eco"^^ . "ECO:0005603"^^ . "protein mass spectrometry evidence"^^ . _:genid3580 . _:genid3580 . _:genid3580 . _:genid3580 "A type of mass spectrometry evidence where one or more protein analyses are performed."^^ . _:genid3580 "ECO:SN"^^ . . . _:genid3581 . _:genid3581 . _:genid3581 . _:genid3581 . _:genid3582 . _:genid3582 . _:genid3582 . _:genid3582 . _:genid3583 . _:genid3583 . _:genid3584 . _:genid3585 . _:genid3587 _:genid3586 . _:genid3585 _:genid3587 . _:genid3586 . _:genid3586 . _:genid3586 . _:genid3587 . _:genid3584 _:genid3585 . _:genid3583 _:genid3584 . _:genid3583 . _:genid3588 . _:genid3588 . _:genid3589 . _:genid3590 . _:genid3592 _:genid3591 . _:genid3590 _:genid3592 . _:genid3591 . _:genid3591 . _:genid3593 . _:genid3593 . _:genid3593 . _:genid3591 _:genid3593 . _:genid3592 . _:genid3589 _:genid3590 . _:genid3588 _:genid3589 . _:genid3588 . "A type of cell proliferation assay evidence where the investigated organism or a potential antagonist is inoculated so as to grow along the diameter line of the agar medium in a Petri dish, then, potentially susceptible microbes (usually bacteria) are streaked perpendicularly to the growth line and inhibition of growth of a test microbe in the vicinity of that line suggests that the antagonist secretes one or more diffusible antibiotics."^^ . "snadendla"^^ . "2016-03-29T15:40:54Z"^^ . "eco"^^ . "ECO:0005604"^^ . "cross-streak test evidence"^^ . _:genid3594 . _:genid3594 . _:genid3594 . _:genid3594 "A type of cell proliferation assay evidence where the investigated organism or a potential antagonist is inoculated so as to grow along the diameter line of the agar medium in a Petri dish, then, potentially susceptible microbes (usually bacteria) are streaked perpendicularly to the growth line and inhibition of growth of a test microbe in the vicinity of that line suggests that the antagonist secretes one or more diffusible antibiotics."^^ . _:genid3594 "ECO:SN"^^ . _:genid3594 "url:www.jstor.org/stable/3792785"^^ . . . _:genid3595 . _:genid3595 . _:genid3595 . _:genid3595 . "Disk diffusion assays were used to determine if ohr and ohrR mutations affected resistance to ROS. The ohr mutant was less resistant than its parental strain when challenged with organic peroxides as shown by the zones of growth inhibition: 4.1 +- 0.2 cm for CuOOH and 3.1 +- 0.1 cm for tBOOH versus to 2.3 +- 0.2 and 2.5 +- 0.3 cm for wild type strain."^^ . "A type of zone of inhibition evidence where sensitivity/resistance to an antimicrobial agent is tested by impregnating small filter disks with a known concentration of antimicrobial agent which is then placed on a Mueller-Hinton agar plate inoculated with the test organism."^^ . "snadendla"^^ . "2016-03-29T16:02:22Z"^^ . "eco"^^ . "ECO:0005605"^^ . "disk diffusion test evidence"^^ . _:genid3596 . _:genid3596 . _:genid3596 . _:genid3596 "Disk diffusion assays were used to determine if ohr and ohrR mutations affected resistance to ROS. The ohr mutant was less resistant than its parental strain when challenged with organic peroxides as shown by the zones of growth inhibition: 4.1 +- 0.2 cm for CuOOH and 3.1 +- 0.1 cm for tBOOH versus to 2.3 +- 0.2 and 2.5 +- 0.3 cm for wild type strain."^^ . _:genid3596 "PMID:21569462"^^ . _:genid3597 . _:genid3597 . _:genid3597 . _:genid3597 "A type of zone of inhibition evidence where sensitivity/resistance to an antimicrobial agent is tested by impregnating small filter disks with a known concentration of antimicrobial agent which is then placed on a Mueller-Hinton agar plate inoculated with the test organism."^^ . _:genid3597 "ECO:SN"^^ . _:genid3597 "url:http://www.cdc.gov/nczved/resources/cholera/ch9.pdf"^^ . . . _:genid3598 . _:genid3598 . _:genid3598 . _:genid3598 . _:genid3599 . _:genid3599 . _:genid3600 . _:genid3601 . _:genid3603 _:genid3602 . _:genid3601 _:genid3603 . _:genid3602 . _:genid3602 . _:genid3602 . _:genid3603 . _:genid3600 _:genid3601 . _:genid3599 _:genid3600 . _:genid3599 . _:genid3604 . _:genid3604 . _:genid3605 . _:genid3606 . _:genid3608 _:genid3607 . _:genid3606 _:genid3608 . _:genid3607 . _:genid3607 . _:genid3609 . _:genid3609 . _:genid3609 . _:genid3607 _:genid3609 . _:genid3608 . _:genid3605 _:genid3606 . _:genid3604 _:genid3605 . _:genid3604 . _:genid3610 . _:genid3610 . _:genid3611 . _:genid3612 . _:genid3614 _:genid3613 . _:genid3612 _:genid3614 . _:genid3613 . _:genid3613 . _:genid3613 . _:genid3614 . _:genid3611 _:genid3612 . _:genid3610 _:genid3611 . _:genid3610 . "A type of experimental evidence where a foreign genetic material is introduced into the cell for study of gene function and regulation and protein function."^^ . "snadendla"^^ . "2016-03-29T16:59:17Z"^^ . "eco"^^ . "ECO:0005606"^^ . "cell transfection experiment evidence"^^ . _:genid3615 . _:genid3615 . _:genid3615 . _:genid3615 "A type of experimental evidence where a foreign genetic material is introduced into the cell for study of gene function and regulation and protein function."^^ . _:genid3615 "ECO:SN"^^ . _:genid3615 "url:http://ch.promega.com/resources/product-guides-and-selectors/protocols-and-applications-guide/transfection/"^^ . _:genid3615 "url:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2911531/"^^ . . . _:genid3616 . _:genid3616 . _:genid3616 . _:genid3616 . "A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis is determined by observing the rotational behavior of the cells tethered to a coverslip by their flagella."^^ . "snadendla"^^ . "2016-03-31T15:51:10Z"^^ . "eco"^^ . "ECO:0005607"^^ . "tethered cell assay evidence"^^ . _:genid3617 . _:genid3617 . _:genid3617 . _:genid3617 "A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis is determined by observing the rotational behavior of the cells tethered to a coverslip by their flagella."^^ . _:genid3617 "ECO:SN"^^ . _:genid3617 "PMID:1103143"^^ . . . _:genid3618 . _:genid3618 . _:genid3618 . _:genid3618 . "A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis in swimming organisms is determined by measuring chemotaxis in response to sudden concentration changes from one uniform spatial environment to another."^^ . "snadendla"^^ . "2016-03-31T16:42:35Z"^^ . "Temporal assay"^^ . "eco"^^ . "ECO:0005608"^^ . "tumble frequency assay evidence"^^ . _:genid3619 . _:genid3619 . _:genid3619 . _:genid3619 "A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis in swimming organisms is determined by measuring chemotaxis in response to sudden concentration changes from one uniform spatial environment to another."^^ . _:genid3619 "ECO:SN"^^ . _:genid3619 "PMID:4576832"^^ . . . _:genid3620 . _:genid3620 . _:genid3620 . _:genid3620 . "A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis is determined by measuring the rate of accumulation of the cells into a capillary."^^ . "snadendla"^^ . "2016-03-31T16:45:29Z"^^ . "eco"^^ . "ECO:0005609"^^ . "To determine the presence of negative chemotaxis, a repellent is added to the organismal suspension (but not in the capillary) and the organisms that fled into the capillary are measured."^^ . "To determine the presence of positive chemotaxis, an attractant is placed in the capillary and the presence of positive chemotaxis is determined based on the amount of organism that accumulated in the capillary."^^ . "capillary assay evidence"^^ . _:genid3621 . _:genid3621 . _:genid3621 . _:genid3621 "A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis is determined by measuring the rate of accumulation of the cells into a capillary."^^ . _:genid3621 "ECO:SN"^^ . _:genid3621 "PMID:4632978"^^ . . _:genid3622 . _:genid3623 . _:genid3625 _:genid3624 . _:genid3623 _:genid3625 . _:genid3624 . _:genid3624 . _:genid3624 . _:genid3625 . _:genid3622 _:genid3623 . _:genid3622 . . . "A type of biological system reconstruction evidence based on homology evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-03-31T17:00:03Z"^^ . "eco"^^ . "ECO:0005610"^^ . "Inference may be based on paralogy and/or orthology of the genome-encoded components and is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. Evidence may originate from a combination of several experiments in the same or another species."^^ . "biological system reconstruction evidence based on homology evidence used in manual assertion"^^ . _:genid3626 . _:genid3626 . _:genid3626 . _:genid3626 . _:genid3626 "true"^^ . _:genid3627 . _:genid3627 . _:genid3627 . _:genid3627 "A type of biological system reconstruction evidence based on homology evidence that is used in a manual assertion."^^ . _:genid3627 "ECO:SN"^^ . . "A type of direct assay evidence used in manual assertion where phenotype or disease association is made with the gene because of involvement in the molecular mechanism of disease or involvement in a pathway known to contribute to a disease."^^ . "snadendla"^^ . "2016-04-12T16:55:16Z"^^ . "IED"^^ . "inferred from experimental data"^^ . "eco"^^ . "ECO:0005611"^^ . "inference from experimental data evidence"^^ . "true"^^ . _:genid3628 . _:genid3628 . _:genid3628 . _:genid3628 "A type of direct assay evidence used in manual assertion where phenotype or disease association is made with the gene because of involvement in the molecular mechanism of disease or involvement in a pathway known to contribute to a disease."^^ . _:genid3628 "ECO:SN"^^ . . "A type of mutant phenotype evidence used in manual assertion where variations or changes, such as mutations or abnormal levels of the product(s) of a single gene of interest, including non-mutational changes such as inhibition with antibodies or other inhibitors are determined."^^ . "snadendla"^^ . "2016-04-12T17:09:43Z"^^ . "IPM"^^ . "inferred from phenotype manipulation"^^ . "eco"^^ . "ECO:0005612"^^ . "Changes can include any gene mutation/knockout, over-expression or ectopic expression of wild-type or mutant genes, anti-sense experiments, RNAi experiments, specific protein inhibitors."^^ . "inference from phenotype manipulation evidence"^^ . "true"^^ . _:genid3629 . _:genid3629 . _:genid3629 . _:genid3629 "A type of mutant phenotype evidence used in manual assertion where variations or changes, such as mutations or abnormal levels of the product(s) of a single gene of interest, including non-mutational changes such as inhibition with antibodies or other inhibitors are determined."^^ . _:genid3629 "ECO:SN"^^ . . . "EXP"^^ . "A type of natural variation mutant evidence used in manual assertion where alleles are directly linked to phenotype and Mendelian diseases as a result of various experiments."^^ . "snadendla"^^ . "2016-04-12T17:24:00Z"^^ . "IAGP"^^ . "inferred by association of genotype from phenotype"^^ . "eco"^^ . "ECO:0005613"^^ . "Used for 1) polymorphism or segregation of genetic markers (SNPs, mutations, RFLPs, microsatellites); 2) polymorphism or segregation of physical markers (FISH, centromeric or heterochromatic regions, chromosomal banding patterns); 3) detection of polymorphisms in inbred stock."^^ . "inference by association of genotype from phenotype"^^ . _:genid3630 . _:genid3630 . _:genid3630 . _:genid3630 "A type of natural variation mutant evidence used in manual assertion where alleles are directly linked to phenotype and Mendelian diseases as a result of various experiments."^^ . _:genid3630 "ECO:SN"^^ . . _:genid3631 . _:genid3632 . _:genid3634 _:genid3633 . _:genid3632 _:genid3634 . _:genid3633 . _:genid3633 . _:genid3633 . _:genid3634 . _:genid3631 _:genid3632 . _:genid3631 . . . "IDA"^^ . "A type of two-dimensional polyacrylamide gel electrophoresis evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T11:03:08Z"^^ . "2D-PAGE evidence"^^ . "eco"^^ . "ECO:0005614"^^ . "two-dimensional polyacrylamide gel electrophoresis evidence used in manual assertion"^^ . _:genid3635 . _:genid3635 . _:genid3635 . _:genid3635 . _:genid3635 "true"^^ . _:genid3636 . _:genid3636 . _:genid3636 . _:genid3636 "A type of two-dimensional polyacrylamide gel electrophoresis evidence that is used in a manual assertion."^^ . _:genid3636 "ECO:SN"^^ . . _:genid3637 . _:genid3638 . _:genid3640 _:genid3639 . _:genid3638 _:genid3640 . _:genid3639 . _:genid3639 . _:genid3639 . _:genid3640 . _:genid3637 _:genid3638 . _:genid3637 . . . "IEP"^^ . "A type of alkaline phosphatase reporter gene assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T11:05:59Z"^^ . "eco"^^ . "SEAP reporter assay"^^ . "secreted embryonic alkaline phosphatase reporter assay"^^ . "ECO:0005615"^^ . "alkaline phosphatase reporter gene assay evidence used in manual assertion"^^ . _:genid3641 . _:genid3641 . _:genid3641 . _:genid3641 . _:genid3641 "true"^^ . _:genid3642 . _:genid3642 . _:genid3642 . _:genid3642 "A type of alkaline phosphatase reporter gene assay evidence that is used in a manual assertion."^^ . _:genid3642 "ECO:SN"^^ . . _:genid3643 . _:genid3644 . _:genid3646 _:genid3645 . _:genid3644 _:genid3646 . _:genid3645 . _:genid3645 . _:genid3645 . _:genid3646 . _:genid3643 _:genid3644 . _:genid3643 . . . "IEP"^^ . "A type of beta-galactosidase reporter gene assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T11:08:57Z"^^ . "beta-gal reporter gene assay evidence"^^ . "LacZ transcript localization evidence used in manual assertion"^^ . "eco"^^ . "lacZ reporter gene assay"^^ . "ECO:0005616"^^ . "beta-galactosidase reporter gene assay evidence used in manual assertion"^^ . _:genid3647 . _:genid3647 . _:genid3647 . _:genid3647 . _:genid3647 "true"^^ . _:genid3648 . _:genid3648 . _:genid3648 . _:genid3648 "A type of beta-galactosidase reporter gene assay evidence that is used in a manual assertion."^^ . _:genid3648 "ECO:SN"^^ . . _:genid3649 . _:genid3650 . _:genid3652 _:genid3651 . _:genid3650 _:genid3652 . _:genid3651 . _:genid3651 . _:genid3651 . _:genid3652 . _:genid3649 _:genid3650 . _:genid3649 . . . "IEP"^^ . "A type of chloramphenicol acetyltransferase reporter gene assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T11:11:07Z"^^ . "CAT reporter gene assay evidence"^^ . "eco"^^ . "ECO:0005617"^^ . "chloramphenicol acetyltransferase reporter gene assay evidence used in manual assertion"^^ . _:genid3653 . _:genid3653 . _:genid3653 . _:genid3653 . _:genid3653 "true"^^ . _:genid3654 . _:genid3654 . _:genid3654 . _:genid3654 "A type of chloramphenicol acetyltransferase reporter gene assay evidence that is used in a manual assertion."^^ . _:genid3654 "ECO:SN"^^ . . _:genid3655 . _:genid3656 . _:genid3658 _:genid3657 . _:genid3656 _:genid3658 . _:genid3657 . _:genid3657 . _:genid3657 . _:genid3658 . _:genid3655 _:genid3656 . _:genid3655 . . . "IEA"^^ . "A type of chromatin immunoprecipitation-chip evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-06T11:17:04Z"^^ . "ChIP-chip evidence"^^ . "ChIP-on-chip evidence"^^ . "eco"^^ . "ECO:0005618"^^ . "chromatin immunoprecipitation-chip evidence used in automatic assertion"^^ . _:genid3659 . _:genid3659 . _:genid3659 . _:genid3659 . _:genid3659 "true"^^ . _:genid3660 . _:genid3660 . _:genid3660 . _:genid3660 "A type of chromatin immunoprecipitation-chip evidence that is used in an automatic assertion."^^ . _:genid3660 "ECO:SN"^^ . . _:genid3661 . _:genid3662 . _:genid3664 _:genid3663 . _:genid3662 _:genid3664 . _:genid3663 . _:genid3663 . _:genid3663 . _:genid3664 . _:genid3661 _:genid3662 . _:genid3661 . . . "IEA"^^ . "A type of chromatin immunoprecipitation- exonuclease evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-06T11:22:25Z"^^ . "ChIP-exo evidence"^^ . "eco"^^ . "ECO:0005619"^^ . "chromatin immunoprecipitation- exonuclease evidence used in automatic assertion"^^ . _:genid3665 . _:genid3665 . _:genid3665 . _:genid3665 . _:genid3665 "true"^^ . _:genid3666 . _:genid3666 . _:genid3666 . _:genid3666 "A type of chromatin immunoprecipitation- exonuclease evidence that is used in an automatic assertion."^^ . _:genid3666 "ECO:SN"^^ . . _:genid3667 . _:genid3668 . _:genid3670 _:genid3669 . _:genid3668 _:genid3670 . _:genid3669 . _:genid3669 . _:genid3669 . _:genid3670 . _:genid3667 _:genid3668 . _:genid3667 . . . "IPI"^^ . "A type of chromatin immunoprecipitation-PCR evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T11:25:01Z"^^ . "ChIP-PCR evidence"^^ . "eco"^^ . "ECO:0005620"^^ . "chromatin immunoprecipitation-PCR evidence used in manual assertion"^^ . _:genid3671 . _:genid3671 . _:genid3671 . _:genid3671 . _:genid3671 "true"^^ . _:genid3672 . _:genid3672 . _:genid3672 . _:genid3672 "A type of chromatin immunoprecipitation-PCR evidence that is used in a manual assertion."^^ . _:genid3672 "ECO:SN"^^ . . _:genid3673 . _:genid3674 . _:genid3676 _:genid3675 . _:genid3674 _:genid3676 . _:genid3675 . _:genid3675 . _:genid3675 . _:genid3676 . _:genid3673 _:genid3674 . _:genid3673 . . . "IEA"^^ . "A type of chromatin immunoprecipitation-seq evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-06T11:29:13Z"^^ . "ChIP-SEQ evidence"^^ . "ChIP-seq evidence"^^ . "eco"^^ . "ECO:0005621"^^ . "chromatin immunoprecipitation-seq evidence used in automatic assertion"^^ . _:genid3677 . _:genid3677 . _:genid3677 . _:genid3677 . _:genid3677 "true"^^ . _:genid3678 . _:genid3678 . _:genid3678 . _:genid3678 "A type of chromatin immunoprecipitation-seq evidence that is used in an automatic assertion."^^ . _:genid3678 "ECO:SN"^^ . . _:genid3679 . _:genid3680 . _:genid3682 _:genid3681 . _:genid3680 _:genid3682 . _:genid3681 . _:genid3681 . _:genid3681 . _:genid3682 . _:genid3679 _:genid3680 . _:genid3679 . . . "ISM"^^ . "A type of comparative genomics motif search evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T14:49:36Z"^^ . "eco"^^ . "ECO:0005622"^^ . "comparative genomics motif search evidence used in manual assertion"^^ . _:genid3683 . _:genid3683 . _:genid3683 . _:genid3683 . _:genid3683 "true"^^ . _:genid3684 . _:genid3684 . _:genid3684 . _:genid3684 "A type of comparative genomics motif search evidence that is used in a manual assertion."^^ . _:genid3684 "ECO:SN"^^ . . _:genid3685 . _:genid3686 . _:genid3688 _:genid3687 . _:genid3686 _:genid3688 . _:genid3687 . _:genid3687 . _:genid3687 . _:genid3688 . _:genid3685 _:genid3686 . _:genid3685 . . . "IEA"^^ . "A type of comparative genomics motif search evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-06T14:52:21Z"^^ . "eco"^^ . "ECO:0005623"^^ . "comparative genomics motif search evidence used in automatic assertion"^^ . _:genid3689 . _:genid3689 . _:genid3689 . _:genid3689 . _:genid3689 "true"^^ . _:genid3690 . _:genid3690 . _:genid3690 . _:genid3690 "A type of comparative genomics motif search evidence that is used in an automatic assertion."^^ . _:genid3690 "ECO:SN"^^ . . _:genid3691 . _:genid3692 . _:genid3694 _:genid3693 . _:genid3692 _:genid3694 . _:genid3693 . _:genid3693 . _:genid3693 . _:genid3694 . _:genid3691 _:genid3692 . _:genid3691 . . . "ISM"^^ . "A type of consensus search evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T14:54:53Z"^^ . "eco"^^ . "ECO:0005624"^^ . "consensus search evidence used in manual assertion"^^ . _:genid3695 . _:genid3695 . _:genid3695 . _:genid3695 . _:genid3695 "true"^^ . _:genid3696 . _:genid3696 . _:genid3696 . _:genid3696 "A type of consensus search evidence that is used in a manual assertion."^^ . _:genid3696 "ECO:SN"^^ . . _:genid3697 . _:genid3698 . _:genid3700 _:genid3699 . _:genid3698 _:genid3700 . _:genid3699 . _:genid3699 . _:genid3699 . _:genid3700 . _:genid3697 _:genid3698 . _:genid3697 . . . "IEA"^^ . "A type of consensus search evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-06T14:58:22Z"^^ . "eco"^^ . "ECO:0005625"^^ . "consensus search evidence used in automatic assertion"^^ . _:genid3701 . _:genid3701 . _:genid3701 . _:genid3701 . _:genid3701 "true"^^ . _:genid3702 . _:genid3702 . _:genid3702 . _:genid3702 "A type of consensus search evidence that is used in an automatic assertion."^^ . _:genid3702 "ECO:SN"^^ . . _:genid3703 . _:genid3704 . _:genid3706 _:genid3705 . _:genid3704 _:genid3706 . _:genid3705 . _:genid3705 . _:genid3705 . _:genid3706 . _:genid3703 _:genid3704 . _:genid3703 . . . "IPI"^^ . "A type of copper-phenanthroline footprinting evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T15:01:25Z"^^ . "1,10-phenanthroline-copper footprinting evidence"^^ . "eco"^^ . "OP-Cu Complex"^^ . "ECO:0005626"^^ . "copper-phenanthroline footprinting evidence used in manual assertion"^^ . _:genid3707 . _:genid3707 . _:genid3707 . _:genid3707 . _:genid3707 "true"^^ . _:genid3708 . _:genid3708 . _:genid3708 . _:genid3708 "A type of copper-phenanthroline footprinting evidence that is used in a manual assertion."^^ . _:genid3708 "ECO:SN"^^ . . _:genid3709 . _:genid3710 . _:genid3712 _:genid3711 . _:genid3710 _:genid3712 . _:genid3711 . _:genid3711 . _:genid3711 . _:genid3712 . _:genid3709 _:genid3710 . _:genid3709 . . . "IPI"^^ . "A type of DNA adenine methyltransferase identification evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T15:05:14Z"^^ . "DamID evidence"^^ . "eco"^^ . "ECO:0005627"^^ . "DNA adenine methyltransferase identification evidence used in manual assertion"^^ . _:genid3713 . _:genid3713 . _:genid3713 . _:genid3713 . _:genid3713 "true"^^ . _:genid3714 . _:genid3714 . _:genid3714 . _:genid3714 "A type of DNA adenine methyltransferase identification evidence that is used in a manual assertion."^^ . _:genid3714 "ECO:SN"^^ . . _:genid3715 . _:genid3716 . _:genid3718 _:genid3717 . _:genid3716 _:genid3718 . _:genid3717 . _:genid3717 . _:genid3717 . _:genid3718 . _:genid3715 _:genid3716 . _:genid3715 . . . "IEA"^^ . "A type of DNA adenine methyltransferase identification evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-06T15:06:46Z"^^ . "DamID evidence"^^ . "eco"^^ . "ECO:0005628"^^ . "DNA adenine methyltransferase identification evidence used in automatic assertion"^^ . _:genid3719 . _:genid3719 . _:genid3719 . _:genid3719 . _:genid3719 "true"^^ . _:genid3720 . _:genid3720 . _:genid3720 . _:genid3720 "A type of DNA adenine methyltransferase identification evidence that is used in an automatic assertion."^^ . _:genid3720 "ECO:SN"^^ . . _:genid3721 . _:genid3722 . _:genid3724 _:genid3723 . _:genid3722 _:genid3724 . _:genid3723 . _:genid3723 . _:genid3723 . _:genid3724 . _:genid3721 _:genid3722 . _:genid3721 . . . "EXP"^^ . "A type of DNA affinity chromatography evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T15:08:40Z"^^ . "DNA affinity purification evidence"^^ . "eco"^^ . "ECO:0005629"^^ . "DNA affinity chromatography evidence used in manual assertion"^^ . _:genid3725 . _:genid3725 . _:genid3725 . _:genid3725 . _:genid3725 "true"^^ . _:genid3726 . _:genid3726 . _:genid3726 . _:genid3726 "A type of DNA affinity chromatography evidence that is used in a manual assertion."^^ . _:genid3726 "ECO:SN"^^ . . _:genid3727 . _:genid3728 . _:genid3730 _:genid3729 . _:genid3728 _:genid3730 . _:genid3729 . _:genid3729 . _:genid3729 . _:genid3730 . _:genid3727 _:genid3728 . _:genid3727 . . . "IEA"^^ . "A type of cDNA to DNA expression microarray evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-06T15:31:51Z"^^ . "DNA microarray evidence"^^ . "RNA microarray evidence"^^ . "eco"^^ . "ECO:0005630"^^ . "cDNA to DNA expression microarray evidence used in automatic assertion"^^ . _:genid3731 . _:genid3731 . _:genid3731 . _:genid3731 . _:genid3731 "true"^^ . _:genid3732 . _:genid3732 . _:genid3732 . _:genid3732 "A type of cDNA to DNA expression microarray evidence that is used in an automatic assertion."^^ . _:genid3732 "ECO:SN"^^ . . _:genid3733 . _:genid3734 . _:genid3736 _:genid3735 . _:genid3734 _:genid3736 . _:genid3735 . _:genid3735 . _:genid3735 . _:genid3736 . _:genid3733 _:genid3734 . _:genid3733 . . . "IPI"^^ . "A type of DNAse footprinting evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T15:35:41Z"^^ . "DNase protection evidence"^^ . "eco"^^ . "ECO:0005631"^^ . "DNAse footprinting evidence used in manual assertion"^^ . _:genid3737 . _:genid3737 . _:genid3737 . _:genid3737 . _:genid3737 "true"^^ . _:genid3738 . _:genid3738 . _:genid3738 . _:genid3738 "A type of DNAse footprinting evidence that is used in a manual assertion."^^ . _:genid3738 "ECO:SN"^^ . . _:genid3739 . _:genid3740 . _:genid3742 _:genid3741 . _:genid3740 _:genid3742 . _:genid3741 . _:genid3741 . _:genid3741 . _:genid3742 . _:genid3739 _:genid3740 . _:genid3739 . . . "IDA"^^ . "A type of fluorescence anisotropy evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T15:45:40Z"^^ . "FA evidence"^^ . "eco"^^ . "FP"^^ . "fluorescence polarization"^^ . "ECO:0005632"^^ . "fluorescence anisotropy evidence used in manual assertion"^^ . _:genid3743 . _:genid3743 . _:genid3743 . _:genid3743 . _:genid3743 "true"^^ . _:genid3744 . _:genid3744 . _:genid3744 . _:genid3744 "A type of fluorescence anisotropy evidence that is used in a manual assertion."^^ . _:genid3744 "ECO:SN"^^ . . _:genid3745 . _:genid3746 . _:genid3748 _:genid3747 . _:genid3746 _:genid3748 . _:genid3747 . _:genid3747 . _:genid3747 . _:genid3748 . _:genid3745 _:genid3746 . _:genid3745 . . . "IEP"^^ . "A type of ferric uptake regulator titration assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T15:49:18Z"^^ . "FURTA evidence"^^ . "eco"^^ . "ECO:0005633"^^ . "ferric uptake regulator titration assay evidence used in manual assertion"^^ . _:genid3749 . _:genid3749 . _:genid3749 . _:genid3749 . _:genid3749 "true"^^ . _:genid3750 . _:genid3750 . _:genid3750 . _:genid3750 "A type of ferric uptake regulator titration assay evidence that is used in a manual assertion."^^ . _:genid3750 "ECO:SN"^^ . . _:genid3751 . _:genid3752 . _:genid3754 _:genid3753 . _:genid3752 _:genid3754 . _:genid3753 . _:genid3753 . _:genid3753 . _:genid3754 . _:genid3751 _:genid3752 . _:genid3751 . . . "IPI"^^ . "A type of genomic systematic evolution of ligands by exponential amplification evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T16:41:30Z"^^ . "genomic SELEX evidence"^^ . "eco"^^ . "ECO:0005634"^^ . "genomic systematic evolution of ligands by exponential amplification evidence used in manual assertion"^^ . _:genid3755 . _:genid3755 . _:genid3755 . _:genid3755 . _:genid3755 "true"^^ . _:genid3756 . _:genid3756 . _:genid3756 . _:genid3756 "A type of genomic systematic evolution of ligands by exponential amplification evidence that is used in a manual assertion."^^ . _:genid3756 "ECO:SN"^^ . . _:genid3757 . _:genid3758 . _:genid3760 _:genid3759 . _:genid3758 _:genid3760 . _:genid3759 . _:genid3759 . _:genid3759 . _:genid3760 . _:genid3757 _:genid3758 . _:genid3757 . . . "IEA"^^ . "A type of genomic systematic evolution of ligands by exponential amplification evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-06T16:43:03Z"^^ . "genomic SELEX evidence"^^ . "eco"^^ . "ECO:0005635"^^ . "genomic systematic evolution of ligands by exponential amplification evidence used in automatic assertion"^^ . _:genid3761 . _:genid3761 . _:genid3761 . _:genid3761 . _:genid3761 "true"^^ . _:genid3762 . _:genid3762 . _:genid3762 . _:genid3762 "A type of genomic systematic evolution of ligands by exponential amplification evidence that is used in an automatic assertion."^^ . _:genid3762 "ECO:SN"^^ . . _:genid3763 . _:genid3764 . _:genid3766 _:genid3765 . _:genid3764 _:genid3766 . _:genid3765 . _:genid3765 . _:genid3765 . _:genid3766 . _:genid3763 _:genid3764 . _:genid3763 . . . "IEP"^^ . "A type of green fluorescent protein reporter gene assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T16:46:32Z"^^ . "GFP reporter gene assay evidence"^^ . "green fluorescent protein transcript localization evidence used in manual assertion"^^ . "eco"^^ . "GFP promoter fusion"^^ . "green fluorescent protein promoter fusion"^^ . "ECO:0005636"^^ . "green fluorescent protein reporter gene assay evidence used in manual assertion"^^ . _:genid3767 . _:genid3767 . _:genid3767 . _:genid3767 . _:genid3767 "true"^^ . _:genid3768 . _:genid3768 . _:genid3768 . _:genid3768 "A type of green fluorescent protein reporter gene assay evidence that is used in a manual assertion."^^ . _:genid3768 "ECO:SN"^^ . . _:genid3769 . _:genid3770 . _:genid3772 _:genid3771 . _:genid3770 _:genid3772 . _:genid3771 . _:genid3771 . _:genid3771 . _:genid3772 . _:genid3769 _:genid3770 . _:genid3769 . . . "IEA"^^ . "A type of green fluorescent protein reporter gene assay evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-06T16:48:29Z"^^ . "GFP reporter gene assay evidence"^^ . "green fluorescent protein transcript localization evidence used in automatic assertion"^^ . "eco"^^ . "GFP promoter fusion"^^ . "green fluorescent protein promoter fusion"^^ . "ECO:0005637"^^ . "green fluorescent protein reporter gene assay evidence used in automatic assertion"^^ . _:genid3773 . _:genid3773 . _:genid3773 . _:genid3773 . _:genid3773 "true"^^ . _:genid3774 . _:genid3774 . _:genid3774 . _:genid3774 "A type of green fluorescent protein reporter gene assay evidence that is used in an automatic assertion."^^ . _:genid3774 "ECO:SN"^^ . . _:genid3775 . _:genid3776 . _:genid3778 _:genid3777 . _:genid3776 _:genid3778 . _:genid3777 . _:genid3777 . _:genid3777 . _:genid3778 . _:genid3775 _:genid3776 . _:genid3775 . . . "IDA"^^ . "A type of cell growth regulation assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T16:52:15Z"^^ . "eco"^^ . "growth curve analysis"^^ . "ECO:0005638"^^ . "cell growth regulation assay evidence used in manual assertion"^^ . _:genid3779 . _:genid3779 . _:genid3779 . _:genid3779 . _:genid3779 "true"^^ . _:genid3780 . _:genid3780 . _:genid3780 . _:genid3780 "A type of cell growth regulation assay evidence that is used in a manual assertion."^^ . _:genid3780 "ECO:SN"^^ . . _:genid3781 . _:genid3782 . _:genid3784 _:genid3783 . _:genid3782 _:genid3784 . _:genid3783 . _:genid3783 . _:genid3783 . _:genid3784 . _:genid3781 _:genid3782 . _:genid3781 . . . "IEA"^^ . "A type of cell growth regulation assay evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-06T16:53:28Z"^^ . "eco"^^ . "growth curve analysis"^^ . "ECO:0005639"^^ . "cell growth regulation assay evidence used in automatic assertion"^^ . _:genid3785 . _:genid3785 . _:genid3785 . _:genid3785 . _:genid3785 "true"^^ . _:genid3786 . _:genid3786 . _:genid3786 . _:genid3786 "A type of cell growth regulation assay evidence that is used in an automatic assertion."^^ . _:genid3786 "ECO:SN"^^ . . _:genid3787 . _:genid3788 . _:genid3790 _:genid3789 . _:genid3788 _:genid3790 . _:genid3789 . _:genid3789 . _:genid3789 . _:genid3790 . _:genid3787 _:genid3788 . _:genid3787 . . . "IPI"^^ . "A type of glutathione S-transferase pull-down assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T16:56:39Z"^^ . "GST pull-down assay evidence"^^ . "eco"^^ . "ECO:0005640"^^ . "glutathione S-transferase pull-down assay evidence used in manual assertion"^^ . _:genid3791 . _:genid3791 . _:genid3791 . _:genid3791 . _:genid3791 "true"^^ . _:genid3792 . _:genid3792 . _:genid3792 . _:genid3792 "A type of glutathione S-transferase pull-down assay evidence that is used in a manual assertion."^^ . _:genid3792 "ECO:SN"^^ . . _:genid3793 . _:genid3794 . _:genid3796 _:genid3795 . _:genid3794 _:genid3796 . _:genid3795 . _:genid3795 . _:genid3795 . _:genid3796 . _:genid3793 _:genid3794 . _:genid3793 . . . "IEP"^^ . "A type of beta-glucuronidase reporter gene assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T16:58:29Z"^^ . "GUS reporter gene assay evidence"^^ . "eco"^^ . "ECO:0005641"^^ . "beta-glucuronidase reporter gene assay evidence used in manual assertion"^^ . _:genid3797 . _:genid3797 . _:genid3797 . _:genid3797 . _:genid3797 "true"^^ . _:genid3798 . _:genid3798 . _:genid3798 . _:genid3798 "A type of beta-glucuronidase reporter gene assay evidence that is used in a manual assertion."^^ . _:genid3798 "ECO:SN"^^ . . _:genid3799 . _:genid3800 . _:genid3802 _:genid3801 . _:genid3800 _:genid3802 . _:genid3801 . _:genid3801 . _:genid3801 . _:genid3802 . _:genid3799 _:genid3800 . _:genid3799 . . . "EXP"^^ . "A type of heteronuclear single quantum coherence spectroscopy evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T23:10:13Z"^^ . "HSQC evidence"^^ . "eco"^^ . "ECO:0005642"^^ . "heteronuclear single quantum coherence spectroscopy evidence used in manual assertion"^^ . _:genid3803 . _:genid3803 . _:genid3803 . _:genid3803 . _:genid3803 "true"^^ . _:genid3804 . _:genid3804 . _:genid3804 . _:genid3804 "A type of heteronuclear single quantum coherence spectroscopy evidence that is used in a manual assertion."^^ . _:genid3804 "ECO:SN"^^ . . _:genid3805 . _:genid3806 . _:genid3808 _:genid3807 . _:genid3806 _:genid3808 . _:genid3807 . _:genid3807 . _:genid3807 . _:genid3808 . _:genid3805 _:genid3806 . _:genid3805 . . . "IPI"^^ . "A type of hydroxyl-radical footprinting evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T23:14:48Z"^^ . "eco"^^ . "ECO:0005643"^^ . "hydroxyl-radical footprinting evidence used in manual assertion"^^ . _:genid3809 . _:genid3809 . _:genid3809 . _:genid3809 . _:genid3809 "true"^^ . _:genid3810 . _:genid3810 . _:genid3810 . _:genid3810 "A type of hydroxyl-radical footprinting evidence that is used in a manual assertion."^^ . _:genid3810 "ECO:SN"^^ . . _:genid3811 . _:genid3812 . _:genid3814 _:genid3813 . _:genid3812 _:genid3814 . _:genid3813 . _:genid3813 . _:genid3813 . _:genid3814 . _:genid3811 _:genid3812 . _:genid3811 . . . "IPI"^^ . "A type of immunoprecipitation evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T23:20:49Z"^^ . "immunoprecipitation"^^ . "eco"^^ . "ECO:0005644"^^ . "immunoprecipitation evidence used in manual assertion"^^ . _:genid3815 . _:genid3815 . _:genid3815 . _:genid3815 . _:genid3815 "true"^^ . _:genid3816 . _:genid3816 . _:genid3816 . _:genid3816 "A type of immunoprecipitation evidence that is used in a manual assertion."^^ . _:genid3816 "ECO:SN"^^ . . _:genid3817 . _:genid3818 . _:genid3820 _:genid3819 . _:genid3818 _:genid3820 . _:genid3819 . _:genid3819 . _:genid3819 . _:genid3820 . _:genid3817 _:genid3818 . _:genid3817 . . . "EXP"^^ . "A type of interferometric reflectance imaging sensor evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T23:27:58Z"^^ . "IRIS evidence"^^ . "SRIB evidence"^^ . "spectral reflectance imaging biosensor evidence"^^ . "eco"^^ . "ECO:0005645"^^ . "interferometric reflectance imaging sensor evidence used in manual assertion"^^ . _:genid3821 . _:genid3821 . _:genid3821 . _:genid3821 . _:genid3821 "true"^^ . _:genid3822 . _:genid3822 . _:genid3822 . _:genid3822 "A type of interferometric reflectance imaging sensor evidence that is used in a manual assertion."^^ . _:genid3822 "ECO:SN"^^ . . _:genid3823 . _:genid3824 . _:genid3826 _:genid3825 . _:genid3824 _:genid3826 . _:genid3825 . _:genid3825 . _:genid3825 . _:genid3826 . _:genid3823 _:genid3824 . _:genid3823 . . . "IEA"^^ . "A type of interferometric reflectance imaging sensor evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-06T23:29:23Z"^^ . "IRIS evidence"^^ . "SRIB evidence"^^ . "spectral reflectance imaging biosensor evidence"^^ . "eco"^^ . "ECO:0005646"^^ . "interferometric reflectance imaging sensor evidence used in automatic assertion"^^ . _:genid3827 . _:genid3827 . _:genid3827 . _:genid3827 . _:genid3827 "true"^^ . _:genid3828 . _:genid3828 . _:genid3828 . _:genid3828 "A type of interferometric reflectance imaging sensor evidence that is used in an automatic assertion."^^ . _:genid3828 "ECO:SN"^^ . . _:genid3829 . _:genid3830 . _:genid3832 _:genid3831 . _:genid3830 _:genid3832 . _:genid3831 . _:genid3831 . _:genid3831 . _:genid3832 . _:genid3829 _:genid3830 . _:genid3829 . . . "IPI"^^ . "A type of isothermal titration calorimetry evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T23:36:26Z"^^ . "ITC evidence"^^ . "eco"^^ . "ECO:0005647"^^ . "isothermal titration calorimetry evidence used in manual assertion"^^ . _:genid3833 . _:genid3833 . _:genid3833 . _:genid3833 . _:genid3833 "true"^^ . _:genid3834 . _:genid3834 . _:genid3834 . _:genid3834 "A type of isothermal titration calorimetry evidence that is used in a manual assertion."^^ . _:genid3834 "ECO:SN"^^ . . _:genid3835 . _:genid3836 . _:genid3838 _:genid3837 . _:genid3836 _:genid3838 . _:genid3837 . _:genid3837 . _:genid3837 . _:genid3838 . _:genid3835 _:genid3836 . _:genid3835 . . . "IEP"^^ . "A type of luciferase reporter gene assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T23:44:52Z"^^ . "eco"^^ . "ECO:0005648"^^ . "luciferase reporter gene assay evidence used in manual assertion"^^ . _:genid3839 . _:genid3839 . _:genid3839 . _:genid3839 . _:genid3839 "true"^^ . _:genid3840 . _:genid3840 . _:genid3840 . _:genid3840 "A type of luciferase reporter gene assay evidence that is used in a manual assertion."^^ . _:genid3840 "ECO:SN"^^ . . _:genid3841 . _:genid3842 . _:genid3844 _:genid3843 . _:genid3842 _:genid3844 . _:genid3843 . _:genid3843 . _:genid3843 . _:genid3844 . _:genid3841 _:genid3842 . _:genid3841 . . . "ISM"^^ . "A type of machine learning prediction of motif instance evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-06T23:51:30Z"^^ . "eco"^^ . "ECO:0005649"^^ . "machine learning prediction of motif instance evidence used in manual assertion"^^ . _:genid3845 . _:genid3845 . _:genid3845 . _:genid3845 . _:genid3845 "true"^^ . _:genid3846 . _:genid3846 . _:genid3846 . _:genid3846 "A type of machine learning prediction of motif instance evidence that is used in a manual assertion."^^ . _:genid3846 "ECO:SN"^^ . . _:genid3847 . _:genid3848 . _:genid3850 _:genid3849 . _:genid3848 _:genid3850 . _:genid3849 . _:genid3849 . _:genid3849 . _:genid3850 . _:genid3847 _:genid3848 . _:genid3847 . . . "IEA"^^ . "A type of machine learning prediction of motif instance evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-06T23:54:00Z"^^ . "eco"^^ . "ECO:0005650"^^ . "machine learning prediction of motif instance evidence used in automatic assertion"^^ . _:genid3851 . _:genid3851 . _:genid3851 . _:genid3851 . _:genid3851 "true"^^ . _:genid3852 . _:genid3852 . _:genid3852 . _:genid3852 "A type of machine learning prediction of motif instance evidence that is used in an automatic assertion."^^ . _:genid3852 "ECO:SN"^^ . . _:genid3853 . _:genid3854 . _:genid3856 _:genid3855 . _:genid3854 _:genid3856 . _:genid3855 . _:genid3855 . _:genid3855 . _:genid3856 . _:genid3853 _:genid3854 . _:genid3853 . . . "IEA"^^ . "A type of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-06T23:57:30Z"^^ . "MALDI-TOF mass spectrometry evidence"^^ . "MALDI-TOF-MS evidence"^^ . "eco"^^ . "ECO:0005651"^^ . "matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evidence used in automatic assertion"^^ . _:genid3857 . _:genid3857 . _:genid3857 . _:genid3857 . _:genid3857 "true"^^ . _:genid3858 . _:genid3858 . _:genid3858 . _:genid3858 "A type of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evidence that is used in an automatic assertion."^^ . _:genid3858 "ECO:SN"^^ . . _:genid3859 . _:genid3860 . _:genid3862 _:genid3861 . _:genid3860 _:genid3862 . _:genid3861 . _:genid3861 . _:genid3861 . _:genid3862 . _:genid3859 _:genid3860 . _:genid3859 . . . "IPI"^^ . "A type of methidiumpropyl-ethylenediaminetetraacetic acid iron (II) footprinting evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-09T14:42:28Z"^^ . "MPE-EDTA Fe(II) footprinting evidence"^^ . "Methidiumpropyl-EDTA Fe(II) footprinting evidence"^^ . "eco"^^ . "MPE Fe(II) footprinting"^^ . "ECO:0005652"^^ . "methidiumpropyl-ethylenediaminetetraacetic acid iron (II) footprinting evidence used in manual assertion"^^ . _:genid3863 . _:genid3863 . _:genid3863 . _:genid3863 . _:genid3863 "true"^^ . _:genid3864 . _:genid3864 . _:genid3864 . _:genid3864 "A type of methidiumpropyl-ethylenediaminetetraacetic acid iron (II) footprinting evidence that is used in a manual assertion."^^ . _:genid3864 "ECO:SN"^^ . . _:genid3865 . _:genid3866 . _:genid3868 _:genid3867 . _:genid3866 _:genid3868 . _:genid3867 . _:genid3867 . _:genid3867 . _:genid3868 . _:genid3865 _:genid3866 . _:genid3865 . . . "IEP"^^ . "A type of northern assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-09T14:48:03Z"^^ . "RNA blot evidence"^^ . "northern assay evidence"^^ . "eco"^^ . "transcript levels (e.g. Northerns)"^^ . "ECO:0005653"^^ . "northern assay evidence used in manual assertion"^^ . _:genid3869 . _:genid3869 . _:genid3869 . _:genid3869 . _:genid3869 "true"^^ . _:genid3870 . _:genid3870 . _:genid3870 . _:genid3870 "A type of northern assay evidence that is used in a manual assertion."^^ . _:genid3870 "ECO:SN"^^ . . _:genid3871 . _:genid3872 . _:genid3874 _:genid3873 . _:genid3872 _:genid3874 . _:genid3873 . _:genid3873 . _:genid3873 . _:genid3874 . _:genid3871 _:genid3872 . _:genid3871 . . . "ISA"^^ . "A type of phylogenetic footprinting evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-09T14:50:52Z"^^ . "eco"^^ . "ECO:0005654"^^ . "phylogenetic footprinting evidence used in manual assertion"^^ . _:genid3875 . _:genid3875 . _:genid3875 . _:genid3875 . _:genid3875 "true"^^ . _:genid3876 . _:genid3876 . _:genid3876 . _:genid3876 "A type of phylogenetic footprinting evidence that is used in a manual assertion."^^ . _:genid3876 "ECO:SN"^^ . . _:genid3877 . _:genid3878 . _:genid3880 _:genid3879 . _:genid3878 _:genid3880 . _:genid3879 . _:genid3879 . _:genid3879 . _:genid3880 . _:genid3877 _:genid3878 . _:genid3877 . . . "IEA"^^ . "A type of phylogenetic footprinting evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-09T14:51:55Z"^^ . "eco"^^ . "ECO:0005655"^^ . "phylogenetic footprinting evidence used in automatic assertion"^^ . _:genid3881 . _:genid3881 . _:genid3881 . _:genid3881 . _:genid3881 "true"^^ . _:genid3882 . _:genid3882 . _:genid3882 . _:genid3882 "A type of phylogenetic footprinting evidence that is used in an automatic assertion."^^ . _:genid3882 "ECO:SN"^^ . . _:genid3883 . _:genid3884 . _:genid3886 _:genid3885 . _:genid3884 _:genid3886 . _:genid3885 . _:genid3885 . _:genid3885 . _:genid3886 . _:genid3883 _:genid3884 . _:genid3883 . . . "IPI"^^ . "A type of methylation interference footprinting evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-09T14:55:25Z"^^ . "premethylation interference footprinting evidence used in manual assertion"^^ . "eco"^^ . "ECO:0005656"^^ . "methylation interference footprinting evidence used in manual assertion"^^ . _:genid3887 . _:genid3887 . _:genid3887 . _:genid3887 . _:genid3887 "true"^^ . _:genid3888 . _:genid3888 . _:genid3888 . _:genid3888 "A type of methylation interference footprinting evidence that is used in a manual assertion."^^ . _:genid3888 "ECO:SN"^^ . . _:genid3889 . _:genid3890 . _:genid3892 _:genid3891 . _:genid3890 _:genid3892 . _:genid3891 . _:genid3891 . _:genid3891 . _:genid3892 . _:genid3889 _:genid3890 . _:genid3889 . . . "IEP"^^ . "A type of primer extension assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-09T14:58:38Z"^^ . "eco"^^ . "ECO:0005657"^^ . "primer extension assay evidence used in manual assertion"^^ . _:genid3893 . _:genid3893 . _:genid3893 . _:genid3893 . _:genid3893 "true"^^ . _:genid3894 . _:genid3894 . _:genid3894 . _:genid3894 "A type of primer extension assay evidence that is used in a manual assertion."^^ . _:genid3894 "ECO:SN"^^ . . _:genid3895 . _:genid3896 . _:genid3898 _:genid3897 . _:genid3896 _:genid3898 . _:genid3897 . _:genid3897 . _:genid3897 . _:genid3898 . _:genid3895 _:genid3896 . _:genid3895 . . . "ISM"^^ . "A type of position-specific scoring matrix motif search evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-09T15:01:31Z"^^ . "PSSM motif search evidence"^^ . "eco"^^ . "ECO:0005658"^^ . "position-specific scoring matrix motif search evidence used in manual assertion"^^ . _:genid3899 . _:genid3899 . _:genid3899 . _:genid3899 . _:genid3899 "true"^^ . _:genid3900 . _:genid3900 . _:genid3900 . _:genid3900 "A type of position-specific scoring matrix motif search evidence that is used in a manual assertion."^^ . _:genid3900 "ECO:SN"^^ . . _:genid3901 . _:genid3902 . _:genid3904 _:genid3903 . _:genid3902 _:genid3904 . _:genid3903 . _:genid3903 . _:genid3903 . _:genid3904 . _:genid3901 _:genid3902 . _:genid3901 . . . "IEA"^^ . "A type of position-specific scoring matrix motif search evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-09T15:02:31Z"^^ . "PSSM motif search evidence"^^ . "eco"^^ . "ECO:0005659"^^ . "position-specific scoring matrix motif search evidence used in automatic assertion"^^ . _:genid3905 . _:genid3905 . _:genid3905 . _:genid3905 . _:genid3905 "true"^^ . _:genid3906 . _:genid3906 . _:genid3906 . _:genid3906 "A type of position-specific scoring matrix motif search evidence that is used in an automatic assertion."^^ . _:genid3906 "ECO:SN"^^ . . _:genid3907 . _:genid3908 . _:genid3910 _:genid3909 . _:genid3908 _:genid3910 . _:genid3909 . _:genid3909 . _:genid3909 . _:genid3910 . _:genid3907 _:genid3908 . _:genid3907 . . . "EXP"^^ . "A type of quantitative polymerase chain reaction evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-09T15:09:01Z"^^ . "eco"^^ . "ECO:0005660"^^ . "quantitative polymerase chain reaction evidence used in manual assertion"^^ . _:genid3911 . _:genid3911 . _:genid3911 . _:genid3911 . _:genid3911 "true"^^ . _:genid3912 . _:genid3912 . _:genid3912 . _:genid3912 "A type of quantitative polymerase chain reaction evidence that is used in a manual assertion."^^ . _:genid3912 "ECO:SN"^^ . . _:genid3913 . _:genid3914 . _:genid3916 _:genid3915 . _:genid3914 _:genid3916 . _:genid3915 . _:genid3915 . _:genid3915 . _:genid3916 . _:genid3913 _:genid3914 . _:genid3913 . . . "EXP"^^ . "A type of rapid amplification of cDNA ends polymerase chain reaction evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-09T15:19:20Z"^^ . "RACE PCR evidence"^^ . "eco"^^ . "ECO:0005661"^^ . "rapid amplification of cDNA ends polymerase chain reaction evidence used in manual assertion"^^ . _:genid3917 . _:genid3917 . _:genid3917 . _:genid3917 . _:genid3917 "true"^^ . _:genid3918 . _:genid3918 . _:genid3918 . _:genid3918 "A type of rapid amplification of cDNA ends polymerase chain reaction evidence that is used in a manual assertion."^^ . _:genid3918 "ECO:SN"^^ . . _:genid3919 . _:genid3920 . _:genid3922 _:genid3921 . _:genid3920 _:genid3922 . _:genid3921 . _:genid3921 . _:genid3921 . _:genid3922 . _:genid3919 _:genid3920 . _:genid3919 . . . "ISM"^^ . "A type of regular expression motif search evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-09T16:13:55Z"^^ . "eco"^^ . "ECO:0005662"^^ . "regular expression motif search evidence used in manual assertion"^^ . _:genid3923 . _:genid3923 . _:genid3923 . _:genid3923 . _:genid3923 "true"^^ . _:genid3924 . _:genid3924 . _:genid3924 . _:genid3924 "A type of regular expression motif search evidence that is used in a manual assertion."^^ . _:genid3924 "ECO:SN"^^ . . _:genid3925 . _:genid3926 . _:genid3928 _:genid3927 . _:genid3926 _:genid3928 . _:genid3927 . _:genid3927 . _:genid3927 . _:genid3928 . _:genid3925 _:genid3926 . _:genid3925 . . . "IEA"^^ . "A type of regular expression motif search evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-09T16:15:03Z"^^ . "eco"^^ . "ECO:0005663"^^ . "regular expression motif search evidence used in automatic assertion"^^ . _:genid3929 . _:genid3929 . _:genid3929 . _:genid3929 . _:genid3929 "true"^^ . _:genid3930 . _:genid3930 . _:genid3930 . _:genid3930 "A type of regular expression motif search evidence that is used in an automatic assertion."^^ . _:genid3930 "ECO:SN"^^ . . "snadendla"^^ . "2016-05-09T16:18:35Z"^^ . "eco"^^ . "ECO:0005664"^^ . "Use ECO:0006068 (RNA-seq evidence used in manual assertion) in place of this term."^^ . "RNA sequencing assay evidence used in manual assertion"^^ . "true"^^ . . "snadendla"^^ . "2016-05-09T16:19:38Z"^^ . "eco"^^ . "ECO:0005665"^^ . "Use ECO:0006069 (RNA-seq evidence used in automatic assertion) in place of this term."^^ . "RNA sequencing assay evidence used in automatic assertion"^^ . "true"^^ . . _:genid3931 . _:genid3932 . _:genid3934 _:genid3933 . _:genid3932 _:genid3934 . _:genid3933 . _:genid3933 . _:genid3933 . _:genid3934 . _:genid3931 _:genid3932 . _:genid3931 . . . "EXP"^^ . "A type of S1 nuclease protection assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-09T16:22:58Z"^^ . "eco"^^ . "ECO:0005666"^^ . "S1 nuclease protection assay evidence used in manual assertion"^^ . _:genid3935 . _:genid3935 . _:genid3935 . _:genid3935 . _:genid3935 "true"^^ . _:genid3936 . _:genid3936 . _:genid3936 . _:genid3936 "A type of S1 nuclease protection assay evidence that is used in a manual assertion."^^ . _:genid3936 "ECO:SN"^^ . . _:genid3937 . _:genid3938 . _:genid3940 _:genid3939 . _:genid3938 _:genid3940 . _:genid3939 . _:genid3939 . _:genid3939 . _:genid3940 . _:genid3937 _:genid3938 . _:genid3937 . . . "IMP"^^ . "A type of site-directed phenotypic mutagenesis evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-09T16:29:13Z"^^ . "site directed mutagenesis evidence"^^ . "site-directed mutagenesis evidence used in manual assertion"^^ . "eco"^^ . "ECO:0005667"^^ . "site-directed mutagenesis phenotypic evidence used in manual assertion"^^ . _:genid3941 . _:genid3941 . _:genid3941 . _:genid3941 . _:genid3941 "true"^^ . _:genid3942 . _:genid3942 . _:genid3942 . _:genid3942 "A type of site-directed phenotypic mutagenesis evidence that is used in a manual assertion."^^ . _:genid3942 "ECO:SN"^^ . . _:genid3943 . _:genid3944 . _:genid3946 _:genid3945 . _:genid3944 _:genid3946 . _:genid3945 . _:genid3945 . _:genid3945 . _:genid3946 . _:genid3943 _:genid3944 . _:genid3943 . . . "IMP"^^ . "A type of survival rate analysis evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-09T16:31:08Z"^^ . "eco"^^ . "ECO:0005668"^^ . "survival rate analysis evidence used in manual assertion"^^ . _:genid3947 . _:genid3947 . _:genid3947 . _:genid3947 . _:genid3947 "true"^^ . _:genid3948 . _:genid3948 . _:genid3948 . _:genid3948 "A type of survival rate analysis evidence that is used in a manual assertion."^^ . _:genid3948 "ECO:SN"^^ . . _:genid3949 . _:genid3950 . _:genid3952 _:genid3951 . _:genid3950 _:genid3952 . _:genid3951 . _:genid3951 . _:genid3951 . _:genid3952 . _:genid3949 _:genid3950 . _:genid3949 . . . "IPI"^^ . "A type of ultraviolet light footprinting evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-09T16:33:44Z"^^ . "eco"^^ . "UV footprinting"^^ . "ECO:0005669"^^ . "ultraviolet light footprinting evidence used in manual assertion"^^ . _:genid3953 . _:genid3953 . _:genid3953 . _:genid3953 . _:genid3953 "true"^^ . _:genid3954 . _:genid3954 . _:genid3954 . _:genid3954 "A type of ultraviolet light footprinting evidence that is used in a manual assertion."^^ . _:genid3954 "ECO:SN"^^ . . _:genid3955 . _:genid3956 . _:genid3958 _:genid3957 . _:genid3956 _:genid3958 . _:genid3957 . _:genid3957 . _:genid3957 . _:genid3958 . _:genid3955 _:genid3956 . _:genid3955 . . . "EXP"^^ . "A type of x-ray crystallography evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-10T11:53:00Z"^^ . "eco"^^ . "ECO:0005670"^^ . "x-ray crystallography evidence used in manual assertion"^^ . _:genid3959 . _:genid3959 . _:genid3959 . _:genid3959 . _:genid3959 "true"^^ . _:genid3960 . _:genid3960 . _:genid3960 . _:genid3960 "A type of x-ray crystallography evidence that is used in a manual assertion."^^ . _:genid3960 "ECO:SN"^^ . . _:genid3961 . _:genid3962 . _:genid3964 _:genid3963 . _:genid3962 _:genid3964 . _:genid3963 . _:genid3963 . _:genid3963 . _:genid3964 . _:genid3961 _:genid3962 . _:genid3961 . . . "IEA"^^ . "A type of x-ray crystallography evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "2016-05-10T11:54:03Z"^^ . "eco"^^ . "ECO:0005671"^^ . "x-ray crystallography evidence used in automatic assertion"^^ . _:genid3965 . _:genid3965 . _:genid3965 . _:genid3965 . _:genid3965 "true"^^ . _:genid3966 . _:genid3966 . _:genid3966 . _:genid3966 "A type of x-ray crystallography evidence that is used in an automatic assertion."^^ . _:genid3966 "ECO:SN"^^ . . _:genid3967 . _:genid3968 . _:genid3970 _:genid3969 . _:genid3968 _:genid3970 . _:genid3969 . _:genid3969 . _:genid3969 . _:genid3970 . _:genid3967 _:genid3968 . _:genid3967 . . . "IEP"^^ . "A type of xylE reporter gene assay evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-10T11:57:15Z"^^ . "eco"^^ . "ECO:0005672"^^ . "xylE reporter gene assay evidence used in manual assertion"^^ . _:genid3971 . _:genid3971 . _:genid3971 . _:genid3971 . _:genid3971 "true"^^ . _:genid3972 . _:genid3972 . _:genid3972 . _:genid3972 "A type of xylE reporter gene assay evidence that is used in a manual assertion."^^ . _:genid3972 "ECO:SN"^^ . . . "A type of experimental phenotypic evidence where a non-standard trait (e.g. natural competence) is assessed qualitatively (e.g. presence/absence) and used as a natural reporter to conclude that some genes or pathways are regulated by the transcription factor."^^ . "CollecTF"^^ . "snadendla"^^ . "2016-05-10T12:57:41Z"^^ . "eco"^^ . "ECO:0005673"^^ . "ad-hoc qualitative phenotype observation evidence"^^ . _:genid3973 . _:genid3973 . _:genid3973 . _:genid3973 "A type of experimental phenotypic evidence where a non-standard trait (e.g. natural competence) is assessed qualitatively (e.g. presence/absence) and used as a natural reporter to conclude that some genes or pathways are regulated by the transcription factor."^^ . _:genid3973 "ECO:SN"^^ . _:genid3973 "PMID:15150239"^^ . . _:genid3974 . _:genid3975 . _:genid3977 _:genid3976 . _:genid3975 _:genid3977 . _:genid3976 . _:genid3976 . _:genid3976 . _:genid3977 . _:genid3974 _:genid3975 . _:genid3974 . . . "EXP"^^ . "A type of ad-hoc qualitative phenotype observation that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-10T14:28:47Z"^^ . "eco"^^ . "ECO:0005674"^^ . "ad-hoc qualitative phenotype observation evidence used in manual assertion"^^ . _:genid3978 . _:genid3978 . _:genid3978 . _:genid3978 . _:genid3978 "true"^^ . _:genid3979 . _:genid3979 . _:genid3979 . _:genid3979 "A type of ad-hoc qualitative phenotype observation that is used in a manual assertion."^^ . _:genid3979 "ECO:SN"^^ . . . "A type of experimental phenotypic evidence where a quantifiable phenotypic trait (e.g. glucose intake) is assessed in a quantitative manner after induction of the regulatory mechanism and used as a natural reporter to conclude that some genes or pathways are regulated by the transcription factor."^^ . "CollecTF"^^ . "snadendla"^^ . "2016-05-10T14:30:50Z"^^ . "eco"^^ . "ECO:0005675"^^ . "ad-hoc quantitative phenotype observation evidence"^^ . _:genid3980 . _:genid3980 . _:genid3980 . _:genid3980 "A type of experimental phenotypic evidence where a quantifiable phenotypic trait (e.g. glucose intake) is assessed in a quantitative manner after induction of the regulatory mechanism and used as a natural reporter to conclude that some genes or pathways are regulated by the transcription factor."^^ . _:genid3980 "ECO:SN"^^ . _:genid3980 "PMID:15150239"^^ . . _:genid3981 . _:genid3982 . _:genid3984 _:genid3983 . _:genid3982 _:genid3984 . _:genid3983 . _:genid3983 . _:genid3983 . _:genid3984 . _:genid3981 _:genid3982 . _:genid3981 . . . "EXP"^^ . "A type of ad-hoc quantitative phenotype observation evidence that is used in a manual assertion."^^ . "snadendla"^^ . "2016-05-10T14:34:50Z"^^ . "eco"^^ . "ECO:0005676"^^ . "ad-hoc quantitative phenotype observation evidence used in manual assertion"^^ . _:genid3985 . _:genid3985 . _:genid3985 . _:genid3985 . _:genid3985 "true"^^ . _:genid3986 . _:genid3986 . _:genid3986 . _:genid3986 "A type of ad-hoc quantitative phenotype observation evidence that is used in a manual assertion."^^ . _:genid3986 "ECO:SN"^^ . . . "A type of direct assay evidence where the activity of a solution is determined by exposing an indicator culture or organism to a series of dilutions and determining the lowest concentration that elicits a biological response."^^ . "critical dilution assay" . "spot assay" . "For chemicals, bacteriocins, or phage, the indicator culture is typically present in a soft-agar layer on top of nutrient agar and a small quantity of each dilution is spotted onto the soft agar overlay." . "dilution assay evidence"@en . _:genid3987 . _:genid3987 . _:genid3987 . _:genid3987 "A type of direct assay evidence where the activity of a solution is determined by exposing an indicator culture or organism to a series of dilutions and determining the lowest concentration that elicits a biological response."^^ . _:genid3987 "http://www.sciencedirect.com/science/article/pii/016770129400068I" . . _:genid3988 . _:genid3989 . _:genid3991 _:genid3990 . _:genid3989 _:genid3991 . _:genid3990 . _:genid3990 . _:genid3990 . _:genid3991 . _:genid3988 _:genid3989 . _:genid3988 . . . "IDA"^^ . "A type of enzyme assay evidence that is used in a manual assertion."^^ . "enzyme assays"^^ . "eco"^^ . "ECO:0005801"^^ . "enzymatic activity assay evidence used in manual assertion"@en . _:genid3992 . _:genid3992 . _:genid3992 . _:genid3992 . _:genid3992 "true"^^ . _:genid3993 . _:genid3993 . _:genid3993 . _:genid3993 "A type of enzyme assay evidence that is used in a manual assertion."^^ . _:genid3993 "ECO:SN"^^ . . _:genid3994 . _:genid3995 . _:genid3997 _:genid3996 . _:genid3995 _:genid3997 . _:genid3996 . _:genid3996 . _:genid3996 . _:genid3997 . _:genid3994 _:genid3995 . _:genid3994 . . . "EXP"^^ . "A type of cell transfection experiment evidence that is used in a manual assertion."^^ . "eco"^^ . "ECO:0005802"^^ . "cell transfection experiment evidence used in manual assertion"@en . _:genid3998 . _:genid3998 . _:genid3998 . _:genid3998 . _:genid3998 "true"^^ . _:genid3999 . _:genid3999 . _:genid3999 . _:genid3999 "A type of cell transfection experiment evidence that is used in a manual assertion."^^ . _:genid3999 "ECO:SN"^^ . . . "A motility assay at 37 degrees C revealed a non-motile phenotype for all strains, as expected (data not shown)."^^ . "A type of direct assay evidence where the motility of a cell or cells is determined."^^ . "eco"^^ . "ECO:0005803"^^ . "motility assay evidence"^^ . _:genid4000 . _:genid4000 . _:genid4000 . _:genid4000 "A motility assay at 37 degrees C revealed a non-motile phenotype for all strains, as expected (data not shown)."^^ . _:genid4000 "PMID:20830609"^^ . _:genid4001 . _:genid4001 . _:genid4001 . _:genid4001 "A type of direct assay evidence where the motility of a cell or cells is determined."^^ . _:genid4001 "ECO:SN"^^ . . _:genid4002 . _:genid4003 . _:genid4005 _:genid4004 . _:genid4003 _:genid4005 . _:genid4004 . _:genid4004 . _:genid4004 . _:genid4005 . _:genid4002 _:genid4003 . _:genid4002 . . . "EXP"^^ . "A type of immunofluorescence evidence that is used in a manual assertion."^^ . "immunofluorescence"^^ . "eco"^^ . "ECO:0005804"^^ . "immunofluorescence evidence used in manual assertion"^^ . _:genid4006 . _:genid4006 . _:genid4006 . _:genid4006 . _:genid4006 "true"^^ . _:genid4007 . _:genid4007 . _:genid4007 . _:genid4007 "A type of immunofluorescence evidence that is used in a manual assertion."^^ . _:genid4007 "ECO:SN"^^ . . _:genid4008 . _:genid4009 . _:genid4011 _:genid4010 . _:genid4009 _:genid4011 . _:genid4010 . _:genid4010 . _:genid4010 . _:genid4011 . _:genid4008 _:genid4009 . _:genid4008 . . . "IPI"^^ . "A type of yeast 2-hybrid evidence that is used in a manual assertion."^^ . "yeast two-hybrid assay"^^ . "eco"^^ . "ECO:0005805"^^ . "yeast 2-hybrid evidence used in manual assertion"^^ . _:genid4012 . _:genid4012 . _:genid4012 . _:genid4012 . _:genid4012 "true"^^ . _:genid4013 . _:genid4013 . _:genid4013 . _:genid4013 "A type of yeast 2-hybrid evidence that is used in a manual assertion."^^ . _:genid4013 "ECO:SN"^^ . . . . "A type of evidence derived from exploiting the CyaA (calmodulin-activated adenylate cyclase toxin) secreted by Bordatella pertussis to synthesize cAMP and alter cellular physiology in a host cell for various biological applications."^^ . "rctauber"^^ . "2016-06-15T08:42:16Z"^^ . "eco"^^ . "ECO:0006001"^^ . "Cya fusion reporter assay evidence"^^ . _:genid4014 . _:genid4014 . _:genid4014 . _:genid4014 "A type of evidence derived from exploiting the CyaA (calmodulin-activated adenylate cyclase toxin) secreted by Bordatella pertussis to synthesize cAMP and alter cellular physiology in a host cell for various biological applications."^^ . _:genid4014 "PMID:10217833"^^ . _:genid4014 "PMID:14702323"^^ . . _:genid4015 . _:genid4016 . _:genid4018 _:genid4017 . _:genid4016 _:genid4018 . _:genid4017 . _:genid4017 . _:genid4017 . _:genid4018 . _:genid4015 _:genid4016 . _:genid4015 . . . . "IEP"^^ . "A type of Cya fusion reporter assay evidence that is used in a manual assertion."^^ . "CollecTF"^^ . "rctauber"^^ . "2010-06-15T08:44:10Z"^^ . "eco"^^ . "ECO:0006002"^^ . "Cya fusion reporter assay evidence used in manual assertion"^^ . _:genid4019 . _:genid4019 . _:genid4019 . _:genid4019 . _:genid4019 "true"^^ . _:genid4020 . _:genid4020 . _:genid4020 . _:genid4020 . _:genid4020 "true"^^ . _:genid4021 . _:genid4021 . _:genid4021 . _:genid4021 "A type of Cya fusion reporter assay evidence that is used in a manual assertion."^^ . _:genid4021 "ECO:RCT"^^ . . _:genid4022 . _:genid4023 . _:genid4025 _:genid4024 . _:genid4023 _:genid4025 . _:genid4024 . _:genid4024 . _:genid4024 . _:genid4025 . _:genid4022 _:genid4023 . _:genid4022 . . . "IDA"^^ . "A type of electron microscopy evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-10-12T12:32:29Z"^^ . "eco"^^ . "ECO:0006003"^^ . "electron microscopy evidence used in manual assertion"^^ . _:genid4026 . _:genid4026 . _:genid4026 . _:genid4026 . _:genid4026 "true"^^ . _:genid4027 . _:genid4027 . _:genid4027 . _:genid4027 "A type of electron microscopy evidence that is used in a manual assertion."^^ . _:genid4027 "ECO:RCT"^^ . . _:genid4028 . _:genid4029 . _:genid4031 _:genid4030 . _:genid4029 _:genid4031 . _:genid4030 . _:genid4030 . _:genid4030 . _:genid4031 . _:genid4028 _:genid4029 . _:genid4028 . . . "IDA"^^ . "A type of super-resolution microscopy evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-10-12T12:32:29Z"^^ . "eco"^^ . "ECO:0006004"^^ . "super-resolution microscopy evidence used in manual assertion"^^ . _:genid4032 . _:genid4032 . _:genid4032 . _:genid4032 . _:genid4032 "true"^^ . _:genid4033 . _:genid4033 . _:genid4033 . _:genid4033 "A type of super-resolution microscopy evidence that is used in a manual assertion."^^ . _:genid4033 "ECO:RCT"^^ . . _:genid4034 . _:genid4035 . _:genid4037 _:genid4036 . _:genid4035 _:genid4037 . _:genid4036 . _:genid4036 . _:genid4036 . _:genid4037 . _:genid4034 _:genid4035 . _:genid4034 . . . "IDA"^^ . "A type of fractionation evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-10-12T12:32:29Z"^^ . "eco"^^ . "ECO:0006005"^^ . "fractionation evidence used in manual assertion"^^ . _:genid4038 . _:genid4038 . _:genid4038 . _:genid4038 . _:genid4038 "true"^^ . _:genid4039 . _:genid4039 . _:genid4039 . _:genid4039 "A type of fractionation evidence that is used in a manual assertion."^^ . _:genid4039 "ECO:RCT"^^ . . _:genid4040 . _:genid4041 . _:genid4043 _:genid4042 . _:genid4041 _:genid4043 . _:genid4042 . _:genid4042 . _:genid4042 . _:genid4043 . _:genid4040 _:genid4041 . _:genid4040 . . . "IDA"^^ . "A type of electrophysiology assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-10-12T12:32:29Z"^^ . "eco"^^ . "ECO:0006006"^^ . "electrophysiology assay evidence used in manual assertion"^^ . _:genid4044 . _:genid4044 . _:genid4044 . _:genid4044 . _:genid4044 "true"^^ . _:genid4045 . _:genid4045 . _:genid4045 . _:genid4045 "A type of electrophysiology assay evidence that is used in a manual assertion."^^ . _:genid4045 "ECO:RCT"^^ . . _:genid4046 . _:genid4047 . _:genid4049 _:genid4048 . _:genid4047 _:genid4049 . _:genid4048 . _:genid4048 . _:genid4048 . _:genid4049 . _:genid4046 _:genid4047 . _:genid4046 . . . "IPI"^^ . "A type of chromatin immunoprecipitation-chip evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-10-21T11:55:53Z"^^ . "ChIP-chip evidence"^^ . "ChIP-on-chip evidence"^^ . "eco"^^ . "ECO:0006007"^^ . "chromatin immunoprecipitation-chip evidence used in manual assertion"^^ . _:genid4050 . _:genid4050 . _:genid4050 . _:genid4050 . _:genid4050 "true"^^ . _:genid4051 . _:genid4051 . _:genid4051 . _:genid4051 "A type of chromatin immunoprecipitation-chip evidence that is used in a manual assertion."^^ . _:genid4051 "ECO:RCT"^^ . . _:genid4052 . _:genid4053 . _:genid4055 _:genid4054 . _:genid4053 _:genid4055 . _:genid4054 . _:genid4054 . _:genid4054 . _:genid4055 . _:genid4052 _:genid4053 . _:genid4052 . . . "IPI"^^ . "A type of chromatin immunoprecipitation- exonuclease evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-10-21T11:55:53Z"^^ . "ChIP-exo"^^ . "eco"^^ . "ECO:0006008"^^ . "chromatin immunoprecipitation- exonuclease evidence used in manual assertion"^^ . _:genid4056 . _:genid4056 . _:genid4056 . _:genid4056 . _:genid4056 "true"^^ . _:genid4057 . _:genid4057 . _:genid4057 . _:genid4057 "A type of chromatin immunoprecipitation- exonuclease evidence that is used in a manual assertion."^^ . _:genid4057 "ECO:RCT"^^ . . _:genid4058 . _:genid4059 . _:genid4061 _:genid4060 . _:genid4059 _:genid4061 . _:genid4060 . _:genid4060 . _:genid4060 . _:genid4061 . _:genid4058 _:genid4059 . _:genid4058 . . . "IPI"^^ . "A type of chromatin immunoprecipitation-seq evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-10-21T11:55:53Z"^^ . "ChIP-SEQ evidence"^^ . "ChIP-seq evidence"^^ . "eco"^^ . "ECO:0006009"^^ . "chromatin immunoprecipitation-seq evidence used in manual assertion"^^ . _:genid4062 . _:genid4062 . _:genid4062 . _:genid4062 . _:genid4062 "true"^^ . _:genid4063 . _:genid4063 . _:genid4063 . _:genid4063 "A type of chromatin immunoprecipitation-seq evidence that is used in a manual assertion."^^ . _:genid4063 "ECO:RCT"^^ . . . _:genid4064 . _:genid4064 . _:genid4064 . _:genid4064 . "A type of nucleic acid binding evidence in which RNA-binding proteins are identified through cross-linking RNA and proteins by UV light, capturing RNA-protein complexes on oligo(dT) beads, and finally identifying by mass spectrometry."^^ . "rctauber"^^ . "2016-10-21T12:28:17Z"^^ . "ultraviolet light cross-linking RNA binding evidence"^^ . "eco"^^ . "ECO:0006010"^^ . "mRNA interactome capture evidence"^^ . _:genid4065 . _:genid4065 . _:genid4065 . _:genid4065 "A type of nucleic acid binding evidence in which RNA-binding proteins are identified through cross-linking RNA and proteins by UV light, capturing RNA-protein complexes on oligo(dT) beads, and finally identifying by mass spectrometry."^^ . _:genid4065 "PMID:27729395"^^ . . _:genid4066 . _:genid4067 . _:genid4069 _:genid4068 . _:genid4067 _:genid4069 . _:genid4068 . _:genid4068 . _:genid4068 . _:genid4069 . _:genid4066 _:genid4067 . _:genid4066 . . . "IPI"^^ . "A type of mRNA interactome capture evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-10-21T12:28:17Z"^^ . "ultraviolet light cross-linking RNA binding evidence"^^ . "eco"^^ . "ECO:0006011"^^ . "mRNA interactome capture evidence used in manual assertion"^^ . _:genid4070 . _:genid4070 . _:genid4070 . _:genid4070 . _:genid4070 "true"^^ . _:genid4071 . _:genid4071 . _:genid4071 . _:genid4071 "A type of mRNA interactome capture evidence that is used in a manual assertion."^^ . _:genid4071 "ECO:RCT"^^ . . . _:genid4072 . _:genid4072 . _:genid4072 . _:genid4072 . _:genid4073 . _:genid4073 . _:genid4073 . _:genid4073 . "A type of electrophysiology assay evidence in which a glass micropipette is sealed to the surface of a cell membrane (patch) to study ion channels."^^ . "rctauber"^^ . "2016-11-28T11:44:05Z"^^ . "eco"^^ . "ECO:0006012"^^ . "patch-clamp recording evidence"^^ . _:genid4074 . _:genid4074 . _:genid4074 . _:genid4074 "A type of electrophysiology assay evidence in which a glass micropipette is sealed to the surface of a cell membrane (patch) to study ion channels."^^ . _:genid4074 "ECO:RCT"^^ . . _:genid4075 . _:genid4076 . _:genid4078 _:genid4077 . _:genid4076 _:genid4078 . _:genid4077 . _:genid4077 . _:genid4077 . _:genid4078 . _:genid4075 _:genid4076 . _:genid4075 . . . "IDA"^^ . "A type of patch-clamp recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-11-28T11:44:05Z"^^ . "eco"^^ . "ECO:0006013"^^ . "patch-clamp recording evidence used in manual assertion"^^ . _:genid4079 . _:genid4079 . _:genid4079 . _:genid4079 "A type of patch-clamp recording evidence that is used in a manual assertion."^^ . _:genid4079 "ECO:RCT"^^ . . . _:genid4080 . _:genid4080 . _:genid4080 . _:genid4080 . "A type of patch-clamp recording evidence in which a glass micropipette filled with a prepared solution is used to form a seal with the cell membrane followed by rupture of membrane to provide accurate and high resolution electrical property measurements of the whole cell."^^ . "rctauber"^^ . "2016-11-28T11:44:05Z"^^ . "eco"^^ . "ECO:0006014"^^ . "whole-cell patch-clamp recording evidence"^^ . _:genid4081 . _:genid4081 . _:genid4081 . _:genid4081 "A type of patch-clamp recording evidence in which a glass micropipette filled with a prepared solution is used to form a seal with the cell membrane followed by rupture of membrane to provide accurate and high resolution electrical property measurements of the whole cell."^^ . _:genid4081 "PMID:27341060"^^ . . _:genid4082 . _:genid4083 . _:genid4085 _:genid4084 . _:genid4083 _:genid4085 . _:genid4084 . _:genid4084 . _:genid4084 . _:genid4085 . _:genid4082 _:genid4083 . _:genid4082 . . . "IDA"^^ . "A type of whole-cell patch-clamp recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-11-28T11:44:05Z"^^ . "eco"^^ . "ECO:0006015"^^ . "whole-cell patch-clamp recording evidence used in manual assertion"^^ . _:genid4086 . _:genid4086 . _:genid4086 . _:genid4086 "A type of whole-cell patch-clamp recording evidence that is used in a manual assertion."^^ . _:genid4086 "ECO:RCT"^^ . . . "A type of traceable author statement that is based on a publication about a clinical study."^^ . "rctauber"^^ . "2016-11-30T09:44:47Z"^^ . "published clinical study evidence"^^ . "eco"^^ . "traceable author statement from published clinical study"^^ . "ECO:0006016"^^ . "author statement from published clinical study"^^ . . _:genid4087 . _:genid4088 . _:genid4090 _:genid4089 . _:genid4088 _:genid4090 . _:genid4089 . _:genid4089 . _:genid4089 . _:genid4090 . _:genid4087 _:genid4088 . _:genid4087 . . . "TAS"^^ . "A type of author statement from published clinical study that is used in a manual assertion."^^ . "rctauber"^^ . "2016-11-30T09:44:47Z"^^ . "published clinical study evidence"^^ . "PCS"^^ . "eco"^^ . "ECO:0006017"^^ . "Created and used by the Human Phenotype Ontology (HPO) Annotations group. Here it is used when evidence for an HPO annotation is information extracted from articles in the medical literature."^^ . "author statement from published clinical study used in manual assertion"^^ . "http://human-phenotype-ontology.github.io/documentation.html#annot"^^ . _:genid4091 . _:genid4091 . _:genid4091 . _:genid4091 . _:genid4091 "true"^^ . _:genid4092 . _:genid4092 . _:genid4092 . _:genid4092 "PCS"^^ . _:genid4092 "HPO:PCS"^^ . . . "A type of curator inference that is based on the individual clinical experience of a clinician"^^ . "rctauber"^^ . "2016-11-30T09:44:47Z"^^ . "individual clinical experience evidence"^^ . "eco"^^ . "ECO:0006018"^^ . "inference based on individual clinical experience"^^ . . _:genid4093 . _:genid4094 . _:genid4096 _:genid4095 . _:genid4094 _:genid4096 . _:genid4095 . _:genid4095 . _:genid4095 . _:genid4096 . _:genid4093 _:genid4094 . _:genid4093 . . . "IC"^^ . "A type of inference based on individual clinical experience that is used in a manual assertion."^^ . "rctauber"^^ . "2016-11-30T09:44:47Z"^^ . "individual clinical experience evidence"^^ . "ICE"^^ . "eco"^^ . "ECO:0006019"^^ . "Created and used by the Human Phenotype Ontology (HPO) Annotations group. Here it is used for annotating disorders with a limited amount of published data, and is accompanied by a reference to the individual or center performing the annotation."^^ . "inference based on individual clinical experience used in manual assertion"^^ . "http://human-phenotype-ontology.github.io/documentation.html#annot"^^ . _:genid4097 . _:genid4097 . _:genid4097 . _:genid4097 . _:genid4097 "true"^^ . _:genid4098 . _:genid4098 . _:genid4098 . _:genid4098 "ICE"^^ . _:genid4098 "HPO:ICE"^^ . . . _:genid4099 . _:genid4099 . _:genid4099 . _:genid4099 . _:genid4100 . _:genid4100 . _:genid4100 . _:genid4100 . _:genid4101 . _:genid4101 . _:genid4102 . _:genid4103 . _:genid4105 _:genid4104 . _:genid4103 _:genid4105 . _:genid4104 . _:genid4104 . _:genid4104 . _:genid4105 . _:genid4102 _:genid4103 . _:genid4101 _:genid4102 . _:genid4101 . _:genid4106 . _:genid4106 . _:genid4107 . _:genid4108 . _:genid4110 _:genid4109 . _:genid4108 _:genid4110 . _:genid4109 . _:genid4109 . _:genid4111 . _:genid4111 . _:genid4111 . _:genid4109 _:genid4111 . _:genid4110 . _:genid4107 _:genid4108 . _:genid4106 _:genid4107 . _:genid4106 . "A type of cell proliferation assay evidence in which biofilm growth is monitored and detected from attachment to development."^^ . "rctauber"^^ . "2016-12-05T09:33:18Z"^^ . "biofilm assay evidence"^^ . "eco"^^ . "ECO:0006020"^^ . "biofilm formation assay evidence"^^ . _:genid4112 . _:genid4112 . _:genid4112 . _:genid4112 "A type of cell proliferation assay evidence in which biofilm growth is monitored and detected from attachment to development."^^ . _:genid4112 "PMID:10547784"^^ . . _:genid4113 . _:genid4114 . _:genid4116 _:genid4115 . _:genid4114 _:genid4116 . _:genid4115 . _:genid4115 . _:genid4115 . _:genid4116 . _:genid4113 _:genid4114 . _:genid4113 . . . "IDA"^^ . "A type of biofilm formation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-12-05T09:33:18Z"^^ . "eco"^^ . "ECO:0006021"^^ . "biofilm formation assay evidence used in manual assertion"^^ . _:genid4117 . _:genid4117 . _:genid4117 . _:genid4117 . _:genid4117 "true"^^ . _:genid4118 . _:genid4118 . _:genid4118 . _:genid4118 "A type of biofilm formation assay evidence that is used in a manual assertion."^^ . _:genid4118 "ECO:RCT"^^ . . . _:genid4119 . _:genid4119 . _:genid4120 . _:genid4121 . _:genid4123 _:genid4122 . _:genid4121 _:genid4123 . _:genid4122 . _:genid4122 . _:genid4122 . _:genid4123 . _:genid4120 _:genid4121 . _:genid4119 _:genid4120 . _:genid4119 . "A type of biofilm formation assay evidence in which microtiter dishes or tubes are inoculated and incubated to promote biofilm formation, and then biofilms are detected by staining with crystal violet or safranin to observe phenotypes."^^ . "rctauber"^^ . "2016-12-05T09:33:18Z"^^ . "96-well biofilm assay evidence"^^ . "eco"^^ . "ECO:0006022"^^ . "microtiter plate biofilm assay evidence"^^ . _:genid4124 . _:genid4124 . _:genid4124 . _:genid4124 "A type of biofilm formation assay evidence in which microtiter dishes or tubes are inoculated and incubated to promote biofilm formation, and then biofilms are detected by staining with crystal violet or safranin to observe phenotypes."^^ . _:genid4124 "PMID:10547784"^^ . . _:genid4125 . _:genid4126 . _:genid4128 _:genid4127 . _:genid4126 _:genid4128 . _:genid4127 . _:genid4127 . _:genid4127 . _:genid4128 . _:genid4125 _:genid4126 . _:genid4125 . . . "IDA"^^ . "A type of microtiter plate biofilm assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-12-05T09:33:18Z"^^ . "eco"^^ . "ECO:0006023"^^ . "microtiter plate biofilm assay evidence used in manual assertion"^^ . _:genid4129 . _:genid4129 . _:genid4129 . _:genid4129 . _:genid4129 "true"^^ . _:genid4130 . _:genid4130 . _:genid4130 . _:genid4130 "A type of microtiter plate biofilm assay evidence that is used in a manual assertion."^^ . _:genid4130 "ECO:RCT"^^ . . . "A type of biofilm formation assay evidence in which biofilm formation is analyzed, without staining, over 4 to 48 hours by growth on a tilted multiwell plate."^^ . "rctauber"^^ . "2016-12-05T09:33:18Z"^^ . "ALI biofilm assay evidence"^^ . "eco"^^ . "ECO:0006024"^^ . "Tilting of the plate positions the air-liquid interface on a clear portion to improve visability."^^ . "air-liquid interface assay evidence"^^ . _:genid4131 . _:genid4131 . _:genid4131 . _:genid4131 "A type of biofilm formation assay evidence in which biofilm formation is analyzed, without staining, over 4 to 48 hours by growth on a tilted multiwell plate."^^ . _:genid4131 "PMID:18770545"^^ . . _:genid4132 . _:genid4133 . _:genid4135 _:genid4134 . _:genid4133 _:genid4135 . _:genid4134 . _:genid4134 . _:genid4134 . _:genid4135 . _:genid4132 _:genid4133 . _:genid4132 . . . "IDA"^^ . "A type of air-liquid interface assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-12-05T09:33:18Z"^^ . "ALI biofilm assay evidence"^^ . "eco"^^ . "ECO:0006025"^^ . "air-liquid interface assay evidence used in manual assertion"^^ . _:genid4136 . _:genid4136 . _:genid4136 . _:genid4136 . _:genid4136 "true"^^ . _:genid4137 . _:genid4137 . _:genid4137 . _:genid4137 "A type of air-liquid interface assay evidence that is used in a manual assertion."^^ . _:genid4137 "ECO:RCT"^^ . . . "A type of biofilm formation assay evidence in which a colony is grown on a semipermeable membrane on an agar plate. The plate serves to supply nutrients and the semipermeable membrane can be relocated to fresh plates."^^ . "rctauber"^^ . "2016-12-05T09:33:18Z"^^ . "eco"^^ . "ECO:0006026"^^ . "The plates commonly contain different carbon sources or antibiotic treatments to observe properties of the cells."^^ . "colony biofilm assay evidence"^^ . _:genid4138 . _:genid4138 . _:genid4138 . _:genid4138 "A type of biofilm formation assay evidence in which a colony is grown on a semipermeable membrane on an agar plate. The plate serves to supply nutrients and the semipermeable membrane can be relocated to fresh plates."^^ . _:genid4138 "PMID:18770545"^^ . . _:genid4139 . _:genid4140 . _:genid4142 _:genid4141 . _:genid4140 _:genid4142 . _:genid4141 . _:genid4141 . _:genid4141 . _:genid4142 . _:genid4139 _:genid4140 . _:genid4139 . . . "IDA"^^ . "A type of colony biofilm assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-12-05T09:33:18Z"^^ . "eco"^^ . "ECO:0006027"^^ . "colony biofilm assay evidence used in manual assertion"^^ . _:genid4143 . _:genid4143 . _:genid4143 . _:genid4143 . _:genid4143 "true"^^ . _:genid4144 . _:genid4144 . _:genid4144 . _:genid4144 "A type of colony biofilm assay evidence that is used in a manual assertion."^^ . _:genid4144 "ECO:RCT"^^ . . . "A type of biofilm formation assay evidence in which mature bacterial biofilms are grown in a multiwell plate that has a growth medium continually pumped through the wells while waste is continually pumped out."^^ . "rctauber"^^ . "2016-12-05T09:33:18Z"^^ . "eco"^^ . "ECO:0006028"^^ . "Kadouri drip-fed biofilm assay evidence"^^ . _:genid4145 . _:genid4145 . _:genid4145 . _:genid4145 "A type of biofilm formation assay evidence in which mature bacterial biofilms are grown in a multiwell plate that has a growth medium continually pumped through the wells while waste is continually pumped out."^^ . _:genid4145 "PMID:18770545"^^ . . _:genid4146 . _:genid4147 . _:genid4149 _:genid4148 . _:genid4147 _:genid4149 . _:genid4148 . _:genid4148 . _:genid4148 . _:genid4149 . _:genid4146 _:genid4147 . _:genid4146 . . . "IDA"^^ . "A type of Kadouri drip-fed biofilm assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-12-05T09:33:18Z"^^ . "eco"^^ . "ECO:0006029"^^ . "Kadouri drip-fed biofilm assay evidence used in manual assertion"^^ . _:genid4150 . _:genid4150 . _:genid4150 . _:genid4150 . _:genid4150 "true"^^ . _:genid4151 . _:genid4151 . _:genid4151 . _:genid4151 "A type of Kadouri drip-fed biofilm assay evidence that is used in a manual assertion."^^ . _:genid4151 "ECO:RCT"^^ . . _:genid4152 . _:genid4153 . _:genid4155 _:genid4154 . _:genid4153 _:genid4155 . _:genid4154 . _:genid4154 . _:genid4154 . _:genid4155 . _:genid4152 _:genid4153 . _:genid4152 . . . "IPI"^^ . "A type of co-immunoprecipitation evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2016-01-13T11:32:26Z"^^ . "co-immunoprecipitation"^^ . "eco"^^ . "ECO:0006030"^^ . "co-immunoprecipitation evidence used in manual assertion"^^ . _:genid4156 . _:genid4156 . _:genid4156 . _:genid4156 . _:genid4156 "true"^^ . _:genid4157 . _:genid4157 . _:genid4157 . _:genid4157 "A type of co-immunoprecipitation evidence that is used in a manual assertion."^^ . _:genid4157 "ECO:RCT"^^ . . _:genid4158 . _:genid4159 . _:genid4161 _:genid4160 . _:genid4159 _:genid4161 . _:genid4160 . _:genid4160 . _:genid4160 . _:genid4161 . _:genid4158 _:genid4159 . _:genid4158 . . . "IDA"^^ . "A type of immunolocalization evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-01-23T07:54:37Z"^^ . "immunolocalization"^^ . "eco"^^ . "ECO:0006031"^^ . "immunolocalization evidence used in manual assertion"^^ . _:genid4162 . _:genid4162 . _:genid4162 . _:genid4162 . _:genid4162 "true"^^ . _:genid4163 . _:genid4163 . _:genid4163 . _:genid4163 "A type of immunolocalization evidence that is used in a manual assertion."^^ . _:genid4163 "ECO:RCT"^^ . . . "A type of experimental phenotypic evidence arising from experiment in which neuronal activity is manipulated using genetically encoded, optically activated neuronal actuators."^^ . "rctauber"^^ . "2017-01-23T11:58:48Z"^^ . "optogenetic actuator evidence"^^ . "eco"^^ . "ECO:0006032"^^ . "optogenetic evidence"^^ . _:genid4164 . _:genid4164 . _:genid4164 . _:genid4164 "A type of experimental phenotypic evidence arising from experiment in which neuronal activity is manipulated using genetically encoded, optically activated neuronal actuators."^^ . _:genid4164 "GOC:DOS"^^ . _:genid4164 "PMID:17035522"^^ . . _:genid4165 . _:genid4166 . _:genid4168 _:genid4167 . _:genid4166 _:genid4168 . _:genid4167 . _:genid4167 . _:genid4167 . _:genid4168 . _:genid4165 _:genid4166 . _:genid4165 . . . "EXP"^^ . "A type of optogenetic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-01-23T11:58:48Z"^^ . "optogenetic actuator evidence"^^ . "eco"^^ . "ECO:0006033"^^ . "optogenetic evidence used in manual assertion"^^ . _:genid4169 . _:genid4169 . _:genid4169 . _:genid4169 . _:genid4169 "true"^^ . _:genid4170 . _:genid4170 . _:genid4170 . _:genid4170 "A type of optogenetic evidence that is used in a manual assertion."^^ . _:genid4170 "ECO:RCT"^^ . . . "A type of fluorescence evidence that is based on direct, quantitative measurement of some cellular property using a fluorescent sensor."^^ . "rctauber"^^ . "2017-01-23T11:58:48Z"^^ . "eco"^^ . "ECO:0006034"^^ . "Examples include sensors for ion concentration and potential difference across a membrane."^^ . "fluorescent sensor evidence"^^ . _:genid4171 . _:genid4171 . _:genid4171 . _:genid4171 "A type of fluorescence evidence that is based on direct, quantitative measurement of some cellular property using a fluorescent sensor."^^ . _:genid4171 "GOC:DOS"^^ . . _:genid4172 . _:genid4173 . _:genid4175 _:genid4174 . _:genid4173 _:genid4175 . _:genid4174 . _:genid4174 . _:genid4174 . _:genid4175 . _:genid4172 _:genid4173 . _:genid4172 . . . "IDA"^^ . "A type of fluorescent sensor evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-01-23T11:58:48Z"^^ . "eco"^^ . "ECO:0006035"^^ . "fluorescent sensor evidence used in manual assertion"^^ . _:genid4176 . _:genid4176 . _:genid4176 . _:genid4176 . _:genid4176 "true"^^ . _:genid4177 . _:genid4177 . _:genid4177 . _:genid4177 "A type of fluorescent sensor evidence that is used in a manual assertion."^^ . _:genid4177 "ECO:RCT"^^ . . . "A type of fluorescent sensor evidence that is based on direct, quantitative measurement of some cellular property using a genetically encoded fluorescent sensor."^^ . "rctauber"^^ . "2017-01-23T11:58:48Z"^^ . "optogenetic sensor evidence"^^ . "eco"^^ . "ECO:0006036"^^ . "genetically encoded fluorescent sensor evidence"^^ . _:genid4178 . _:genid4178 . _:genid4178 . _:genid4178 "A type of fluorescent sensor evidence that is based on direct, quantitative measurement of some cellular property using a genetically encoded fluorescent sensor."^^ . _:genid4178 "GOC:DOS"^^ . . _:genid4179 . _:genid4180 . _:genid4182 _:genid4181 . _:genid4180 _:genid4182 . _:genid4181 . _:genid4181 . _:genid4181 . _:genid4182 . _:genid4179 _:genid4180 . _:genid4179 . . . "IDA"^^ . "A type of genetically encoded fluorescent sensor evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-01-23T11:58:48Z"^^ . "optogenetic sensor evidence"^^ . "eco"^^ . "ECO:0006037"^^ . "genetically encoded fluorescent sensor evidence used in manual assertion"^^ . _:genid4183 . _:genid4183 . _:genid4183 . _:genid4183 . _:genid4183 "true"^^ . _:genid4184 . _:genid4184 . _:genid4184 . _:genid4184 "A type of genetically encoded fluorescent sensor evidence that is used in a manual assertion."^^ . _:genid4184 "ECO:RCT"^^ . . . . "A type of fluorescent sensor evidence and electrophysiology assay evidence where the electrical properties of cells or tissues are studied using fluorescent sensors."^^ . "rctauber"^^ . "2017-01-23T11:58:48Z"^^ . "electrophysiology - optical assay evidence"^^ . "eco"^^ . "ECO:0006038"^^ . "Examples include genetically encoded sensors that detect potential difference across plasma membrane."^^ . "genetically encoded fluorescent electrophysiology assay evidence"^^ . _:genid4185 . _:genid4185 . _:genid4185 . _:genid4185 "A type of fluorescent sensor evidence and electrophysiology assay evidence where the electrical properties of cells or tissues are studied using fluorescent sensors."^^ . _:genid4185 "GOC:DOS"^^ . . _:genid4186 . _:genid4187 . _:genid4189 _:genid4188 . _:genid4187 _:genid4189 . _:genid4188 . _:genid4188 . _:genid4188 . _:genid4189 . _:genid4186 _:genid4187 . _:genid4186 . . . . "IDA"^^ . "A type of genetically encoded fluorescent electrophysiology assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-01-23T11:58:48Z"^^ . "electrophysiology - optical assay evidence"^^ . "eco"^^ . "ECO:0006039"^^ . "genetically encoded fluorescent electrophysiology assay evidence used in manual assertion"^^ . _:genid4190 . _:genid4190 . _:genid4190 . _:genid4190 . _:genid4190 "true"^^ . _:genid4191 . _:genid4191 . _:genid4191 . _:genid4191 . _:genid4191 "true"^^ . _:genid4192 . _:genid4192 . _:genid4192 . _:genid4192 "A type of genetically encoded fluorescent electrophysiology assay evidence that is used in a manual assertion."^^ . _:genid4192 "ECO:RCT"^^ . . . "A type of genetically encoded fluorescent electrophysiology assay evidence that is based on direct, quantitative measurement of ion concentration using a genetically encoded fluorescent sensor."^^ . "rctauber"^^ . "2017-01-23T11:58:48Z"^^ . "eco"^^ . "ECO:0006040"^^ . "Examples include the genetically encoded calcium indicator GCaMP."^^ . "genetically encoded fluorescent ion concentration sensor assay evidence"^^ . _:genid4193 . _:genid4193 . _:genid4193 . _:genid4193 "A type of genetically encoded fluorescent electrophysiology assay evidence that is based on direct, quantitative measurement of ion concentration using a genetically encoded fluorescent sensor."^^ . _:genid4193 "GOC:DOS"^^ . . _:genid4194 . _:genid4195 . _:genid4197 _:genid4196 . _:genid4195 _:genid4197 . _:genid4196 . _:genid4196 . _:genid4196 . _:genid4197 . _:genid4194 _:genid4195 . _:genid4194 . . . "IDA"^^ . "A type of genetically encoded fluorescent ion concentration sensor assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-01-23T11:58:48Z"^^ . "eco"^^ . "ECO:0006041"^^ . "genetically encoded fluorescent ion concentration sensor assay evidence used in manual assertion"^^ . _:genid4198 . _:genid4198 . _:genid4198 . _:genid4198 . _:genid4198 "true"^^ . _:genid4199 . _:genid4199 . _:genid4199 . _:genid4199 "A type of genetically encoded fluorescent ion concentration sensor assay evidence that is used in a manual assertion."^^ . _:genid4199 "ECO:RCT"^^ . . _:genid4200 . _:genid4201 . _:genid4203 _:genid4202 . _:genid4201 _:genid4203 . _:genid4202 . _:genid4202 . _:genid4202 . _:genid4203 . _:genid4200 _:genid4201 . _:genid4200 . . . "IDA"^^ . "A type of cell fractionation evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-02-21T07:26:28Z"^^ . "cell fractionation"^^ . "eco"^^ . "ECO:0006042"^^ . "cell fractionation evidence used in manual assertion"^^ . _:genid4204 . _:genid4204 . _:genid4204 . _:genid4204 . _:genid4204 "true"^^ . _:genid4205 . _:genid4205 . _:genid4205 . _:genid4205 "A type of cell fractionation evidence that is used in a manual assertion."^^ . _:genid4205 "ECO:RCT"^^ . . . _:genid4206 . _:genid4206 . _:genid4206 . _:genid4206 . _:genid4207 . _:genid4207 . _:genid4207 . _:genid4207 . "A type of electrophysiology assay evidence resulting from the use of electrodes to measure in vivo electrical activity coming from adjacent neurons."^^ . "rctauber"^^ . "2017-02-21T07:26:28Z"^^ . "eco"^^ . "ECO:0006043"^^ . "extracellular recording evidence"^^ . _:genid4208 . _:genid4208 . _:genid4208 . _:genid4208 "A type of electrophysiology assay evidence resulting from the use of electrodes to measure in vivo electrical activity coming from adjacent neurons."^^ . _:genid4208 "url:http://www.nature.com/subjects/extracellular-recording"^^ . . _:genid4209 . _:genid4210 . _:genid4212 _:genid4211 . _:genid4210 _:genid4212 . _:genid4211 . _:genid4211 . _:genid4211 . _:genid4212 . _:genid4209 _:genid4210 . _:genid4209 . . . "IDA"^^ . "A type of extracellular recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-02-21T07:26:28Z"^^ . "eco"^^ . "ECO:0006044"^^ . "extracellular recording evidence used in manual assertion"^^ . _:genid4213 . _:genid4213 . _:genid4213 . _:genid4213 . _:genid4213 "true"^^ . _:genid4214 . _:genid4214 . _:genid4214 . _:genid4214 "A type of extracellular recording evidence that is used in a manual assertion."^^ . _:genid4214 "ECO:RCT"^^ . . . _:genid4215 . _:genid4215 . _:genid4215 . _:genid4215 . "A type of extracellular recording evidence in which an extracellular microelectrode is used to measure the electrical activity of a single neuron."^^ . "rctauber"^^ . "2017-02-21T07:26:28Z"^^ . "eco"^^ . "ECO:0006045"^^ . "single-unit extracellular recording evidence"^^ . _:genid4216 . _:genid4216 . _:genid4216 . _:genid4216 "A type of extracellular recording evidence in which an extracellular microelectrode is used to measure the electrical activity of a single neuron."^^ . _:genid4216 "doi:10.1385/0-89603-185-3:1"^^ . . _:genid4217 . _:genid4218 . _:genid4220 _:genid4219 . _:genid4218 _:genid4220 . _:genid4219 . _:genid4219 . _:genid4219 . _:genid4220 . _:genid4217 _:genid4218 . _:genid4217 . . . "IDA"^^ . "A type of single-unit extracellular recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-02-21T07:26:28Z"^^ . "eco"^^ . "ECO:0006046"^^ . "single-unit extracellular recording evidence used in manual assertion"^^ . _:genid4221 . _:genid4221 . _:genid4221 . _:genid4221 . _:genid4221 "true"^^ . _:genid4222 . _:genid4222 . _:genid4222 . _:genid4222 "A type of single-unit extracellular recording evidence that is used in a manual assertion."^^ . _:genid4222 "ECO:RCT"^^ . . . _:genid4223 . _:genid4223 . _:genid4223 . _:genid4223 . "A type of extracellular recording evidence in which electrical activity is measured in either tissue or at a cellular level with microelectrodes."^^ . "rctauber"^^ . "2017-02-21T07:26:28Z"^^ . "local field potential recording evidence"^^ . "eco"^^ . "ECO:0006047"^^ . "field potential recording evidence"^^ . _:genid4224 . _:genid4224 . _:genid4224 . _:genid4224 "A type of extracellular recording evidence in which electrical activity is measured in either tissue or at a cellular level with microelectrodes."^^ . _:genid4224 "ECO:RCT"^^ . . _:genid4225 . _:genid4226 . _:genid4228 _:genid4227 . _:genid4226 _:genid4228 . _:genid4227 . _:genid4227 . _:genid4227 . _:genid4228 . _:genid4225 _:genid4226 . _:genid4225 . . . "IDA"^^ . "A type of field potential recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-02-21T07:26:28Z"^^ . "eco"^^ . "local field potential recording evidence"^^ . "ECO:0006048"^^ . "field potential recording evidence used in manual assertion"^^ . _:genid4229 . _:genid4229 . _:genid4229 . _:genid4229 . _:genid4229 "true"^^ . _:genid4230 . _:genid4230 . _:genid4230 . _:genid4230 "A type of field potential recording evidence that is used in a manual assertion."^^ . _:genid4230 "ECO:RCT"^^ . . _:genid4231 . _:genid4232 . _:genid4234 _:genid4233 . _:genid4232 _:genid4234 . _:genid4233 . _:genid4233 . _:genid4233 . _:genid4234 . _:genid4231 _:genid4232 . _:genid4231 . . . "IMP"^^ . "A type of genetic transformation evidence that is used in a manual assertion"^^ . "rctauber"^^ . "2017-02-21T18:08:58Z"^^ . "eco"^^ . "ECO:0006049"^^ . "genetic transformation evidence used in manual assertion"^^ . _:genid4235 . _:genid4235 . _:genid4235 . _:genid4235 . _:genid4235 "true"^^ . _:genid4236 . _:genid4236 . _:genid4236 . _:genid4236 "A type of genetic transformation evidence that is used in a manual assertion"^^ . _:genid4236 "ECO:RCT"^^ . . _:genid4237 . _:genid4238 . _:genid4240 _:genid4239 . _:genid4238 _:genid4240 . _:genid4239 . _:genid4239 . _:genid4239 . _:genid4240 . _:genid4237 _:genid4238 . _:genid4237 . . . "IMP"^^ . "A type of anti-sense experiment evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-02-21T18:08:58Z"^^ . "anti-sense experiments"^^ . "eco"^^ . "ECO:0006050"^^ . "anti-sense experiment evidence used in manual assertion"^^ . _:genid4241 . _:genid4241 . _:genid4241 . _:genid4241 . _:genid4241 "true"^^ . _:genid4242 . _:genid4242 . _:genid4242 . _:genid4242 "A type of anti-sense experiment evidence that is used in a manual assertion."^^ . _:genid4242 "ECO:RCT"^^ . . _:genid4243 . _:genid4244 . _:genid4246 _:genid4245 . _:genid4244 _:genid4246 . _:genid4245 . _:genid4245 . _:genid4245 . _:genid4246 . _:genid4243 _:genid4244 . _:genid4243 . . . "IMP"^^ . "A type of morpholino experiment evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-02-21T18:08:58Z"^^ . "anti-sense evidence"^^ . "eco"^^ . "ECO:0006051"^^ . "morpholino experiment evidence used in manual assertion"^^ . _:genid4247 . _:genid4247 . _:genid4247 . _:genid4247 . _:genid4247 "true"^^ . _:genid4248 . _:genid4248 . _:genid4248 . _:genid4248 "A type of morpholino experiment evidence that is used in a manual assertion."^^ . _:genid4248 "ECO:RCT"^^ . . _:genid4249 . _:genid4250 . _:genid4252 _:genid4251 . _:genid4250 _:genid4252 . _:genid4251 . _:genid4251 . _:genid4251 . _:genid4252 . _:genid4249 _:genid4250 . _:genid4249 . . . "IMP"^^ . "A type of RNAi evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-02-21T18:08:58Z"^^ . "RNAi experiment"^^ . "eco"^^ . "ECO:0006052"^^ . "RNAi evidence used in manual assertion"^^ . _:genid4253 . _:genid4253 . _:genid4253 . _:genid4253 . _:genid4253 "true"^^ . _:genid4254 . _:genid4254 . _:genid4254 . _:genid4254 "A type of RNAi evidence that is used in a manual assertion."^^ . _:genid4254 "ECO:RCT"^^ . . . _:genid4255 . _:genid4255 . _:genid4255 . _:genid4255 . _:genid4256 . _:genid4256 . _:genid4257 . _:genid4258 . _:genid4260 _:genid4259 . _:genid4258 _:genid4260 . _:genid4259 . _:genid4259 . _:genid4259 . _:genid4260 . _:genid4257 _:genid4258 . _:genid4256 _:genid4257 . _:genid4256 . "A type of experimental phenotypic evidence that arises from assaying the response of a cell, tissue, organ or organism following exposure to a receptor agonist or antagonist."^^ . "dosumis"^^ . "2017-03-07T08:51:02Z"^^ . "eco"^^ . "ECO:0006053"^^ . "pharmacological assay evidence"^^ . _:genid4261 . _:genid4261 . _:genid4261 . _:genid4261 "A type of experimental phenotypic evidence that arises from assaying the response of a cell, tissue, organ or organism following exposure to a receptor agonist or antagonist."^^ . _:genid4261 "GOC:DOS"^^ . . _:genid4262 . _:genid4263 . _:genid4265 _:genid4264 . _:genid4263 _:genid4265 . _:genid4264 . _:genid4264 . _:genid4264 . _:genid4265 . _:genid4262 _:genid4263 . _:genid4262 . . . "EXP"^^ . "A type of experimental phenotypic evidence used in a manual assertion that arises from assaying the response of a cell, tissue, organ or organism following exposure to a receptor agonist or antagonist."^^ . "rctauber"^^ . "2017-03-07T08:51:02Z"^^ . "eco"^^ . "ECO:0006054"^^ . "pharmacological assay evidence used in manual assertion"^^ . _:genid4266 . _:genid4266 . _:genid4266 . _:genid4266 . _:genid4266 "true"^^ . _:genid4267 . _:genid4267 . _:genid4267 . _:genid4267 "A type of experimental phenotypic evidence used in a manual assertion that arises from assaying the response of a cell, tissue, organ or organism following exposure to a receptor agonist or antagonist."^^ . _:genid4267 "GOC:DOS"^^ . . . "A type of evidence where data generation is automated with equipment to allow for assaying samples or molecules in parallel."^^ . "mchibucos"^^ . "2017-03-28T14:48:39Z"^^ . "HT evidence"^^ . "high-throughput evidence"^^ . "high throughput cell biology evidence"^^ . "high throughput screening evidence"^^ . "eco"^^ . "ECO:0006055"^^ . "Some relevant articles include: PMID: 23340846, doi:10.1038/nmeth0607-523"^^ . "high throughput evidence"^^ . _:genid4268 . _:genid4268 . _:genid4268 . _:genid4268 "A type of evidence where data generation is automated with equipment to allow for assaying samples or molecules in parallel."^^ . _:genid4268 "ECO:MCC"^^ . . _:genid4269 . _:genid4270 . _:genid4272 _:genid4271 . _:genid4270 _:genid4272 . _:genid4271 . _:genid4271 . _:genid4271 . _:genid4272 . _:genid4269 _:genid4270 . _:genid4269 . . . "HTP"^^ . "A type of evidence that is used in a manual assertion where data generation is automated with equipment to allow for assaying large numbers of samples or molecules in parallel."^^ . "rctauber"^^ . "2017-03-28T14:48:39Z"^^ . "HT evidence"^^ . "high-throughput evidence"^^ . "GOECO:HTP"^^ . "HTP"^^ . "inferred from high throughput experiment"^^ . "eco"^^ . "high throughput cell biology evidence"^^ . "high throughput screening evidence"^^ . "ECO:0006056"^^ . "high throughput evidence used in manual assertion"^^ . _:genid4273 . _:genid4273 . _:genid4273 . _:genid4273 . _:genid4273 "true"^^ . _:genid4274 . _:genid4274 . _:genid4274 . _:genid4274 "HTP"^^ . _:genid4274 "Default"^^ . _:genid4275 . _:genid4275 . _:genid4275 . _:genid4275 "A type of evidence that is used in a manual assertion where data generation is automated with equipment to allow for assaying large numbers of samples or molecules in parallel."^^ . _:genid4275 "ECO:RCT"^^ . _:genid4276 . _:genid4276 . _:genid4276 . _:genid4276 "GOECO:HTP"^^ . _:genid4276 "inferred from high throughput experiment"^^ . _:genid4277 . _:genid4277 . _:genid4277 . _:genid4277 "HTP"^^ . _:genid4277 "GOECO:HTP"^^ . _:genid4278 . _:genid4278 . _:genid4278 . _:genid4278 "inferred from high throughput experiment"^^ . _:genid4278 "GOECO:HTP"^^ . . _:genid4279 . _:genid4280 . _:genid4282 _:genid4281 . _:genid4280 _:genid4282 . _:genid4281 . _:genid4281 . _:genid4281 . _:genid4282 . _:genid4279 _:genid4280 . _:genid4279 . . . "IEA"^^ . "A type of evidence that is used in an automatic assertion where data generation is automated with equipment to allow for assaying samples or molecules in parallel."^^ . "rctauber"^^ . "2017-03-28T14:48:39Z"^^ . "HT evidence"^^ . "high-throughput evidence"^^ . "eco"^^ . "high throughput cell biology evidence"^^ . "high throughput screening evidence"^^ . "ECO:0006057"^^ . "high throughput evidence used in automatic assertion"^^ . _:genid4283 . _:genid4283 . _:genid4283 . _:genid4283 . _:genid4283 "true"^^ . _:genid4284 . _:genid4284 . _:genid4284 . _:genid4284 "A type of evidence that is used in an automatic assertion where data generation is automated with equipment to allow for assaying samples or molecules in parallel."^^ . _:genid4284 "ECO:RCT"^^ . . . "A type of high throughput evidence where a classical cell biology technique is automated with equipment to allow for assaying biomolecules in parallel."^^ . "mchibucos"^^ . "2017-03-28T14:48:39Z"^^ . "eco"^^ . "omics experiment"^^ . "ECO:0006058"^^ . "HT methodologies may incorporate techniques from optics, chemistry, biology or image analysis (https://en.wikipedia.org/wiki/High_throughput_biology)"^^ . "high throughput cell biology evidence"^^ . _:genid4285 . _:genid4285 . _:genid4285 . _:genid4285 "A type of high throughput evidence where a classical cell biology technique is automated with equipment to allow for assaying biomolecules in parallel."^^ . _:genid4285 "ECO:MCC"^^ . . _:genid4286 . _:genid4287 . _:genid4289 _:genid4288 . _:genid4287 _:genid4289 . _:genid4288 . _:genid4288 . _:genid4288 . _:genid4289 . _:genid4286 _:genid4287 . _:genid4286 . . . "HTP"^^ . "A type of high throughput evidence used in a manual assertion where a classical cell biology technique is automated with equipment to allow for assaying biomolecules in parallel."^^ . "rctauber"^^ . "2017-03-28T14:48:39Z"^^ . "eco"^^ . "omics experiment"^^ . "ECO:0006059"^^ . "high throughput cell biology evidence used in manual assertion"^^ . _:genid4290 . _:genid4290 . _:genid4290 . _:genid4290 . _:genid4290 "true"^^ . _:genid4291 . _:genid4291 . _:genid4291 . _:genid4291 "A type of high throughput evidence used in a manual assertion where a classical cell biology technique is automated with equipment to allow for assaying biomolecules in parallel."^^ . _:genid4291 "ECO:RCT"^^ . . _:genid4292 . _:genid4293 . _:genid4295 _:genid4294 . _:genid4293 _:genid4295 . _:genid4294 . _:genid4294 . _:genid4294 . _:genid4295 . _:genid4292 _:genid4293 . _:genid4292 . . . "IEA"^^ . "A type of high throughput evidence used in an automatic assertion where a classical cell biology technique is automated with equipment to allow for assaying biomolecules in parallel."^^ . "rctauber"^^ . "2017-03-28T14:48:39Z"^^ . "eco"^^ . "omics experiment"^^ . "ECO:0006060"^^ . "high throughput cell biology evidence used in automatic assertion"^^ . _:genid4296 . _:genid4296 . _:genid4296 . _:genid4296 . _:genid4296 "true"^^ . _:genid4297 . _:genid4297 . _:genid4297 . _:genid4297 "A type of high throughput evidence used in an automatic assertion where a classical cell biology technique is automated with equipment to allow for assaying biomolecules in parallel."^^ . _:genid4297 "ECO:RCT"^^ . . _:genid4298 . _:genid4299 . _:genid4301 _:genid4300 . _:genid4299 _:genid4301 . _:genid4300 . _:genid4300 . _:genid4300 . _:genid4301 . _:genid4298 _:genid4299 . _:genid4298 . . . . "IDA"^^ . "A type of wide-field fluorescence microscopy evidence used in a manual assertion where fluorescently tagged antibodies are imaged that are used to bind to their antigens."^^ . "rctauber"^^ . "2017-05-15T08:57:07Z"^^ . "wide-field epifluorescence microscopy evidence"^^ . "eco"^^ . "ECO:0006061"^^ . "immunofluorescence wide-field microscopy evidence used in manual assertion"^^ . _:genid4302 . _:genid4302 . _:genid4302 . _:genid4302 . _:genid4302 "true"^^ . _:genid4303 . _:genid4303 . _:genid4303 . _:genid4303 . _:genid4303 "true"^^ . _:genid4304 . _:genid4304 . _:genid4304 . _:genid4304 "A type of wide-field fluorescence microscopy evidence used in a manual assertion where fluorescently tagged antibodies are imaged that are used to bind to their antigens."^^ . _:genid4304 "ECO:SN"^^ . _:genid4304 "url:http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0057135"^^ . . _:genid4305 . _:genid4306 . _:genid4308 _:genid4307 . _:genid4306 _:genid4308 . _:genid4307 . _:genid4307 . _:genid4307 . _:genid4308 . _:genid4305 _:genid4306 . _:genid4305 . . . "IDA"^^ . "A type of wide-field microscopy evidence that is used in a manual assertion where pure white and ultraviolet light are produced by a mercury lamp, passed through an optical filter (excitation filter), and directed to a sample via a dichroic mirror, followed by detection of the fluorescent light by a camera after it passes through an emission filter."^^ . "rctauber"^^ . "2017-05-15T09:01:19Z"^^ . "eco"^^ . "ECO:0006062"^^ . "wide-field fluorescence microscopy evidence used in manual assertion"^^ . _:genid4309 . _:genid4309 . _:genid4309 . _:genid4309 . _:genid4309 "true"^^ . _:genid4310 . _:genid4310 . _:genid4310 . _:genid4310 "A type of wide-field microscopy evidence that is used in a manual assertion where pure white and ultraviolet light are produced by a mercury lamp, passed through an optical filter (excitation filter), and directed to a sample via a dichroic mirror, followed by detection of the fluorescent light by a camera after it passes through an emission filter."^^ . _:genid4310 "ECO:SN"^^ . _:genid4310 "url:http://www.bristol.ac.uk/synaptic/research/techniques/widefield.html"^^ . . _:genid4311 . _:genid4312 . _:genid4314 _:genid4313 . _:genid4312 _:genid4314 . _:genid4313 . _:genid4313 . _:genid4313 . _:genid4314 . _:genid4311 _:genid4312 . _:genid4311 . . . "IMP"^^ . "A type of experimental phenotypic evidence that is used in a manual assertion where a gene and/or gene product is investigated in a transgenic organism that has been engineered to overexpress that gene product."^^ . "rctauber"^^ . "2017-05-15T09:03:49Z"^^ . "eco"^^ . "analysis of overexpression/ectopic expression phenotype"^^ . "ECO:0006063"^^ . "over expression analysis evidence used in manual assertion"^^ . _:genid4315 . _:genid4315 . _:genid4315 . _:genid4315 . _:genid4315 "true"^^ . _:genid4316 . _:genid4316 . _:genid4316 . _:genid4316 "A type of experimental phenotypic evidence that is used in a manual assertion where a gene and/or gene product is investigated in a transgenic organism that has been engineered to overexpress that gene product."^^ . _:genid4316 "PMID:22419077"^^ . . _:genid4317 . _:genid4318 . _:genid4320 _:genid4319 . _:genid4318 _:genid4320 . _:genid4319 . _:genid4319 . _:genid4319 . _:genid4320 . _:genid4317 _:genid4318 . _:genid4317 . . . "IDA"^^ . "A type of cell-free assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-05-15T09:08:17Z"^^ . "in vitro assay evidence"^^ . "eco"^^ . "ECO:0006064"^^ . "cell-free assay evidence used in manual assertion"^^ . _:genid4321 . _:genid4321 . _:genid4321 . _:genid4321 . _:genid4321 "true"^^ . _:genid4322 . _:genid4322 . _:genid4322 . _:genid4322 "A type of cell-free assay evidence that is used in a manual assertion."^^ . _:genid4322 "PMID:18453125"^^ . . "rctauber"^^ . "2017-05-15T09:11:13Z"^^ . "eco"^^ . "ECO:0006065"^^ . "Use children of ECO:0001565 (cell-based assay evidence) in place of this term."^^ . "in vitro cell based assay evidence used in manual assertion"^^ . "true"^^ . . . _:genid4323 . _:genid4323 . _:genid4323 . _:genid4323 . _:genid4324 . _:genid4324 . _:genid4324 . _:genid4324 . _:genid4325 . _:genid4325 . _:genid4326 . _:genid4327 . _:genid4329 _:genid4328 . _:genid4327 _:genid4329 . _:genid4328 . _:genid4328 . _:genid4330 . _:genid4330 . _:genid4331 . _:genid4332 . _:genid4334 _:genid4333 . _:genid4332 _:genid4334 . _:genid4333 . _:genid4333 . _:genid4333 . _:genid4334 . _:genid4331 _:genid4332 . _:genid4330 _:genid4331 . _:genid4328 _:genid4330 . _:genid4329 . _:genid4326 _:genid4327 . _:genid4325 _:genid4326 . _:genid4325 . "A type of fluorescence evidence where quantitative information on the diffusion properties of a sample is produced from the measurement of diffusion of fluorescent probes over time into an area that has been photobleached by a high-intensity laser pulse."^^ . "dosumis"^^ . "rctauber"^^ . "2017-05-16T10:55:40Z"^^ . "FRAP evidence"^^ . "eco"^^ . "ECO:0006066"^^ . "FRAP is a fluorescence microscopy-based technique."^^ . "fluorescence recovery after photobleaching evidence"@en . _:genid4335 . _:genid4335 . _:genid4335 . _:genid4335 "A type of fluorescence evidence where quantitative information on the diffusion properties of a sample is produced from the measurement of diffusion of fluorescent probes over time into an area that has been photobleached by a high-intensity laser pulse."^^ . _:genid4335 "PMID:26314367"^^ . _:genid4336 . _:genid4336 . _:genid4336 . _:genid4336 "FRAP is a fluorescence microscopy-based technique."^^ . _:genid4336 "PMID:26314367"^^ . . _:genid4337 . _:genid4338 . _:genid4340 _:genid4339 . _:genid4338 _:genid4340 . _:genid4339 . _:genid4339 . _:genid4339 . _:genid4340 . _:genid4337 _:genid4338 . _:genid4337 . . . "IDA"^^ . "A type of fluorescence evidence that is used in a manual assertion where quantitative information on the diffusion properties of a sample is produced from the measurement of diffusion of fluorescent probes over time into an area that has been photobleached by a high-intensity laser pulse."^^ . "rctauber"^^ . "2017-05-16T10:55:40Z"^^ . "FRAP evidence"^^ . "eco"^^ . "ECO:0006067"^^ . "fluorescence recovery after photobleaching evidence used in manual assertion"@en . _:genid4341 . _:genid4341 . _:genid4341 . _:genid4341 . _:genid4341 "true"^^ . . _:genid4342 . _:genid4343 . _:genid4345 _:genid4344 . _:genid4343 _:genid4345 . _:genid4344 . _:genid4344 . _:genid4344 . _:genid4345 . _:genid4342 _:genid4343 . _:genid4342 . . . "IEP"^^ . "A type of high throughput nucleotide sequencing assay evidence used in a manual assertion based on high-throughput (HT) sequencing of fragmented cDNA molecules."^^ . "rctauber"^^ . "2017-06-28T10:37:02Z"^^ . "WTSS evidence"^^ . "whole transcriptome shotgun sequencing"^^ . "RNA-seq evidence used in manual assertion"^^ . "RNAseq evidence used in manual assertion"^^ . "eco"^^ . "RNA sequencing|differential gene expression evidence from RNA-seq experiment"^^ . "ECO:0006068"^^ . "RNA-sequencing evidence used in manual assertion"^^ . _:genid4346 . _:genid4346 . _:genid4346 . _:genid4346 . _:genid4346 "true"^^ . _:genid4347 . _:genid4347 . _:genid4347 . _:genid4347 "A type of high throughput nucleotide sequencing assay evidence used in a manual assertion based on high-throughput (HT) sequencing of fragmented cDNA molecules."^^ . _:genid4347 "ECO:MCC"^^ . . _:genid4348 . _:genid4349 . _:genid4351 _:genid4350 . _:genid4349 _:genid4351 . _:genid4350 . _:genid4350 . _:genid4350 . _:genid4351 . _:genid4348 _:genid4349 . _:genid4348 . . . "IEA"^^ . "A type of high throughput nucleotide sequencing assay evidence used in an automatic assertion based on high-throughput (HT) sequencing of fragmented cDNA molecules."^^ . "rctauber"^^ . "2017-06-28T10:37:02Z"^^ . "WTSS evidence"^^ . "whole transcriptome shotgun sequencing"^^ . "RNA-seq evidence used in automatic assertion"^^ . "RNAseq evidence used in automatic assertion"^^ . "eco"^^ . "RNA sequencing|differential gene expression evidence from RNA-seq experiment"^^ . "ECO:0006069"^^ . "RNA-sequencing evidence used in automatic assertion"^^ . _:genid4352 . _:genid4352 . _:genid4352 . _:genid4352 . _:genid4352 "true"^^ . _:genid4353 . _:genid4353 . _:genid4353 . _:genid4353 "A type of high throughput nucleotide sequencing assay evidence used in an automatic assertion based on high-throughput (HT) sequencing of fragmented cDNA molecules."^^ . _:genid4353 "ECO:MCC"^^ . . . _:genid4354 . _:genid4354 . _:genid4354 . _:genid4354 . _:genid4355 . _:genid4355 . _:genid4356 . _:genid4357 . _:genid4359 _:genid4358 . _:genid4357 _:genid4359 . _:genid4358 . _:genid4358 . _:genid4360 . _:genid4360 . _:genid4361 . _:genid4362 . _:genid4364 _:genid4363 . _:genid4362 _:genid4364 . _:genid4363 . _:genid4363 . _:genid4363 . _:genid4364 . _:genid4361 _:genid4362 . _:genid4360 _:genid4361 . _:genid4358 _:genid4360 . _:genid4359 . _:genid4356 _:genid4357 . _:genid4355 _:genid4356 . _:genid4355 . _:genid4365 . _:genid4365 . _:genid4366 . _:genid4367 . _:genid4369 _:genid4368 . _:genid4367 _:genid4369 . _:genid4368 . _:genid4368 . _:genid4368 . _:genid4369 . _:genid4366 _:genid4367 . _:genid4365 _:genid4366 . _:genid4365 . "A type of electron microscopy evidence resulting from the use of antibodies to identify the localization of antigens in cells and tissues."^^ . "dosumis"^^ . "rctauber"^^ . "2017-07-05T09:59:10Z"^^ . "immunolabelling electron microscopy evidence"^^ . "eco"^^ . "ECO:0006070"^^ . "immuno-labelling electron microscopy evidence"^^ . _:genid4370 . _:genid4370 . _:genid4370 . _:genid4370 "A type of electron microscopy evidence resulting from the use of antibodies to identify the localization of antigens in cells and tissues."^^ . _:genid4370 "PMID:25151300"^^ . . _:genid4371 . _:genid4372 . _:genid4374 _:genid4373 . _:genid4372 _:genid4374 . _:genid4373 . _:genid4373 . _:genid4373 . _:genid4374 . _:genid4371 _:genid4372 . _:genid4371 . . . "IDA"^^ . "A type of electron microscopy evidence used in a manual assertion resulting from the use of antibodies to identify the localization of antigens in cells and tissues."^^ . "PMID:25151300"^^ . "dosumis"^^ . "rctauber"^^ . "2017-07-05T09:59:10Z"^^ . "immunolabelling electron microscopy evidence"^^ . "eco"^^ . "ECO:0006071"^^ . "immuno-labelling electron microscopy evidence used in manual assertion"^^ . _:genid4375 . _:genid4375 . _:genid4375 . _:genid4375 . _:genid4375 "true"^^ . _:genid4376 . _:genid4376 . _:genid4376 . _:genid4376 "A type of electron microscopy evidence used in a manual assertion resulting from the use of antibodies to identify the localization of antigens in cells and tissues."^^ . _:genid4376 "PMID:25151300"^^ . . . "A type of super-resolution microscopy evidence resulting from the use of fluorescently-tagged antibodies to identify the localization of antigens in cells and tissue."^^ . "dosumis"^^ . "rctauber"^^ . "2017-07-05T09:59:10Z"^^ . "eco"^^ . "ECO:0006072"^^ . "immunofluorescence super resolution microscopy evidence"^^ . _:genid4377 . _:genid4377 . _:genid4377 . _:genid4377 "A type of super-resolution microscopy evidence resulting from the use of fluorescently-tagged antibodies to identify the localization of antigens in cells and tissue."^^ . _:genid4377 "PMID:19245833"^^ . . _:genid4378 . _:genid4379 . _:genid4381 _:genid4380 . _:genid4379 _:genid4381 . _:genid4380 . _:genid4380 . _:genid4380 . _:genid4381 . _:genid4378 _:genid4379 . _:genid4378 . . . "IDA"^^ . "A type of super-resolution microscopy evidence used in a manual assertion resulting from the use of fluorescently-tagged antibodies to identify the localization of antigens in cells and tissue."^^ . "dosumis"^^ . "rctauber"^^ . "2017-07-05T09:59:10Z"^^ . "eco"^^ . "ECO:0006073"^^ . "immunofluorescence super resolution microscopy evidence used in manual assertion"^^ . _:genid4382 . _:genid4382 . _:genid4382 . _:genid4382 . _:genid4382 "true"^^ . _:genid4383 . _:genid4383 . _:genid4383 . _:genid4383 "A type of super-resolution microscopy evidence used in a manual assertion resulting from the use of fluorescently-tagged antibodies to identify the localization of antigens in cells and tissue."^^ . _:genid4383 "PMID:19245833"^^ . . _:genid4384 . _:genid4385 . _:genid4387 _:genid4386 . _:genid4385 _:genid4387 . _:genid4386 . _:genid4386 . _:genid4386 . _:genid4387 . _:genid4384 _:genid4385 . _:genid4384 . . . "IPI"^^ . "A type of physical interaction evidence that is used in manual assertion where a cellular component subunit is isolated as part of purification of its larger complex."^^ . "rctauber"^^ . "2017-09-14T09:19:19Z"^^ . "co-purification"^^ . "eco"^^ . "ECO:0006074"^^ . "co-purification evidence used in manual assertion"^^ . _:genid4388 . _:genid4388 . _:genid4388 . _:genid4388 . _:genid4388 "true"^^ . _:genid4389 . _:genid4389 . _:genid4389 . _:genid4389 "A type of physical interaction evidence that is used in manual assertion where a cellular component subunit is isolated as part of purification of its larger complex."^^ . _:genid4389 "TAIR:TED"^^ . . _:genid4390 . _:genid4391 . _:genid4393 _:genid4392 . _:genid4391 _:genid4393 . _:genid4392 . _:genid4392 . _:genid4392 . _:genid4393 . _:genid4390 _:genid4391 . _:genid4390 . . . "IPI"^^ . "A type of physical interaction evidence that is used in manual assertion that depends on the strength of the interaction between two entities."^^ . "rctauber"^^ . "2017-09-14T09:19:20Z"^^ . "eco"^^ . "ligand binding evidence"^^ . "ECO:0006075"^^ . "affinity evidence used in manual assertion"^^ . _:genid4394 . _:genid4394 . _:genid4394 . _:genid4394 . _:genid4394 "true"^^ . _:genid4395 . _:genid4395 . _:genid4395 . _:genid4395 "A type of physical interaction evidence that is used in manual assertion that depends on the strength of the interaction between two entities."^^ . _:genid4395 "ECO:MCC"^^ . . _:genid4396 . _:genid4397 . _:genid4399 _:genid4398 . _:genid4397 _:genid4399 . _:genid4398 . _:genid4398 . _:genid4398 . _:genid4399 . _:genid4396 _:genid4397 . _:genid4396 . . . "IPI"^^ . "A type of affinity evidence that is used in manual assertion resulting from the binding of a molecule to a protein or protein complex."^^ . "rctauber"^^ . "2017-09-14T09:19:21Z"^^ . "eco"^^ . "ECO:0006076"^^ . "protein binding evidence used in manual assertion"^^ . _:genid4400 . _:genid4400 . _:genid4400 . _:genid4400 . _:genid4400 "true"^^ . _:genid4401 . _:genid4401 . _:genid4401 . _:genid4401 "A type of affinity evidence that is used in manual assertion resulting from the binding of a molecule to a protein or protein complex."^^ . _:genid4401 "GO:0005515"^^ . . _:genid4402 . _:genid4403 . _:genid4405 _:genid4404 . _:genid4403 _:genid4405 . _:genid4404 . _:genid4404 . _:genid4404 . _:genid4405 . _:genid4402 _:genid4403 . _:genid4402 . . . "IPI"^^ . "A type of bait-prey hybrid interaction evidence that is used in manual assertion where proteins of interest (bait and prey) are covalently linked to incomplete fragments of a third protein (reporter) and expressed in vivo, at which time interaction between bait and prey proteins brings reporter fragments in close enough proximity to allow them to reform and become a functional reporter protein."^^ . "rctauber"^^ . "2017-09-14T09:19:22Z"^^ . "bait-prey protein pull-down evidence"^^ . "eco"^^ . "ECO:0006077"^^ . "bait-prey hybrid interaction evidence used in manual assertion"^^ . _:genid4406 . _:genid4406 . _:genid4406 . _:genid4406 . _:genid4406 "true"^^ . _:genid4407 . _:genid4407 . _:genid4407 . _:genid4407 "A type of bait-prey hybrid interaction evidence that is used in manual assertion where proteins of interest (bait and prey) are covalently linked to incomplete fragments of a third protein (reporter) and expressed in vivo, at which time interaction between bait and prey proteins brings reporter fragments in close enough proximity to allow them to reform and become a functional reporter protein."^^ . _:genid4407 "ECO:MCC"^^ . . _:genid4408 . _:genid4409 . _:genid4411 _:genid4410 . _:genid4409 _:genid4411 . _:genid4410 . _:genid4410 . _:genid4410 . _:genid4411 . _:genid4408 _:genid4409 . _:genid4408 . . . "IPI"^^ . "A type of affinity evidence that is used in manual assertion resulting from quantitation of the analyte which depends on the reaction of an antigen (analyte) and an antibody."^^ . "rctauber"^^ . "2017-09-14T09:19:23Z"^^ . "eco"^^ . "ECO:0006078"^^ . "immunological assay evidence used in manual assertion"^^ . _:genid4412 . _:genid4412 . _:genid4412 . _:genid4412 . _:genid4412 "true"^^ . _:genid4413 . _:genid4413 . _:genid4413 . _:genid4413 "A type of affinity evidence that is used in manual assertion resulting from quantitation of the analyte which depends on the reaction of an antigen (analyte) and an antibody."^^ . _:genid4413 "ERO:0001362"^^ . . _:genid4414 . _:genid4415 . _:genid4417 _:genid4416 . _:genid4415 _:genid4417 . _:genid4416 . _:genid4416 . _:genid4416 . _:genid4417 . _:genid4414 _:genid4415 . _:genid4414 . . . "IPI"^^ . "A type of hybrid interaction evidence that is used in manual assertion that is based on a protein-DNA complementation assay where a single promoter acts as bait and is screened against a library of prey transcription factors."^^ . "rctauber"^^ . "2017-09-14T09:19:24Z"^^ . "yeast one-hybrid assay"^^ . "eco"^^ . "ECO:0006079"^^ . "yeast one-hybrid evidence used in manual assertion"^^ . _:genid4418 . _:genid4418 . _:genid4418 . _:genid4418 . _:genid4418 "true"^^ . _:genid4419 . _:genid4419 . _:genid4419 . _:genid4419 "A type of hybrid interaction evidence that is used in manual assertion that is based on a protein-DNA complementation assay where a single promoter acts as bait and is screened against a library of prey transcription factors."^^ . _:genid4419 "ECO:MCC"^^ . . _:genid4420 . _:genid4421 . _:genid4423 _:genid4422 . _:genid4421 _:genid4423 . _:genid4422 . _:genid4422 . _:genid4422 . _:genid4423 . _:genid4420 _:genid4421 . _:genid4420 . . . "IPI"^^ . "A type of split-ubiquitin functional complementation evidence that is used in a manual assertion that is based on detection of protein-protein interaction between a bait and prey protein by in vivo reconstitution of split-ubiquitin (when bait and prey interact) and release of a reporter protein."^^ . "rctauber"^^ . "2017-09-14T09:19:25Z"^^ . "split-ubiquitin assay"^^ . "eco"^^ . "ECO:0006080"^^ . "split-ubiquitin functional complementation evidence used in manual assertion"^^ . _:genid4424 . _:genid4424 . _:genid4424 . _:genid4424 . _:genid4424 "true"^^ . _:genid4425 . _:genid4425 . _:genid4425 . _:genid4425 "A type of split-ubiquitin functional complementation evidence that is used in a manual assertion that is based on detection of protein-protein interaction between a bait and prey protein by in vivo reconstitution of split-ubiquitin (when bait and prey interact) and release of a reporter protein."^^ . _:genid4425 "PMID:15064465"^^ . . _:genid4426 . _:genid4427 . _:genid4429 _:genid4428 . _:genid4427 _:genid4429 . _:genid4428 . _:genid4428 . _:genid4428 . _:genid4429 . _:genid4426 _:genid4427 . _:genid4426 . . . "IPI"^^ . "A type of physical interaction evidence that is used in a manual assertion that is based on detection of protein-protein interactions by separation of target proteins by SDS-PAGE which are blotted to a membrane, followed by denaturation and renaturation, probing with purified bait proteins, and detection of the target-bait complexes."^^ . "rctauber"^^ . "2017-09-14T09:19:26Z"^^ . "far-Western analysis"^^ . "eco"^^ . "ECO:0006081"^^ . "far-Western blotting evidence used in manual assertion"^^ . _:genid4430 . _:genid4430 . _:genid4430 . _:genid4430 . _:genid4430 "true"^^ . _:genid4431 . _:genid4431 . _:genid4431 . _:genid4431 "A type of physical interaction evidence that is used in a manual assertion that is based on detection of protein-protein interactions by separation of target proteins by SDS-PAGE which are blotted to a membrane, followed by denaturation and renaturation, probing with purified bait proteins, and detection of the target-bait complexes."^^ . _:genid4431 "PMID:18079728"^^ . . _:genid4432 . _:genid4433 . _:genid4435 _:genid4434 . _:genid4433 _:genid4435 . _:genid4434 . _:genid4434 . _:genid4434 . _:genid4435 . _:genid4432 _:genid4433 . _:genid4432 . . . "IPI"^^ . "A type of affinity evidence that is used in a manual assertion that results from separation of biochemical mixtures by selective binding of a compound to an immobilized compound on a polymeric matrix, subsequent removal of unattached components, and then displacement of the bond compound."^^ . "rctauber"^^ . "2017-09-14T09:19:27Z"^^ . "affinity chromatography"^^ . "eco"^^ . "ECO:0006082"^^ . "affinity chromatography evidence used in manual assertion"^^ . _:genid4436 . _:genid4436 . _:genid4436 . _:genid4436 . _:genid4436 "true"^^ . _:genid4437 . _:genid4437 . _:genid4437 . _:genid4437 "A type of affinity evidence that is used in a manual assertion that results from separation of biochemical mixtures by selective binding of a compound to an immobilized compound on a polymeric matrix, subsequent removal of unattached components, and then displacement of the bond compound."^^ . _:genid4437 "ECO:MCC"^^ . . _:genid4438 . _:genid4439 . _:genid4441 _:genid4440 . _:genid4439 _:genid4441 . _:genid4440 . _:genid4440 . _:genid4440 . _:genid4441 . _:genid4438 _:genid4439 . _:genid4438 . . . "IPI"^^ . "A type of affinity evidence that is used in a manual assertion resulting from the binding of a molecule to a nucleic acid."^^ . "rctauber"^^ . "2017-09-14T09:19:28Z"^^ . "eco"^^ . "ECO:0006083"^^ . "nucleic acid binding evidence used in manual assertion"^^ . _:genid4442 . _:genid4442 . _:genid4442 . _:genid4442 . _:genid4442 "true"^^ . _:genid4443 . _:genid4443 . _:genid4443 . _:genid4443 "A type of affinity evidence that is used in a manual assertion resulting from the binding of a molecule to a nucleic acid."^^ . _:genid4443 "GO:0003676"^^ . . _:genid4444 . _:genid4445 . _:genid4447 _:genid4446 . _:genid4445 _:genid4447 . _:genid4446 . _:genid4446 . _:genid4446 . _:genid4447 . _:genid4444 _:genid4445 . _:genid4444 . . . "IPI"^^ . "A type of nucleic acid binding evidence that is used in a manual assertion resulting from an enzyme displaying binding activity to specific ribohomopolymer."^^ . "rctauber"^^ . "2017-09-14T09:19:29Z"^^ . "ribohomopolymer binding assay"^^ . "eco"^^ . "ECO:0006084"^^ . "ribohomopolymer binding assay evidence used in manual assertion"^^ . _:genid4448 . _:genid4448 . _:genid4448 . _:genid4448 . _:genid4448 "true"^^ . _:genid4449 . _:genid4449 . _:genid4449 . _:genid4449 "A type of nucleic acid binding evidence that is used in a manual assertion resulting from an enzyme displaying binding activity to specific ribohomopolymer."^^ . _:genid4449 "PMC:102612"^^ . . _:genid4450 . _:genid4451 . _:genid4453 _:genid4452 . _:genid4451 _:genid4453 . _:genid4452 . _:genid4452 . _:genid4452 . _:genid4453 . _:genid4450 _:genid4451 . _:genid4450 . . . "IPI"^^ . "A type of protein binding evidence that is used in a manual assertion resulting from a metal ion binding to a protein at a specific binding site."^^ . "rctauber"^^ . "2017-09-14T09:19:30Z"^^ . "eco"^^ . "ECO:0006085"^^ . "protein:ion binding evidence used in manual assertion"^^ . _:genid4454 . _:genid4454 . _:genid4454 . _:genid4454 . _:genid4454 "true"^^ . _:genid4455 . _:genid4455 . _:genid4455 . _:genid4455 "A type of protein binding evidence that is used in a manual assertion resulting from a metal ion binding to a protein at a specific binding site."^^ . _:genid4455 "PMID:2377604"^^ . . _:genid4456 . _:genid4457 . _:genid4459 _:genid4458 . _:genid4457 _:genid4459 . _:genid4458 . _:genid4458 . _:genid4458 . _:genid4459 . _:genid4456 _:genid4457 . _:genid4456 . . . "IPI"^^ . "A type of nucleic acid binding evidence that is used in a manual assertion in which DNA-protein binding is detected using labeled DNA as probes, hybridized to electrophoretically separated proteins."^^ . "rctauber"^^ . "2017-09-14T09:19:31Z"^^ . "Southwestern analysis"^^ . "eco"^^ . "ECO:0006086"^^ . "Southwestern blot evidence used in manual assertion"^^ . _:genid4460 . _:genid4460 . _:genid4460 . _:genid4460 . _:genid4460 "true"^^ . _:genid4461 . _:genid4461 . _:genid4461 . _:genid4461 "A type of nucleic acid binding evidence that is used in a manual assertion in which DNA-protein binding is detected using labeled DNA as probes, hybridized to electrophoretically separated proteins."^^ . _:genid4461 "ECO:RCT"^^ . . _:genid4462 . _:genid4463 . _:genid4465 _:genid4464 . _:genid4463 _:genid4465 . _:genid4464 . _:genid4464 . _:genid4464 . _:genid4465 . _:genid4462 _:genid4463 . _:genid4462 . . . "IPI"^^ . "A type of nucleic acid binding evidence that is used in a manual assertion in which RNA-protein binding is detected using labeled RNA as probes, hybridized to electrophoretically separated proteins."^^ . "rctauber"^^ . "2017-09-14T09:19:32Z"^^ . "Northwestern analysis"^^ . "eco"^^ . "ECO:0006087"^^ . "Northwestern blot evidence used in manual assertion"^^ . _:genid4466 . _:genid4466 . _:genid4466 . _:genid4466 . _:genid4466 "true"^^ . _:genid4467 . _:genid4467 . _:genid4467 . _:genid4467 "A type of nucleic acid binding evidence that is used in a manual assertion in which RNA-protein binding is detected using labeled RNA as probes, hybridized to electrophoretically separated proteins."^^ . _:genid4467 "ECO:RCT"^^ . . _:genid4468 . _:genid4469 . _:genid4471 _:genid4470 . _:genid4469 _:genid4471 . _:genid4470 . _:genid4470 . _:genid4470 . _:genid4471 . _:genid4468 _:genid4469 . _:genid4468 . . . "IPI"^^ . "A type of evidence that is used in a manual assertion arising from a physical interaction analysis where a combinatorial chemistry technique is used to identify oligonucleotides that bind to a target ligand."^^ . "rctauber"^^ . "2017-09-14T09:19:33Z"^^ . "SELEX evidence"^^ . "in vitro selection evidence"^^ . "eco"^^ . "in vitro evolution evidence"^^ . "ECO:0006088"^^ . "systematic evolution of ligands by exponential amplification evidence used in manual assertion"^^ . _:genid4472 . _:genid4472 . _:genid4472 . _:genid4472 . _:genid4472 "true"^^ . _:genid4473 . _:genid4473 . _:genid4473 . _:genid4473 "A type of evidence that is used in a manual assertion arising from a physical interaction analysis where a combinatorial chemistry technique is used to identify oligonucleotides that bind to a target ligand."^^ . _:genid4473 "ECO:MCC"^^ . . _:genid4474 . _:genid4475 . _:genid4477 _:genid4476 . _:genid4475 _:genid4477 . _:genid4476 . _:genid4476 . _:genid4476 . _:genid4477 . _:genid4474 _:genid4475 . _:genid4474 . . . "IPI"^^ . "A type of hybrid interaction evidence that is used in a manual assertion that uses bacterial transformation with two plasmids to assess in vivo binding of a DNA-binding domain (bait) and DNA target site (prey)."^^ . "rctauber"^^ . "2017-09-14T09:19:34Z"^^ . "B1H evidence"^^ . "eco"^^ . "ECO:0006089"^^ . "bacterial one-hybrid evidence used in manual assertion"^^ . _:genid4478 . _:genid4478 . _:genid4478 . _:genid4478 . _:genid4478 "true"^^ . _:genid4479 . _:genid4479 . _:genid4479 . _:genid4479 "A type of hybrid interaction evidence that is used in a manual assertion that uses bacterial transformation with two plasmids to assess in vivo binding of a DNA-binding domain (bait) and DNA target site (prey)."^^ . _:genid4479 "ECO:MCC"^^ . . _:genid4480 . _:genid4481 . _:genid4483 _:genid4482 . _:genid4481 _:genid4483 . _:genid4482 . _:genid4482 . _:genid4482 . _:genid4483 . _:genid4480 _:genid4481 . _:genid4480 . . . . "IPI"^^ . "A type of protein-oligonucleotide microarray binding evidence that is used in a manual assertion that detects binding of a tagged protein to an array of oligonucleotide probes representing potential binding sites."^^ . "rctauber"^^ . "2017-09-14T09:19:35Z"^^ . "PBM evidence"^^ . "eco"^^ . "ECO:0006090"^^ . "protein-oligonucleotide microarray binding evidence used in manual assertion"^^ . _:genid4484 . _:genid4484 . _:genid4484 . _:genid4484 . _:genid4484 "true"^^ . _:genid4485 . _:genid4485 . _:genid4485 . _:genid4485 . _:genid4485 "true"^^ . _:genid4486 . _:genid4486 . _:genid4486 . _:genid4486 "A type of protein-oligonucleotide microarray binding evidence that is used in a manual assertion that detects binding of a tagged protein to an array of oligonucleotide probes representing potential binding sites."^^ . _:genid4486 "PMID:22146299"^^ . . _:genid4487 . _:genid4488 . _:genid4490 _:genid4489 . _:genid4488 _:genid4490 . _:genid4489 . _:genid4489 . _:genid4489 . _:genid4490 . _:genid4487 _:genid4488 . _:genid4487 . . . "IGI"^^ . "A type of genetic interaction evidence that is used in a manual assertion where a wild-type copy of the gene in question is inserted into a mutant cell to see if it restores the wild-type phenotype in the mutant background."^^ . "rctauber"^^ . "2017-09-14T09:19:36Z"^^ . "functional complementation"^^ . "eco"^^ . "ECO:0006091"^^ . "functional complementation evidence used in manual assertion"^^ . _:genid4491 . _:genid4491 . _:genid4491 . _:genid4491 . _:genid4491 "true"^^ . _:genid4492 . _:genid4492 . _:genid4492 . _:genid4492 "A type of genetic interaction evidence that is used in a manual assertion where a wild-type copy of the gene in question is inserted into a mutant cell to see if it restores the wild-type phenotype in the mutant background."^^ . _:genid4492 "PMID:27403640"^^ . . _:genid4493 . _:genid4494 . _:genid4496 _:genid4495 . _:genid4494 _:genid4496 . _:genid4495 . _:genid4495 . _:genid4495 . _:genid4496 . _:genid4493 _:genid4494 . _:genid4493 . . . "IGI"^^ . "A type of functional complementation evidence that is used in a manual assertion that is used in manual assertion resulting from the introduction of a transgene to prevent, or \"rescue\" an organism from a condition."^^ . "rctauber"^^ . "2017-09-14T09:19:37Z"^^ . "eco"^^ . "ECO:0006092"^^ . "transgenic rescue experiment evidence used in manual assertion"^^ . _:genid4497 . _:genid4497 . _:genid4497 . _:genid4497 . _:genid4497 "true"^^ . _:genid4498 . _:genid4498 . _:genid4498 . _:genid4498 "A type of functional complementation evidence that is used in a manual assertion that is used in manual assertion resulting from the introduction of a transgene to prevent, or \"rescue\" an organism from a condition."^^ . _:genid4498 "url:http://www.nature.com/gt/journal/v11/n15/full/3302282a.html"^^ . . _:genid4499 . _:genid4500 . _:genid4502 _:genid4501 . _:genid4500 _:genid4502 . _:genid4501 . _:genid4501 . _:genid4501 . _:genid4502 . _:genid4499 _:genid4500 . _:genid4499 . . . "IGI"^^ . "A type of transient rescue experiment evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-09-14T09:19:38Z"^^ . "eco"^^ . "ECO:0006093"^^ . "transient rescue experiment evidence used in manual assertion"^^ . _:genid4503 . _:genid4503 . _:genid4503 . _:genid4503 . _:genid4503 "true"^^ . _:genid4504 . _:genid4504 . _:genid4504 . _:genid4504 "A type of transient rescue experiment evidence that is used in a manual assertion."^^ . _:genid4504 "ECO:RCT"^^ . . _:genid4505 . _:genid4506 . _:genid4508 _:genid4507 . _:genid4506 _:genid4508 . _:genid4507 . _:genid4507 . _:genid4507 . _:genid4508 . _:genid4505 _:genid4506 . _:genid4505 . . . "IGI"^^ . "A type of suppressor/enhancer interaction phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-09-14T09:19:39Z"^^ . "'traditional' genetic interactions (e.g. suppressors, synthetic lethals)"^^ . "suppressor/enhancer interaction evidence used in manual assertion"^^ . "eco"^^ . "ECO:0006094"^^ . "suppressor/enhancer interaction phenotypic evidence used in manual assertion"^^ . _:genid4509 . _:genid4509 . _:genid4509 . _:genid4509 . _:genid4509 "true"^^ . _:genid4510 . _:genid4510 . _:genid4510 . _:genid4510 "A type of suppressor/enhancer interaction phenotypic evidence that is used in a manual assertion."^^ . _:genid4510 "url:http://www.wormbook.org/chapters/www:geneticsuppression/geneticsuppression.html"^^ . . _:genid4511 . _:genid4512 . _:genid4514 _:genid4513 . _:genid4512 _:genid4514 . _:genid4513 . _:genid4513 . _:genid4513 . _:genid4514 . _:genid4511 _:genid4512 . _:genid4511 . . . "IGI" . "A type of double mutant phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-09-14T09:19:40Z"^^ . "double mutant analysis"^^ . "double mutant phenotype evidence used in manual assertion"^^ . "eco"^^ . "ECO:0006095"^^ . "double mutant phenotypic evidence used in manual assertion"^^ . _:genid4515 . _:genid4515 . _:genid4515 . _:genid4515 . _:genid4515 "true"^^ . _:genid4516 . _:genid4516 . _:genid4516 . _:genid4516 "A type of double mutant phenotypic evidence that is used in a manual assertion."^^ . _:genid4516 "ECO:RCT"^^ . . _:genid4517 . _:genid4518 . _:genid4520 _:genid4519 . _:genid4518 _:genid4520 . _:genid4519 . _:genid4519 . _:genid4519 . _:genid4520 . _:genid4517 _:genid4518 . _:genid4517 . . . "IGI"^^ . "A type of epistatic interaction phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-09-14T09:19:41Z"^^ . "epistatic interactions"^^ . "epistatic interaction evidence used in manual assertion"^^ . "eco"^^ . "ECO:0006096"^^ . "epistatic interaction phenotypic evidence used in manual assertion"^^ . _:genid4521 . _:genid4521 . _:genid4521 . _:genid4521 . _:genid4521 "true"^^ . _:genid4522 . _:genid4522 . _:genid4522 . _:genid4522 "A type of epistatic interaction phenotypic evidence that is used in a manual assertion."^^ . _:genid4522 "PMID:18852697"^^ . . _:genid4523 . _:genid4524 . _:genid4526 _:genid4525 . _:genid4524 _:genid4526 . _:genid4525 . _:genid4525 . _:genid4525 . _:genid4526 . _:genid4523 _:genid4524 . _:genid4523 . . . "IGI"^^ . "A type of functional complementation evidence that is used in a manual assertion that is based on the insertion of a wild-type copy of a gene into a heterologous organism, with the mutation occurring in a homologous gene."^^ . "rctauber"^^ . "2017-09-14T09:19:42Z"^^ . "functional complementation in heterologous system"^^ . "eco"^^ . "ECO:0006097"^^ . "functional complementation in heterologous system evidence used in manual assertion"^^ . _:genid4527 . _:genid4527 . _:genid4527 . _:genid4527 . _:genid4527 "true"^^ . _:genid4528 . _:genid4528 . _:genid4528 . _:genid4528 "A type of functional complementation evidence that is used in a manual assertion that is based on the insertion of a wild-type copy of a gene into a heterologous organism, with the mutation occurring in a homologous gene."^^ . _:genid4528 "TAIR:TED"^^ . . . "A type of mutant phenotype evidence resulting from altered gene function at higher temperatures."^^ . "pgaudet"^^ . "rctauber"^^ . "2017-09-18T07:58:28Z"^^ . "Ts mutation evidence"^^ . "temperature-sensitive mutant phenotype evidence"^^ . "eco"^^ . "ECO:0006098"^^ . "temperature-sensitive mutant phenotypic evidence"^^ . _:genid4529 . _:genid4529 . _:genid4529 . _:genid4529 "A type of mutant phenotype evidence resulting from altered gene function at higher temperatures."^^ . _:genid4529 "GOC:PG"^^ . _:genid4529 "PMID:19596904"^^ . . _:genid4530 . _:genid4531 . _:genid4533 _:genid4532 . _:genid4531 _:genid4533 . _:genid4532 . _:genid4532 . _:genid4532 . _:genid4533 . _:genid4530 _:genid4531 . _:genid4530 . . . "IMP"^^ . "A type of temperature-sensitive mutant phenotypic evidence that is used in a manual assertion."^^ . "pgaudet"^^ . "rctauber"^^ . "2017-09-18T07:58:28Z"^^ . "Ts mutation evidence"^^ . "temperature-sensitive mutant phenotype evidence used in manual assertion"^^ . "eco"^^ . "ECO:0006099"^^ . "temperature-sensitive mutant phenotypic evidence used in manual assertion"^^ . _:genid4534 . _:genid4534 . _:genid4534 . _:genid4534 . _:genid4534 "true"^^ . _:genid4535 . _:genid4535 . _:genid4535 . _:genid4535 "A type of temperature-sensitive mutant phenotypic evidence that is used in a manual assertion."^^ . _:genid4535 "GOC:PG"^^ . _:genid4535 "PMID:19596904"^^ . . . "A type of mutant phenotype evidence based on the analysis of a mutation which, in diploid organisms, must be present in both alleles for a phenotype to manifest itself."^^ . "pgaudet"^^ . "rctauber"^^ . "2017-09-18T07:58:28Z"^^ . "eco"^^ . "ECO:0006100"^^ . "recessive mutant phenotype evidence"^^ . _:genid4536 . _:genid4536 . _:genid4536 . _:genid4536 "A type of mutant phenotype evidence based on the analysis of a mutation which, in diploid organisms, must be present in both alleles for a phenotype to manifest itself."^^ . _:genid4536 "GOC:PG"^^ . _:genid4536 "NBK:21578"^^ . . _:genid4537 . _:genid4538 . _:genid4540 _:genid4539 . _:genid4538 _:genid4540 . _:genid4539 . _:genid4539 . _:genid4539 . _:genid4540 . _:genid4537 _:genid4538 . _:genid4537 . . . "IMP"^^ . "A type of mutant phenotype evidence that is used in a manual assertion based on the analysis of a mutation which, in diploid organisms, must be present in both alleles for a phenotype to manifest itself."^^ . "pgaudet"^^ . "rctauber"^^ . "2017-09-18T07:58:28Z"^^ . "eco"^^ . "ECO:0006101"^^ . "recessive mutant phenotype evidence used in manual assertion"^^ . _:genid4541 . _:genid4541 . _:genid4541 . _:genid4541 . _:genid4541 "true"^^ . _:genid4542 . _:genid4542 . _:genid4542 . _:genid4542 "A type of mutant phenotype evidence that is used in a manual assertion based on the analysis of a mutation which, in diploid organisms, must be present in both alleles for a phenotype to manifest itself."^^ . _:genid4542 "GOC:PG"^^ . _:genid4542 "NBK:21578"^^ . . . "A type of computational evidence where the active site of the molecular system is described with highly accurate quantum theory, while the contribution of the rest of the system is described with molecular mechanical force field."^^ . "snadendla"^^ . "QM/MM evidence"^^ . "eco"^^ . "ECO:0006135"^^ . "quantum mechanics/molecular mechanics simulation evidence"^^ . _:genid4543 . _:genid4543 . _:genid4543 . _:genid4543 "A type of computational evidence where the active site of the molecular system is described with highly accurate quantum theory, while the contribution of the rest of the system is described with molecular mechanical force field."^^ . _:genid4543 "ECO:SN"^^ . _:genid4543 "PMID:26930454"^^ . . . "A type of quantum mechanics/molecular mechanics simulation evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006136"^^ . "quantum mechanics/molecular mechanics simulation evidence used in automatic assertion"^^ . _:genid4544 . _:genid4544 . _:genid4544 . _:genid4544 "A type of quantum mechanics/molecular mechanics simulation evidence that is used in an automatic assertion."^^ . _:genid4544 "ECO:SN"^^ . . . "A type of quantum mechanics/molecular mechanics simulation evidence that is used in manual assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006137"^^ . "quantum mechanics/molecular mechanics simulation evidence used in manual assertion"^^ . _:genid4545 . _:genid4545 . _:genid4545 . _:genid4545 "A type of quantum mechanics/molecular mechanics simulation evidence that is used in manual assertion."^^ . _:genid4545 "ECO:SN"^^ . . . "A type of computational evidence where the energy of a molecular system is predicted as a function of its conformation."^^ . "snadendla"^^ . "MM evidence"^^ . "eco"^^ . "ECO:0006138"^^ . "molecular mechanics simulation evidence"^^ . _:genid4546 . _:genid4546 . _:genid4546 . _:genid4546 "A type of computational evidence where the energy of a molecular system is predicted as a function of its conformation."^^ . _:genid4546 "ECO:SN"^^ . _:genid4546 "url:http://vergil.chemistry.gatech.edu/courses/chem6485/pdf/molmech.pdf"^^ . . . "A type of molecular mechanics simulation evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006139"^^ . "molecular mechanics simulation evidence used in automatic assertion"^^ . _:genid4547 . _:genid4547 . _:genid4547 . _:genid4547 "A type of molecular mechanics simulation evidence that is used in an automatic assertion."^^ . _:genid4547 "ECO:SN"^^ . . . "A type of molecular mechanics simulation evidence that is used in manual assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006140"^^ . "molecular mechanics simulation evidence used in manual assertion"^^ . _:genid4548 . _:genid4548 . _:genid4548 . _:genid4548 "A type of molecular mechanics simulation evidence that is used in manual assertion."^^ . _:genid4548 "ECO:SN"^^ . . . "A type of computational evidence where the behavior of matter and light on the atomic and subatomic scale is described."^^ . "snadendla"^^ . "QM evidence"^^ . "quantum physics evidence"^^ . "quantum theory evidence"^^ . "eco"^^ . "ECO:0006141"^^ . "quantum mechanics simulation evidence"^^ . _:genid4549 . _:genid4549 . _:genid4549 . _:genid4549 "A type of computational evidence where the behavior of matter and light on the atomic and subatomic scale is described."^^ . _:genid4549 "ECO:SN"^^ . _:genid4549 "url:https://www.britannica.com/science/quantum-mechanics-physics"^^ . . . "A type of quantum mechanics simulation evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006142"^^ . "quantum mechanics simulation evidence used in automatic assertion"^^ . _:genid4550 . _:genid4550 . _:genid4550 . _:genid4550 "A type of quantum mechanics simulation evidence that is used in an automatic assertion."^^ . _:genid4550 "ECO:SN"^^ . . . "A type of quantum mechanics simulation evidence that is used in manual assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006143"^^ . "quantum mechanics simulation evidence used in manual assertion"^^ . _:genid4551 . _:genid4551 . _:genid4551 . _:genid4551 "A type of quantum mechanics simulation evidence that is used in manual assertion."^^ . _:genid4551 "ECO:SN"^^ . . . "A type of quantum mechanics simulation evidence that results from the calculation of ground-state electronic structure of atoms, molecules and solid state materials."^^ . "snadendla"^^ . "DFT evidence"^^ . "eco"^^ . "ECO:0006144"^^ . "density functional theory simulation evidence"^^ . _:genid4552 . _:genid4552 . _:genid4552 . _:genid4552 "A type of quantum mechanics simulation evidence that results from the calculation of ground-state electronic structure of atoms, molecules and solid state materials."^^ . _:genid4552 "ECO:SN"^^ . _:genid4552 "url:https://www.sciencedirect.com/topics/physics-and-astronomy/density-functional-theory"^^ . . . "A type of density functional theory simulation evidence that is used in manual assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006145"^^ . "density functional theory simulation evidence used in manual assertion"^^ . _:genid4553 . _:genid4553 . _:genid4553 . _:genid4553 "A type of density functional theory simulation evidence that is used in manual assertion."^^ . _:genid4553 "ECO:SN"^^ . . . "A type of density functional theory simulation evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006146"^^ . "density functional theory simulation evidence used in automatic assertion"^^ . _:genid4554 . _:genid4554 . _:genid4554 . _:genid4554 "A type of density functional theory simulation evidence that is used in an automatic assertion."^^ . _:genid4554 "ECO:SN"^^ . . . "A type of evidence in which information is recorded in some documentation system, for example, but not limited to a publication, survey, or medical record."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006151"^^ . "documented statement evidence"^^ . _:genid4555 . _:genid4555 . _:genid4555 . _:genid4555 "A type of evidence in which information is recorded in some documentation system, for example, but not limited to a publication, survey, or medical record."^^ . _:genid4555 "ECO:SN"^^ . . . "A type of documented statement evidence in which information is stated by a health care professional, for example, but not limited to a doctor, nurse, or psychologist."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006152"^^ . "medical practitioner statement evidence"^^ . _:genid4556 . _:genid4556 . _:genid4556 . _:genid4556 "A type of documented statement evidence in which information is stated by a health care professional, for example, but not limited to a doctor, nurse, or psychologist."^^ . _:genid4556 "ECO:SN"^^ . . . "A type of documented statement evidence in which information is provided by an individual through means including, but not limited to, paper form, electronic form, or verbal communication, and is captured in a documented record."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006153"^^ . "self-reported individual's statement evidence"^^ . _:genid4557 . _:genid4557 . _:genid4557 . _:genid4557 "A type of documented statement evidence in which information is provided by an individual through means including, but not limited to, paper form, electronic form, or verbal communication, and is captured in a documented record."^^ . _:genid4557 "ECO:SN"^^ . . . "A type of self-reported individual's statement evidence in which information is provided by a patient in a clinical setting."^^ . "Pablo Botas for Foundation 29, Dx29 project"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006154"^^ . "self-reported patient statement evidence"^^ . _:genid4558 . _:genid4558 . _:genid4558 . _:genid4558 "A type of self-reported individual's statement evidence in which information is provided by a patient in a clinical setting."^^ . _:genid4558 "ECO:SN"^^ . . _:genid4559 . _:genid4560 . _:genid4562 _:genid4561 . _:genid4560 _:genid4562 . _:genid4561 . _:genid4561 . _:genid4561 . _:genid4562 . _:genid4559 _:genid4560 . _:genid4559 . . . "A type of documented statement evidence that is used in a manual assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006155"^^ . "documented statement evidence used in manual assertion"^^ . _:genid4563 . _:genid4563 . _:genid4563 . _:genid4563 . _:genid4563 "true"^^ . _:genid4564 . _:genid4564 . _:genid4564 . _:genid4564 "A type of documented statement evidence that is used in a manual assertion."^^ . _:genid4564 "ECO:SN"^^ . . _:genid4565 . _:genid4566 . _:genid4568 _:genid4567 . _:genid4566 _:genid4568 . _:genid4567 . _:genid4567 . _:genid4567 . _:genid4568 . _:genid4565 _:genid4566 . _:genid4565 . . . "IEA"^^ . "A type of documented statement evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006156"^^ . "documented statement evidence used in automatic assertion"^^ . _:genid4569 . _:genid4569 . _:genid4569 . _:genid4569 . _:genid4569 "true"^^ . _:genid4570 . _:genid4570 . _:genid4570 . _:genid4570 "A type of documented statement evidence that is used in an automatic assertion."^^ . _:genid4570 "ECO:SN"^^ . . _:genid4571 . _:genid4572 . _:genid4574 _:genid4573 . _:genid4572 _:genid4574 . _:genid4573 . _:genid4573 . _:genid4573 . _:genid4574 . _:genid4571 _:genid4572 . _:genid4571 . . . "A type of self-reported individual's statement evidence that is used in a manual assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006157"^^ . "self-reported individual's statement evidence used in manual assertion"^^ . _:genid4575 . _:genid4575 . _:genid4575 . _:genid4575 . _:genid4575 "true"^^ . _:genid4576 . _:genid4576 . _:genid4576 . _:genid4576 "A type of self-reported individual's statement evidence that is used in a manual assertion."^^ . _:genid4576 "ECO:SN"^^ . . _:genid4577 . _:genid4578 . _:genid4580 _:genid4579 . _:genid4578 _:genid4580 . _:genid4579 . _:genid4579 . _:genid4579 . _:genid4580 . _:genid4577 _:genid4578 . _:genid4577 . . . "IEA"^^ . "A type of self-reported individual's statement evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006158"^^ . "self-reported individual's statement evidence used in automatic assertion"^^ . _:genid4581 . _:genid4581 . _:genid4581 . _:genid4581 . _:genid4581 "true"^^ . _:genid4582 . _:genid4582 . _:genid4582 . _:genid4582 "A type of self-reported individual's statement evidence that is used in an automatic assertion."^^ . _:genid4582 "ECO:SN"^^ . . _:genid4583 . _:genid4584 . _:genid4586 _:genid4585 . _:genid4584 _:genid4586 . _:genid4585 . _:genid4585 . _:genid4585 . _:genid4586 . _:genid4583 _:genid4584 . _:genid4583 . . . "A type of self-reported patient statement evidence that is used in a manual assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006159"^^ . "self-reported patient statement evidence used in manual assertion"^^ . _:genid4587 . _:genid4587 . _:genid4587 . _:genid4587 . _:genid4587 "true"^^ . _:genid4588 . _:genid4588 . _:genid4588 . _:genid4588 "A type of self-reported patient statement evidence that is used in a manual assertion."^^ . _:genid4588 "ECO:SN"^^ . . _:genid4589 . _:genid4590 . _:genid4592 _:genid4591 . _:genid4590 _:genid4592 . _:genid4591 . _:genid4591 . _:genid4591 . _:genid4592 . _:genid4589 _:genid4590 . _:genid4589 . . . "IEA"^^ . "A type of self-reported patient statement evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006160"^^ . "self-reported patient statement evidence used in automatic assertion"^^ . _:genid4593 . _:genid4593 . _:genid4593 . _:genid4593 . _:genid4593 "true"^^ . _:genid4594 . _:genid4594 . _:genid4594 . _:genid4594 "A type of self-reported patient statement evidence that is used in an automatic assertion."^^ . _:genid4594 "ECO:SN"^^ . . _:genid4595 . _:genid4596 . _:genid4598 _:genid4597 . _:genid4596 _:genid4598 . _:genid4597 . _:genid4597 . _:genid4597 . _:genid4598 . _:genid4595 _:genid4596 . _:genid4595 . . . "A type of medical practitioner statement evidence that is used in a manual assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006161"^^ . "medical practitioner statement evidence used in manual assertion"^^ . _:genid4599 . _:genid4599 . _:genid4599 . _:genid4599 . _:genid4599 "true"^^ . _:genid4600 . _:genid4600 . _:genid4600 . _:genid4600 "A type of medical practitioner statement evidence that is used in a manual assertion."^^ . _:genid4600 "ECO:SN"^^ . . _:genid4601 . _:genid4602 . _:genid4604 _:genid4603 . _:genid4602 _:genid4604 . _:genid4603 . _:genid4603 . _:genid4603 . _:genid4604 . _:genid4601 _:genid4602 . _:genid4601 . . . "IEA"^^ . "A type of medical practitioner statement evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006162"^^ . "medical practitioner statement evidence used in automatic assertion"^^ . _:genid4605 . _:genid4605 . _:genid4605 . _:genid4605 . _:genid4605 "true"^^ . _:genid4606 . _:genid4606 . _:genid4606 . _:genid4606 "A type of medical practitioner statement evidence that is used in an automatic assertion."^^ . _:genid4606 "ECO:SN"^^ . . . _:genid4607 . _:genid4607 . _:genid4607 . _:genid4607 . "A type of nuclear magnetic resonance evidence used for quantification of metabolites or for the determination of chemical structure or composition."^^ . "SIB:PG"^^ . "snadendla"^^ . "NMR Spectroscopy"^^ . "eco"^^ . "ECO:0006163"^^ . "nuclear magnetic resonance spectroscopy evidence"^^ . _:genid4608 . _:genid4608 . _:genid4608 . _:genid4608 "A type of nuclear magnetic resonance evidence used for quantification of metabolites or for the determination of chemical structure or composition."^^ . _:genid4608 "ECO:SN"^^ . _:genid4608 "PMID: 16428685"^^ . _:genid4608 "PMID: 23036848"^^ . . _:genid4609 . _:genid4610 . _:genid4612 _:genid4611 . _:genid4610 _:genid4612 . _:genid4611 . _:genid4611 . _:genid4611 . _:genid4612 . _:genid4609 _:genid4610 . _:genid4609 . . . "IEA"^^ . "A type of nuclear magnetic resonance spectroscopy evidence that is used in an automatic assertion."^^ . "SIB:PG"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006164"^^ . "nuclear magnetic resonance spectroscopy evidence used in automatic assertion"^^ . _:genid4613 . _:genid4613 . _:genid4613 . _:genid4613 . _:genid4613 "true"^^ . _:genid4614 . _:genid4614 . _:genid4614 . _:genid4614 "A type of nuclear magnetic resonance spectroscopy evidence that is used in an automatic assertion."^^ . _:genid4614 "ECO:SN"^^ . . _:genid4615 . _:genid4616 . _:genid4618 _:genid4617 . _:genid4616 _:genid4618 . _:genid4617 . _:genid4617 . _:genid4617 . _:genid4618 . _:genid4615 _:genid4616 . _:genid4615 . . . "EXP"^^ . "A type of nuclear magnetic resonance spectroscopy evidence that is used in a manual assertion."^^ . "SIB:PG"^^ . "snadendla"^^ . "NMR spectroscopy evidence"^^ . "eco"^^ . "ECO:0006165"^^ . "nuclear magnetic resonance spectroscopy evidence used in manual assertion"^^ . _:genid4619 . _:genid4619 . _:genid4619 . _:genid4619 . _:genid4619 "true"^^ . _:genid4620 . _:genid4620 . _:genid4620 . _:genid4620 "A type of nuclear magnetic resonance spectroscopy evidence that is used in a manual assertion."^^ . _:genid4620 "ECO:SN"^^ . . . "A type of nuclear magnetic resonance evidence used to image anatomy and physiological processes."^^ . "bjonnh"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006166"^^ . "nuclear magnetic resonance imaging evidence"^^ . _:genid4621 . _:genid4621 . _:genid4621 . _:genid4621 "A type of nuclear magnetic resonance evidence used to image anatomy and physiological processes."^^ . _:genid4621 "url:https://en.wikipedia.org/wiki/Magnetic_resonance_imaging"^^ . . _:genid4622 . _:genid4623 . _:genid4625 _:genid4624 . _:genid4623 _:genid4625 . _:genid4624 . _:genid4624 . _:genid4624 . _:genid4625 . _:genid4622 _:genid4623 . _:genid4622 . . . "IEA"^^ . "A type of nuclear magnetic resonance imaging evidence that is used in an automatic assertion."^^ . "bjonnh"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006167"^^ . "nuclear magnetic resonance imaging evidence used in automatic assertion"^^ . _:genid4626 . _:genid4626 . _:genid4626 . _:genid4626 . _:genid4626 "true"^^ . _:genid4627 . _:genid4627 . _:genid4627 . _:genid4627 "A type of nuclear magnetic resonance imaging evidence that is used in an automatic assertion."^^ . _:genid4627 "ECO:SN"^^ . . _:genid4628 . _:genid4629 . _:genid4631 _:genid4630 . _:genid4629 _:genid4631 . _:genid4630 . _:genid4630 . _:genid4630 . _:genid4631 . _:genid4628 _:genid4629 . _:genid4628 . . . "EXP"^^ . "A type of nuclear magnetic resonance imaging evidence that is used in a manual assertion."^^ . "bjonnh"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006168"^^ . "nuclear magnetic resonance imaging evidence used in manual assertion"^^ . _:genid4632 . _:genid4632 . _:genid4632 . _:genid4632 . _:genid4632 "true"^^ . _:genid4633 . _:genid4633 . _:genid4633 . _:genid4633 "A type of nuclear magnetic resonance imaging evidence that is used in a manual assertion."^^ . _:genid4633 "ECO:SN"^^ . . . "A type of qualitative western immunoblotting evidence where detection of the signal is carried out through digital imaging and the signal is normalized with methods such as standard curves built from reference housekeeping proteins or total transferred protein measurements."^^ . "GO:Val"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006169"^^ . "quantitative western immunoblotting evidence"^^ . _:genid4634 . _:genid4634 . _:genid4634 . _:genid4634 "A type of qualitative western immunoblotting evidence where detection of the signal is carried out through digital imaging and the signal is normalized with methods such as standard curves built from reference housekeeping proteins or total transferred protein measurements."^^ . _:genid4634 "ECO:SN"^^ . _:genid4634 "PMID:25852189"^^ . . _:genid4635 . _:genid4636 . _:genid4638 _:genid4637 . _:genid4636 _:genid4638 . _:genid4637 . _:genid4637 . _:genid4637 . _:genid4638 . _:genid4635 _:genid4636 . _:genid4635 . . . "IEP"^^ . "A type of quantitative western immunoblotting evidence that is used in a manual assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006170"^^ . "quantitative western immunoblotting evidence used in manual evidence"^^ . _:genid4639 . _:genid4639 . _:genid4639 . _:genid4639 . _:genid4639 "true"^^ . _:genid4640 . _:genid4640 . _:genid4640 . _:genid4640 "A type of quantitative western immunoblotting evidence that is used in a manual assertion."^^ . _:genid4640 "ECO:SN"^^ . . _:genid4641 . _:genid4642 . _:genid4644 _:genid4643 . _:genid4642 _:genid4644 . _:genid4643 . _:genid4643 . _:genid4643 . _:genid4644 . _:genid4641 _:genid4642 . _:genid4641 . . . "IEA"^^ . "A type of quantitatative western immunoblotting evidence that is used in an automatic assertion."^^ . "snadendla"^^ . "eco"^^ . "ECO:0006171"^^ . "quantitative western immunoblotting evidence used in automatic assertion"^^ . _:genid4645 . _:genid4645 . _:genid4645 . _:genid4645 . _:genid4645 "true"^^ . _:genid4646 . _:genid4646 . _:genid4646 . _:genid4646 "A type of quantitatative western immunoblotting evidence that is used in an automatic assertion."^^ . _:genid4646 "ECO:SN"^^ . . . "A type of support of intron positions by RNA-sequencing alignment evidence where RNA-seq alignments from a mixture of samples support all of the intron positions (exon pairs) predicted for a transcript."^^ . "NCBI-RefSeq"^^ . "snadendla"^^ . "mixed support of intron positions by RNA-seq alignment evidence"^^ . "eco"^^ . "ECO:0006172"^^ . "Mixed support entails that all exon pairs represented in the transcript are supported, but require a combination of evidence from multiple samples. For example, for a transcript containing five exons, if liver RNA-seq reads support the first two introns and brain RNA-seq supports the last three introns, then neither sample meets the criteria for full support (ECO:0000343) but the combination of samples qualifies as Mixed support. Mixed support may result from differential expression, or low expression levels that benefit from combining data."^^ . "mixed support of intron positions by RNA-sequencing alignment evidence"^^ . _:genid4647 . _:genid4647 . _:genid4647 . _:genid4647 "A type of support of intron positions by RNA-sequencing alignment evidence where RNA-seq alignments from a mixture of samples support all of the intron positions (exon pairs) predicted for a transcript."^^ . _:genid4647 "ECO:SN"^^ . . _:genid4648 . _:genid4649 . _:genid4651 _:genid4650 . _:genid4649 _:genid4651 . _:genid4650 . _:genid4650 . _:genid4650 . _:genid4651 . _:genid4648 _:genid4649 . _:genid4648 . . . "IEA"^^ . "A type of mixed support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion."^^ . "NCBI-RefSeq"^^ . "snadendla"^^ . "mixed support of intron positions by RNA-seq alignment evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0006173"^^ . "mixed support of intron positions by RNA-sequencing alignment evidence used in automatic assertion"^^ . _:genid4652 . _:genid4652 . _:genid4652 . _:genid4652 . _:genid4652 "true"^^ . _:genid4653 . _:genid4653 . _:genid4653 . _:genid4653 "A type of mixed support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion."^^ . _:genid4653 "ECO:SN"^^ . . _:genid4654 . _:genid4655 . _:genid4657 _:genid4656 . _:genid4655 _:genid4657 . _:genid4656 . _:genid4656 . _:genid4656 . _:genid4657 . _:genid4654 _:genid4655 . _:genid4654 . . . "IEP"^^ . "A type of mixed support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion"^^ . "NCBI-RefSeq"^^ . "snadendla"^^ . "mixed support of intron positions by RNA-seq alignment evidence used in manual assertion"^^ . "eco"^^ . "ECO:0006174"^^ . "mixed support of intron positions by RNA-sequencing alignment evidence used in manual assertion"^^ . _:genid4658 . _:genid4658 . _:genid4658 . _:genid4658 . _:genid4658 "true"^^ . _:genid4659 . _:genid4659 . _:genid4659 . _:genid4659 "A type of mixed support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion"^^ . _:genid4659 "ECO:SN"^^ . . . "A type of nuclear magnetic resonance spectroscopy evidence resulting from measuring the change in a certain type of NMR spectrum as a result of the spontenaous exchange of hydrogen and deuterium nuclei between the sample and the solvent."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "NMR HDX"^^ . "eco"^^ . "ECO:0006175"^^ . "nuclear magnetic resonance spectroscopy-based hydrogen-deuterium exchange evidence"^^ . _:genid4660 . _:genid4660 . _:genid4660 . _:genid4660 "A type of nuclear magnetic resonance spectroscopy evidence resulting from measuring the change in a certain type of NMR spectrum as a result of the spontenaous exchange of hydrogen and deuterium nuclei between the sample and the solvent."^^ . _:genid4660 "PMID:20960033"^^ . _:genid4660 "PMID:28538145"^^ . _:genid4660 "url:https://en.wikipedia.org/wiki/Hydrogen%E2%80%93deuterium_exchange#NMR_spectroscopy"^^ . . . "A type of nuclear magnetic resonance spectroscopy evidence in which the electromagnetic singal being measured comes from the perturbation of hydrogen nuclei resulting in a one dimensional spectrum."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "1D NMR"^^ . "proton NMR"^^ . "eco"^^ . "ECO:0006176"^^ . "proton-based nuclear magnetic resonance evidence"^^ . _:genid4661 . _:genid4661 . _:genid4661 . _:genid4661 "A type of nuclear magnetic resonance spectroscopy evidence in which the electromagnetic singal being measured comes from the perturbation of hydrogen nuclei resulting in a one dimensional spectrum."^^ . _:genid4661 "url:https://en.wikipedia.org/wiki/Proton_nuclear_magnetic_resonance"^^ . . . . "A type of spectrometry evidence derived from irradiating a sample with light (either visible, infrared or ultraviolet wavelengths) and observing the difference of absorption of left-handed and right-handed light by the sample by comparing the extent of circular polarization in the incident and the emitted light."^^ . "DisProt:BalintMeszaros"^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "CD"^^ . "eco"^^ . "ECO:0006177"^^ . "circular dichroism evidence"^^ . _:genid4662 . _:genid4662 . _:genid4662 . _:genid4662 "A type of spectrometry evidence derived from irradiating a sample with light (either visible, infrared or ultraviolet wavelengths) and observing the difference of absorption of left-handed and right-handed light by the sample by comparing the extent of circular polarization in the incident and the emitted light."^^ . _:genid4662 "PMID:17464384"^^ . _:genid4662 "url:https://en.wikipedia.org/wiki/Circular_dichroism"^^ . . . "A type of circular dichroism evidence where the source of radiation is radially accelerated particles, most often moving on a circular path in a synchrotron, typically providing lower wavelengths and therefore higher signal-to-noise ratio compared to regular circular dichroism measurements."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "SRCD"^^ . "eco"^^ . "ECO:0006178"^^ . "synchrotron radiation circular dichroism evidence"^^ . _:genid4663 . _:genid4663 . _:genid4663 . _:genid4663 "A type of circular dichroism evidence where the source of radiation is radially accelerated particles, most often moving on a circular path in a synchrotron, typically providing lower wavelengths and therefore higher signal-to-noise ratio compared to regular circular dichroism measurements."^^ . _:genid4663 "PMID:20658968"^^ . . . "A type of circular dichroism evidence whose spectrum is in the range of 190-230 nm, providing information mainly about amide bonds and through which the relative proportion of secondary structure elements of a protein can be estimated."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "far-UV CD"^^ . "eco"^^ . "ECO:0006179"^^ . "far-UV circular dichroism evidence"^^ . _:genid4664 . _:genid4664 . _:genid4664 . _:genid4664 "A type of circular dichroism evidence whose spectrum is in the range of 190-230 nm, providing information mainly about amide bonds and through which the relative proportion of secondary structure elements of a protein can be estimated."^^ . _:genid4664 "PMID:17464384"^^ . . . "A type of circular dichroism evidence whose spectrum is in the range of 250-350 nm , providing information mainly about aromatic residues, i.e. phenylalanine, tyrosine and tryptophan, through which it provides information on the tertiary structure of a protein."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "near-UV CD"^^ . "eco"^^ . "ECO:0006180"^^ . "near-UV circular dichroism evidence"^^ . _:genid4665 . _:genid4665 . _:genid4665 . _:genid4665 "A type of circular dichroism evidence whose spectrum is in the range of 250-350 nm , providing information mainly about aromatic residues, i.e. phenylalanine, tyrosine and tryptophan, through which it provides information on the tertiary structure of a protein."^^ . _:genid4665 "PMID:17464384"^^ . . . "A type of electron microscopy evidence where the sample being studied has been cooled to cryogenic temperatures (typically below -153 degrees Celsius) prior to the experiment."^^ . "DisProt:BalintMeszaros"^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "cryo-EM"^^ . "eco"^^ . "ECO:0006181"^^ . "cryogenic electron microscopy evidence"^^ . _:genid4666 . _:genid4666 . _:genid4666 . _:genid4666 "A type of electron microscopy evidence where the sample being studied has been cooled to cryogenic temperatures (typically below -153 degrees Celsius) prior to the experiment."^^ . _:genid4666 "PMID:31078399"^^ . _:genid4666 "url:https://en.wikipedia.org/wiki/Cryogenic_electron_microscopy"^^ . . . "A type of light scattering evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight and structural transitions by irradiating the sample with an X-ray beam and the scattered intensity is probed at small angles (typically in the range of 0.1-10 degrees) by a detector."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "SAXS"^^ . "eco"^^ . "ECO:0006182"^^ . "small-angle X-ray scattering evidence"^^ . _:genid4667 . _:genid4667 . _:genid4667 . _:genid4667 "A type of light scattering evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight and structural transitions by irradiating the sample with an X-ray beam and the scattered intensity is probed at small angles (typically in the range of 0.1-10 degrees) by a detector."^^ . _:genid4667 "PMID:26320411"^^ . _:genid4667 "url:https://en.wikipedia.org/wiki/Small-angle_X-ray_scattering"^^ . . . "A type of structure determination evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight, diffusion and interaction strength by irradiating the sample with a particle beam and the scattered intensity is probed at a certain angle by a detector."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006183"^^ . "particle scattering evidence"^^ . _:genid4668 . _:genid4668 . _:genid4668 . _:genid4668 "A type of structure determination evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight, diffusion and interaction strength by irradiating the sample with a particle beam and the scattered intensity is probed at a certain angle by a detector."^^ . _:genid4668 "DisProt:BalintMeszaros"^^ . . . "A type of particle scattering evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight and structural transitions by irradiating the sample with a beam of thermal neutrons and the scattered intensity is probed at small angles (typically in the range of 0.1-10 degrees) by a detector."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "SANS"^^ . "eco"^^ . "ECO:0006184"^^ . "small-angle neutron scattering evidence"^^ . _:genid4669 . _:genid4669 . _:genid4669 . _:genid4669 "A type of particle scattering evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight and structural transitions by irradiating the sample with a beam of thermal neutrons and the scattered intensity is probed at small angles (typically in the range of 0.1-10 degrees) by a detector."^^ . _:genid4669 "PMID:17714935"^^ . _:genid4669 "url:https://en.wikipedia.org/wiki/Small-angle_neutron_scattering"^^ . . . . "A type of inferential evidence where an assertion is derived by the authors of a scientific publication from another assertion and/or primary data via logical inference or other rational means."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006185"^^ . "author inference"^^ . _:genid4670 . _:genid4670 . _:genid4670 . _:genid4670 "A type of inferential evidence where an assertion is derived by the authors of a scientific publication from another assertion and/or primary data via logical inference or other rational means."^^ . _:genid4670 "DisProt:BalintMeszaros"^^ . . . "A type of combinatorial experimental and author inference evidence where the experimental results and author inference are contained in a single publication. "^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006186"^^ . "combinatorial experimental and author inference evidence contained in single publication"^^ . _:genid4671 . _:genid4671 . _:genid4671 . _:genid4671 "A type of combinatorial experimental and author inference evidence where the experimental results and author inference are contained in a single publication. "^^ . _:genid4671 "ECO:MG"^^ . . . "A type of X-ray cystallography evidence in which a structural model is built lacking coordinates for some residues indicating high flexibility or structural disorder in that area of the molecule."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006187"^^ . "X-ray crystallography-based structural model with missing residue coordinates"^^ . _:genid4672 . _:genid4672 . _:genid4672 . _:genid4672 "A type of X-ray cystallography evidence in which a structural model is built lacking coordinates for some residues indicating high flexibility or structural disorder in that area of the molecule."^^ . _:genid4672 "DisProt:BalintMeszaros"^^ . . . "A type of X-ray cystallography evidence in which a structural model is built that contains high relative B-factor values indicating flexibility in that area of the molecule."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006188"^^ . "X-ray crystallography-based structural model with high relative B-factor values"^^ . _:genid4673 . _:genid4673 . _:genid4673 . _:genid4673 "A type of X-ray cystallography evidence in which a structural model is built that contains high relative B-factor values indicating flexibility in that area of the molecule."^^ . _:genid4673 "DisProt:BalintMeszaros"^^ . . . "A type of cryogenic electron microscopy evidence in which a structural model is built lacking coordinates for some residues indicating high flexibility or structural disorder in that area of the molecule."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006189"^^ . "cryogenic electron microscopy-based structural model with missing residue coordinates"^^ . _:genid4674 . _:genid4674 . _:genid4674 . _:genid4674 "A type of cryogenic electron microscopy evidence in which a structural model is built lacking coordinates for some residues indicating high flexibility or structural disorder in that area of the molecule."^^ . _:genid4674 "DisProt:BalintMeszaros"^^ . . . "A type of cryogenic electron microscopy evidence in which a structural model is built that contains high relative B-factor values indicating flexibility in that area of the molecule."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006190"^^ . "cryogenic electron microscopy-based structural model with high relative B-factor values"^^ . _:genid4675 . _:genid4675 . _:genid4675 . _:genid4675 "A type of cryogenic electron microscopy evidence in which a structural model is built that contains high relative B-factor values indicating flexibility in that area of the molecule."^^ . _:genid4675 "DisProt:BalintMeszaros"^^ . . . "A type of spectrophotometry evidence resulting from the evaluation of a molecule in a fluid or solid state by its ability to alter the transmission of infrared light, where the raw data collected is transformed into the specturm by Fourier transform."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "FT-IR"^^ . "FTIR"^^ . "eco"^^ . "ECO:0006191"^^ . "Fourier-transform infrared spectroscopy evidence"^^ . _:genid4676 . _:genid4676 . _:genid4676 . _:genid4676 "A type of spectrophotometry evidence resulting from the evaluation of a molecule in a fluid or solid state by its ability to alter the transmission of infrared light, where the raw data collected is transformed into the specturm by Fourier transform."^^ . _:genid4676 "url:https://en.wikipedia.org/wiki/Fourier-transform_infrared_spectroscopy"^^ . . . "A type of direct assay evidence derived from measuring the amount of heat absorbed or released by a sample to monitor chemical reactions, phase transitions or other processes affecting the physical state or chemical composition."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "calorimetry evidence"^^ . "eco"^^ . "ECO:0006192"^^ . "heat capacity-based evidence"^^ . _:genid4677 . _:genid4677 . _:genid4677 . _:genid4677 "A type of direct assay evidence derived from measuring the amount of heat absorbed or released by a sample to monitor chemical reactions, phase transitions or other processes affecting the physical state or chemical composition."^^ . _:genid4677 "url:https://en.wikipedia.org/wiki/Calorimetry"^^ . . . "A type of heat capacity-based evidence where the heat required to increase the temperature of the sample is continuously monitored and compared to the heat required to increase the temperature of a reference (having a largely identical composition compared to the sample, such as the empty buffer compared to a protein solution) over a range of temperatures."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "DSC"^^ . "eco"^^ . "ECO:0006193"^^ . "differential scanning calorimetry evidence"^^ . _:genid4678 . _:genid4678 . _:genid4678 . _:genid4678 "A type of heat capacity-based evidence where the heat required to increase the temperature of the sample is continuously monitored and compared to the heat required to increase the temperature of a reference (having a largely identical composition compared to the sample, such as the empty buffer compared to a protein solution) over a range of temperatures."^^ . _:genid4678 "url:https://en.wikipedia.org/wiki/Differential_scanning_calorimetry"^^ . . . . "Here, we describe the generation, characterisation, and utility of a monoclonal antibody that selectively binds with high affinity to the asymmetric TNF trimer\u2013small molecule complex. The antibody helps to define the molecular dynamics of the apo TNF trimer, reveals the mode of action and specificity of the small molecule inhibitors, acts as a chaperone in solving the human TNF\u2013TNFR1 complex crystal structure, and facilitates the measurement of small molecule target occupancy in complex biological samples."^^ . "A type of immunodetection assay evidence that involves the use of antibodies that are selective to conformations of the epitope to which they bind in order to provide information on conformations present in a target molecule."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006194"^^ . "selective antibody-based structural conformation evidence"^^ . _:genid4679 . _:genid4679 . _:genid4679 . _:genid4679 "Here, we describe the generation, characterisation, and utility of a monoclonal antibody that selectively binds with high affinity to the asymmetric TNF trimer\u2013small molecule complex. The antibody helps to define the molecular dynamics of the apo TNF trimer, reveals the mode of action and specificity of the small molecule inhibitors, acts as a chaperone in solving the human TNF\u2013TNFR1 complex crystal structure, and facilitates the measurement of small molecule target occupancy in complex biological samples."^^ . _:genid4679 "PMID:33495445"^^ . _:genid4680 . _:genid4680 . _:genid4680 . _:genid4680 "A type of immunodetection assay evidence that involves the use of antibodies that are selective to conformations of the epitope to which they bind in order to provide information on conformations present in a target molecule."^^ . _:genid4680 "DisProt:BalintMeszaros"^^ . . . "A type of mass spectrometry evidence derived from measuring changes in mass associated with the isotopic exchange between amide hydrogens of the protein backbone and its surrounding solvent, providing information on the structural state, the dynamics and the intrinsic chemical properties of the underlying amino acid sequence."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "HDX-MS"^^ . "eco"^^ . "ECO:0006195"^^ . "protein hydrogen-deuterium exchange mass spectrometry evidence"^^ . _:genid4681 . _:genid4681 . _:genid4681 . _:genid4681 "A type of mass spectrometry evidence derived from measuring changes in mass associated with the isotopic exchange between amide hydrogens of the protein backbone and its surrounding solvent, providing information on the structural state, the dynamics and the intrinsic chemical properties of the underlying amino acid sequence."^^ . _:genid4681 "PMID:31249422"^^ . _:genid4681 "url:https://en.wikipedia.org/wiki/Hydrogen%E2%80%93deuterium_exchange#Mass_spectrometry"^^ . . _:genid4682 . _:genid4683 . _:genid4685 _:genid4684 . _:genid4683 _:genid4685 . _:genid4684 . _:genid4684 . _:genid4684 . _:genid4685 . _:genid4682 _:genid4683 . _:genid4682 . . . "EXP"^^ . "A type of nuclear magnetic resonance spectroscopy-based hydrogen-deuterium exchange evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "NMR HDX"^^ . "eco"^^ . "ECO:0006196"^^ . "nuclear magnetic resonance spectroscopy-based hydrogen-deuterium exchange evidence used in manual assertion"^^ . _:genid4686 . _:genid4686 . _:genid4686 . _:genid4686 . _:genid4686 "true"^^ . _:genid4687 . _:genid4687 . _:genid4687 . _:genid4687 "A type of nuclear magnetic resonance spectroscopy-based hydrogen-deuterium exchange evidence that is used in a manual assertion."^^ . _:genid4687 "ECO:SN"^^ . . _:genid4688 . _:genid4689 . _:genid4691 _:genid4690 . _:genid4689 _:genid4691 . _:genid4690 . _:genid4690 . _:genid4690 . _:genid4691 . _:genid4688 _:genid4689 . _:genid4688 . . . "IEA"^^ . "A type of nuclear magnetic resonance spectroscopy-based hydrogen-deuterium exchange evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "NMR HDX"^^ . "eco"^^ . "ECO:0006197"^^ . "nuclear magnetic resonance spectroscopy-based hydrogen-deuterium exchange evidence used in automatic assertion"^^ . _:genid4692 . _:genid4692 . _:genid4692 . _:genid4692 . _:genid4692 "true"^^ . _:genid4693 . _:genid4693 . _:genid4693 . _:genid4693 "A type of nuclear magnetic resonance spectroscopy-based hydrogen-deuterium exchange evidence that is used in an automatic assertion."^^ . _:genid4693 "ECO:SN"^^ . . _:genid4694 . _:genid4695 . _:genid4697 _:genid4696 . _:genid4695 _:genid4697 . _:genid4696 . _:genid4696 . _:genid4696 . _:genid4697 . _:genid4694 _:genid4695 . _:genid4694 . . . "EXP"^^ . "A type of proton-based nuclear magnetic resonance evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "1D NMR"^^ . "proton NMR"^^ . "eco"^^ . "ECO:0006198"^^ . "proton-based nuclear magnetic resonance evidence used in manual assertion"^^ . _:genid4698 . _:genid4698 . _:genid4698 . _:genid4698 . _:genid4698 "true"^^ . _:genid4699 . _:genid4699 . _:genid4699 . _:genid4699 "A type of proton-based nuclear magnetic resonance evidence that is used in a manual assertion."^^ . _:genid4699 "ECO:SN"^^ . . _:genid4700 . _:genid4701 . _:genid4703 _:genid4702 . _:genid4701 _:genid4703 . _:genid4702 . _:genid4702 . _:genid4702 . _:genid4703 . _:genid4700 _:genid4701 . _:genid4700 . . . "IEA"^^ . "A type of proton-based nuclear magnetic resonance evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "1D NMR"^^ . "proton NMR"^^ . "eco"^^ . "ECO:0006199"^^ . "proton-based nuclear magnetic resonance evidence used in automatic assertion"^^ . _:genid4704 . _:genid4704 . _:genid4704 . _:genid4704 . _:genid4704 "true"^^ . _:genid4705 . _:genid4705 . _:genid4705 . _:genid4705 "A type of proton-based nuclear magnetic resonance evidence that is used in an automatic assertion."^^ . _:genid4705 "ECO:SN"^^ . . _:genid4706 . _:genid4707 . _:genid4709 _:genid4708 . _:genid4707 _:genid4709 . _:genid4708 . _:genid4708 . _:genid4708 . _:genid4709 . _:genid4706 _:genid4707 . _:genid4706 . . . "EXP"^^ . "A type of circular dichroism evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "CD"^^ . "eco"^^ . "ECO:0006200"^^ . "circular dichroism evidence used in manual assertion"^^ . _:genid4710 . _:genid4710 . _:genid4710 . _:genid4710 . _:genid4710 "true"^^ . _:genid4711 . _:genid4711 . _:genid4711 . _:genid4711 "A type of circular dichroism evidence that is used in a manual assertion."^^ . _:genid4711 "ECO:SN"^^ . . _:genid4712 . _:genid4713 . _:genid4715 _:genid4714 . _:genid4713 _:genid4715 . _:genid4714 . _:genid4714 . _:genid4714 . _:genid4715 . _:genid4712 _:genid4713 . _:genid4712 . . . . "IEA"^^ . "A type of circular dichroism evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "CD"^^ . "eco"^^ . "ECO:0006201"^^ . "circular dichroism evidence used in automatic assertion"^^ . _:genid4716 . _:genid4716 . _:genid4716 . _:genid4716 . _:genid4716 "true"^^ . _:genid4717 . _:genid4717 . _:genid4717 . _:genid4717 . _:genid4717 "true"^^ . _:genid4718 . _:genid4718 . _:genid4718 . _:genid4718 "A type of circular dichroism evidence that is used in an automatic assertion."^^ . _:genid4718 "ECO:SN"^^ . . _:genid4719 . _:genid4720 . _:genid4722 _:genid4721 . _:genid4720 _:genid4722 . _:genid4721 . _:genid4721 . _:genid4721 . _:genid4722 . _:genid4719 _:genid4720 . _:genid4719 . . . "EXP"^^ . "A type of synchrotron radiation circular dichroism evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "SRCD"^^ . "eco"^^ . "ECO:0006202"^^ . "synchrotron radiation circular dichroism evidence used in manual assertion"^^ . _:genid4723 . _:genid4723 . _:genid4723 . _:genid4723 . _:genid4723 "true"^^ . _:genid4724 . _:genid4724 . _:genid4724 . _:genid4724 "A type of synchrotron radiation circular dichroism evidence that is used in a manual assertion."^^ . _:genid4724 "ECO:SN"^^ . . _:genid4725 . _:genid4726 . _:genid4728 _:genid4727 . _:genid4726 _:genid4728 . _:genid4727 . _:genid4727 . _:genid4727 . _:genid4728 . _:genid4725 _:genid4726 . _:genid4725 . . . "IEA"^^ . "A type of synchrotron radiation circular dichroism evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "SRCD"^^ . "eco"^^ . "ECO:0006203"^^ . "synchrotron radiation circular dichroism evidence used in automatic assertion"^^ . _:genid4729 . _:genid4729 . _:genid4729 . _:genid4729 . _:genid4729 "true"^^ . _:genid4730 . _:genid4730 . _:genid4730 . _:genid4730 "A type of synchrotron radiation circular dichroism evidence that is used in an automatic assertion."^^ . _:genid4730 "ECO:SN"^^ . . _:genid4731 . _:genid4732 . _:genid4734 _:genid4733 . _:genid4732 _:genid4734 . _:genid4733 . _:genid4733 . _:genid4733 . _:genid4734 . _:genid4731 _:genid4732 . _:genid4731 . . . "EXP"^^ . "A type of far-UV circular dichroism evidence that is used in a manual assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "far-UV CD"^^ . "eco"^^ . "ECO:0006204"^^ . "far-UV circular dichroism evidence used in manual assertion"^^ . _:genid4735 . _:genid4735 . _:genid4735 . _:genid4735 . _:genid4735 "true"^^ . _:genid4736 . _:genid4736 . _:genid4736 . _:genid4736 "A type of far-UV circular dichroism evidence that is used in a manual assertion."^^ . _:genid4736 "ECO:SN"^^ . . _:genid4737 . _:genid4738 . _:genid4740 _:genid4739 . _:genid4738 _:genid4740 . _:genid4739 . _:genid4739 . _:genid4739 . _:genid4740 . _:genid4737 _:genid4738 . _:genid4737 . . . "IEA"^^ . "A type of far-UV circular dichroism evidence that is used in an automatic assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "far-UV CD"^^ . "eco"^^ . "ECO:0006205"^^ . "far-UV circular dichroism evidence used in automatic assertion"^^ . _:genid4741 . _:genid4741 . _:genid4741 . _:genid4741 . _:genid4741 "true"^^ . _:genid4742 . _:genid4742 . _:genid4742 . _:genid4742 "A type of far-UV circular dichroism evidence that is used in an automatic assertion."^^ . _:genid4742 "ECO:SN"^^ . . _:genid4743 . _:genid4744 . _:genid4746 _:genid4745 . _:genid4744 _:genid4746 . _:genid4745 . _:genid4745 . _:genid4745 . _:genid4746 . _:genid4743 _:genid4744 . _:genid4743 . . . "EXP"^^ . "A type of near-UV circular dichroism evidence that is used in a manual assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "near-UV CD"^^ . "eco"^^ . "ECO:0006206"^^ . "near-UV circular dichroism evidence used in manual assertion"^^ . _:genid4747 . _:genid4747 . _:genid4747 . _:genid4747 . _:genid4747 "true"^^ . _:genid4748 . _:genid4748 . _:genid4748 . _:genid4748 "A type of near-UV circular dichroism evidence that is used in a manual assertion."^^ . _:genid4748 "ECO:SN"^^ . . _:genid4749 . _:genid4750 . _:genid4752 _:genid4751 . _:genid4750 _:genid4752 . _:genid4751 . _:genid4751 . _:genid4751 . _:genid4752 . _:genid4749 _:genid4750 . _:genid4749 . . . "IEA"^^ . "A type of near-UV circular dichroism evidence that is used in an automatic assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "near-UV CD"^^ . "eco"^^ . "ECO:0006207"^^ . "near-UV circular dichroism evidence used in automatic assertion"^^ . _:genid4753 . _:genid4753 . _:genid4753 . _:genid4753 . _:genid4753 "true"^^ . _:genid4754 . _:genid4754 . _:genid4754 . _:genid4754 "A type of near-UV circular dichroism evidence that is used in an automatic assertion."^^ . _:genid4754 "ECO:SN"^^ . . _:genid4755 . _:genid4756 . _:genid4758 _:genid4757 . _:genid4756 _:genid4758 . _:genid4757 . _:genid4757 . _:genid4757 . _:genid4758 . _:genid4755 _:genid4756 . _:genid4755 . . . "IDA"^^ . "A type of cryogenic electron microscopy evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "cryo-EM"^^ . "eco"^^ . "ECO:0006208"^^ . "cryogenic electron microscopy evidence used in manual assertion"^^ . _:genid4759 . _:genid4759 . _:genid4759 . _:genid4759 . _:genid4759 "true"^^ . _:genid4760 . _:genid4760 . _:genid4760 . _:genid4760 "A type of cryogenic electron microscopy evidence that is used in a manual assertion."^^ . _:genid4760 "ECO:SN"^^ . . _:genid4761 . _:genid4762 . _:genid4764 _:genid4763 . _:genid4762 _:genid4764 . _:genid4763 . _:genid4763 . _:genid4763 . _:genid4764 . _:genid4761 _:genid4762 . _:genid4761 . . . "IEA"^^ . "A type of cryogenic electron microscopy evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "cryo-EM"^^ . "eco"^^ . "ECO:0006209"^^ . "cryogenic electron microscopy evidence used in automatic assertion"^^ . _:genid4765 . _:genid4765 . _:genid4765 . _:genid4765 . _:genid4765 "true"^^ . _:genid4766 . _:genid4766 . _:genid4766 . _:genid4766 "A type of cryogenic electron microscopy evidence that is used in an automatic assertion."^^ . _:genid4766 "ECO:SN"^^ . . _:genid4767 . _:genid4768 . _:genid4770 _:genid4769 . _:genid4768 _:genid4770 . _:genid4769 . _:genid4769 . _:genid4769 . _:genid4770 . _:genid4767 _:genid4768 . _:genid4767 . . . "EXP"^^ . "A type of small-angle X-ray scattering evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "SAXS"^^ . "eco"^^ . "ECO:0006210"^^ . "small-angle X-ray scattering evidence used in manual assertion"^^ . _:genid4771 . _:genid4771 . _:genid4771 . _:genid4771 . _:genid4771 "true"^^ . _:genid4772 . _:genid4772 . _:genid4772 . _:genid4772 "A type of small-angle X-ray scattering evidence that is used in a manual assertion."^^ . _:genid4772 "ECO:SN"^^ . . _:genid4773 . _:genid4774 . _:genid4776 _:genid4775 . _:genid4774 _:genid4776 . _:genid4775 . _:genid4775 . _:genid4775 . _:genid4776 . _:genid4773 _:genid4774 . _:genid4773 . . . "IEA"^^ . "A type of small-angle X-ray scattering evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "SAXS"^^ . "eco"^^ . "ECO:0006211"^^ . "small-angle X-ray scattering evidence used in automatic assertion"^^ . _:genid4777 . _:genid4777 . _:genid4777 . _:genid4777 . _:genid4777 "true"^^ . _:genid4778 . _:genid4778 . _:genid4778 . _:genid4778 "A type of small-angle X-ray scattering evidence that is used in an automatic assertion."^^ . _:genid4778 "ECO:SN"^^ . . _:genid4779 . _:genid4780 . _:genid4782 _:genid4781 . _:genid4780 _:genid4782 . _:genid4781 . _:genid4781 . _:genid4781 . _:genid4782 . _:genid4779 _:genid4780 . _:genid4779 . . . "EXP"^^ . "A type of particle scattering evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006212"^^ . "particle scattering evidence used in manual assertion"^^ . _:genid4783 . _:genid4783 . _:genid4783 . _:genid4783 . _:genid4783 "true"^^ . _:genid4784 . _:genid4784 . _:genid4784 . _:genid4784 "A type of particle scattering evidence that is used in a manual assertion."^^ . _:genid4784 "ECO:SN"^^ . . _:genid4785 . _:genid4786 . _:genid4788 _:genid4787 . _:genid4786 _:genid4788 . _:genid4787 . _:genid4787 . _:genid4787 . _:genid4788 . _:genid4785 _:genid4786 . _:genid4785 . . . "IEA"^^ . "A type of particle scattering evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006213"^^ . "particle scattering evidence used in automatic assertion"^^ . _:genid4789 . _:genid4789 . _:genid4789 . _:genid4789 . _:genid4789 "true"^^ . _:genid4790 . _:genid4790 . _:genid4790 . _:genid4790 "A type of particle scattering evidence that is used in an automatic assertion."^^ . _:genid4790 "ECO:SN"^^ . . _:genid4791 . _:genid4792 . _:genid4794 _:genid4793 . _:genid4792 _:genid4794 . _:genid4793 . _:genid4793 . _:genid4793 . _:genid4794 . _:genid4791 _:genid4792 . _:genid4791 . . . "EXP"^^ . "A type of small-angle neutron scattering evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "SANS"^^ . "eco"^^ . "ECO:0006214"^^ . "small-angle neutron scattering evidence used in manual assertion"^^ . _:genid4795 . _:genid4795 . _:genid4795 . _:genid4795 . _:genid4795 "true"^^ . _:genid4796 . _:genid4796 . _:genid4796 . _:genid4796 "A type of small-angle neutron scattering evidence that is used in a manual assertion."^^ . _:genid4796 "ECO:SN"^^ . . _:genid4797 . _:genid4798 . _:genid4800 _:genid4799 . _:genid4798 _:genid4800 . _:genid4799 . _:genid4799 . _:genid4799 . _:genid4800 . _:genid4797 _:genid4798 . _:genid4797 . . . "IEA"^^ . "A type of small-angle neutron scattering evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "SANS"^^ . "eco"^^ . "ECO:0006215"^^ . "small-angle neutron scattering evidence used in automatic assertion"^^ . _:genid4801 . _:genid4801 . _:genid4801 . _:genid4801 . _:genid4801 "true"^^ . _:genid4802 . _:genid4802 . _:genid4802 . _:genid4802 "A type of small-angle neutron scattering evidence that is used in an automatic assertion."^^ . _:genid4802 "ECO:SN"^^ . . _:genid4803 . _:genid4804 . _:genid4806 _:genid4805 . _:genid4804 _:genid4806 . _:genid4805 . _:genid4805 . _:genid4805 . _:genid4806 . _:genid4803 _:genid4804 . _:genid4803 . . . . "A type of author inference that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006216"^^ . "author inference used in manual assertion"^^ . _:genid4807 . _:genid4807 . _:genid4807 . _:genid4807 . _:genid4807 "true"^^ . _:genid4808 . _:genid4808 . _:genid4808 . _:genid4808 . _:genid4808 "true"^^ . _:genid4809 . _:genid4809 . _:genid4809 . _:genid4809 "A type of author inference that is used in a manual assertion."^^ . _:genid4809 "ECO:SN"^^ . . _:genid4810 . _:genid4811 . _:genid4813 _:genid4812 . _:genid4811 _:genid4813 . _:genid4812 . _:genid4812 . _:genid4812 . _:genid4813 . _:genid4810 _:genid4811 . _:genid4810 . . . . "IEA"^^ . "A type of author inference that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006217"^^ . "author inference used in automatic assertion"^^ . _:genid4814 . _:genid4814 . _:genid4814 . _:genid4814 . _:genid4814 "true"^^ . _:genid4815 . _:genid4815 . _:genid4815 . _:genid4815 . _:genid4815 "true"^^ . _:genid4816 . _:genid4816 . _:genid4816 . _:genid4816 "A type of author inference that is used in an automatic assertion."^^ . _:genid4816 "ECO:SN"^^ . . _:genid4817 . _:genid4818 . _:genid4820 _:genid4819 . _:genid4818 _:genid4820 . _:genid4819 . _:genid4819 . _:genid4819 . _:genid4820 . _:genid4817 _:genid4818 . _:genid4817 . . . "A type of combinatorial experimental and author inference evidence contained in single publication that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006218"^^ . "combinatorial experimental and author inference evidence contained in single publication used in manual assertion"^^ . _:genid4821 . _:genid4821 . _:genid4821 . _:genid4821 . _:genid4821 "true"^^ . _:genid4822 . _:genid4822 . _:genid4822 . _:genid4822 "A type of combinatorial experimental and author inference evidence contained in single publication that is used in a manual assertion."^^ . _:genid4822 "ECO:SN"^^ . . _:genid4823 . _:genid4824 . _:genid4826 _:genid4825 . _:genid4824 _:genid4826 . _:genid4825 . _:genid4825 . _:genid4825 . _:genid4826 . _:genid4823 _:genid4824 . _:genid4823 . . . "IEA"^^ . "A type of combinatorial experimental and author inference evidence contained in single publication that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006219"^^ . "combinatorial experimental and author inference evidence contained in single publication used in automatic assertion"^^ . _:genid4827 . _:genid4827 . _:genid4827 . _:genid4827 . _:genid4827 "true"^^ . _:genid4828 . _:genid4828 . _:genid4828 . _:genid4828 "A type of combinatorial experimental and author inference evidence contained in single publication that is used in an automatic assertion."^^ . _:genid4828 "ECO:SN"^^ . . _:genid4829 . _:genid4830 . _:genid4832 _:genid4831 . _:genid4830 _:genid4832 . _:genid4831 . _:genid4831 . _:genid4831 . _:genid4832 . _:genid4829 _:genid4830 . _:genid4829 . . . "EXP"^^ . "A type of X-ray crystallography-based structural model with missing residue coordinates that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006220"^^ . "X-ray crystallography-based structural model with missing residue coordinates used in manual assertion"^^ . _:genid4833 . _:genid4833 . _:genid4833 . _:genid4833 . _:genid4833 "true"^^ . _:genid4834 . _:genid4834 . _:genid4834 . _:genid4834 "A type of X-ray crystallography-based structural model with missing residue coordinates that is used in a manual assertion."^^ . _:genid4834 "ECO:SN"^^ . . _:genid4835 . _:genid4836 . _:genid4838 _:genid4837 . _:genid4836 _:genid4838 . _:genid4837 . _:genid4837 . _:genid4837 . _:genid4838 . _:genid4835 _:genid4836 . _:genid4835 . . . "IEA"^^ . "A type of X-ray crystallography-based structural model with missing residue coordinates that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006221"^^ . "X-ray crystallography-based structural model with missing residue coordinates used in automatic assertion"^^ . _:genid4839 . _:genid4839 . _:genid4839 . _:genid4839 . _:genid4839 "true"^^ . _:genid4840 . _:genid4840 . _:genid4840 . _:genid4840 "A type of X-ray crystallography-based structural model with missing residue coordinates that is used in an automatic assertion."^^ . _:genid4840 "ECO:SN"^^ . . _:genid4841 . _:genid4842 . _:genid4844 _:genid4843 . _:genid4842 _:genid4844 . _:genid4843 . _:genid4843 . _:genid4843 . _:genid4844 . _:genid4841 _:genid4842 . _:genid4841 . . . "EXP"^^ . "A type of X-ray crystallography-based structural model with high relative B-factor values that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006222"^^ . "X-ray crystallography-based structural model with high relative B-factor values used in manual assertion"^^ . _:genid4845 . _:genid4845 . _:genid4845 . _:genid4845 . _:genid4845 "true"^^ . _:genid4846 . _:genid4846 . _:genid4846 . _:genid4846 "A type of X-ray crystallography-based structural model with high relative B-factor values that is used in a manual assertion."^^ . _:genid4846 "ECO:SN"^^ . . _:genid4847 . _:genid4848 . _:genid4850 _:genid4849 . _:genid4848 _:genid4850 . _:genid4849 . _:genid4849 . _:genid4849 . _:genid4850 . _:genid4847 _:genid4848 . _:genid4847 . . . "IEA"^^ . "A type of X-ray crystallography-based structural model with high relative B-factor values that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006223"^^ . "X-ray crystallography-based structural model with high relative B-factor values used in automatic assertion"^^ . _:genid4851 . _:genid4851 . _:genid4851 . _:genid4851 . _:genid4851 "true"^^ . _:genid4852 . _:genid4852 . _:genid4852 . _:genid4852 "A type of X-ray crystallography-based structural model with high relative B-factor values that is used in an automatic assertion."^^ . _:genid4852 "ECO:SN"^^ . . _:genid4853 . _:genid4854 . _:genid4856 _:genid4855 . _:genid4854 _:genid4856 . _:genid4855 . _:genid4855 . _:genid4855 . _:genid4856 . _:genid4853 _:genid4854 . _:genid4853 . . . "IDA"^^ . "A type of cryogenic electron microscopy-based structural model with missing residue coordinates that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006224"^^ . "cryogenic electron microscopy-based structural model with missing residue coordinates used in manual assertion"^^ . _:genid4857 . _:genid4857 . _:genid4857 . _:genid4857 . _:genid4857 "true"^^ . _:genid4858 . _:genid4858 . _:genid4858 . _:genid4858 "A type of cryogenic electron microscopy-based structural model with missing residue coordinates that is used in a manual assertion."^^ . _:genid4858 "ECO:SN"^^ . . _:genid4859 . _:genid4860 . _:genid4862 _:genid4861 . _:genid4860 _:genid4862 . _:genid4861 . _:genid4861 . _:genid4861 . _:genid4862 . _:genid4859 _:genid4860 . _:genid4859 . . . "IEA"^^ . "A type of cryogenic electron microscopy-based structural model with missing residue coordinates that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006225"^^ . "cryogenic electron microscopy-based structural model with missing residue coordinates used in automatic assertion"^^ . _:genid4863 . _:genid4863 . _:genid4863 . _:genid4863 . _:genid4863 "true"^^ . _:genid4864 . _:genid4864 . _:genid4864 . _:genid4864 "A type of cryogenic electron microscopy-based structural model with missing residue coordinates that is used in an automatic assertion."^^ . _:genid4864 "ECO:SN"^^ . . _:genid4865 . _:genid4866 . _:genid4868 _:genid4867 . _:genid4866 _:genid4868 . _:genid4867 . _:genid4867 . _:genid4867 . _:genid4868 . _:genid4865 _:genid4866 . _:genid4865 . . . "IDA"^^ . "A type of cryogenic electron microscopy-based structural model with high relative B-factor values that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006226"^^ . "cryogenic electron microscopy-based structural model with high relative B-factor values used in manual assertion"^^ . _:genid4869 . _:genid4869 . _:genid4869 . _:genid4869 . _:genid4869 "true"^^ . _:genid4870 . _:genid4870 . _:genid4870 . _:genid4870 "A type of cryogenic electron microscopy-based structural model with high relative B-factor values that is used in a manual assertion."^^ . _:genid4870 "ECO:SN"^^ . . _:genid4871 . _:genid4872 . _:genid4874 _:genid4873 . _:genid4872 _:genid4874 . _:genid4873 . _:genid4873 . _:genid4873 . _:genid4874 . _:genid4871 _:genid4872 . _:genid4871 . . . "IEA"^^ . "A type of cryogenic electron microscopy-based structural model with high relative B-factor values that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006227"^^ . "cryogenic electron microscopy-based structural model with high relative B-factor values used in automatic assertion"^^ . _:genid4875 . _:genid4875 . _:genid4875 . _:genid4875 . _:genid4875 "true"^^ . _:genid4876 . _:genid4876 . _:genid4876 . _:genid4876 "A type of cryogenic electron microscopy-based structural model with high relative B-factor values that is used in an automatic assertion."^^ . _:genid4876 "ECO:SN"^^ . . _:genid4877 . _:genid4878 . _:genid4880 _:genid4879 . _:genid4878 _:genid4880 . _:genid4879 . _:genid4879 . _:genid4879 . _:genid4880 . _:genid4877 _:genid4878 . _:genid4877 . . . "EXP"^^ . "A type of Fourier-transform infrared spectroscopy evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "FT-IR"^^ . "FTIR"^^ . "eco"^^ . "ECO:0006228"^^ . "Fourier-transform infrared spectroscopy evidence used in manual assertion"^^ . _:genid4881 . _:genid4881 . _:genid4881 . _:genid4881 . _:genid4881 "true"^^ . _:genid4882 . _:genid4882 . _:genid4882 . _:genid4882 "A type of Fourier-transform infrared spectroscopy evidence that is used in a manual assertion."^^ . _:genid4882 "ECO:SN"^^ . . _:genid4883 . _:genid4884 . _:genid4886 _:genid4885 . _:genid4884 _:genid4886 . _:genid4885 . _:genid4885 . _:genid4885 . _:genid4886 . _:genid4883 _:genid4884 . _:genid4883 . . . "IEA"^^ . "A type of Fourier-transform infrared spectroscopy evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "FT-IR"^^ . "FTIR"^^ . "eco"^^ . "ECO:0006229"^^ . "Fourier-transform infrared spectroscopy evidence used in automatic assertion"^^ . _:genid4887 . _:genid4887 . _:genid4887 . _:genid4887 . _:genid4887 "true"^^ . _:genid4888 . _:genid4888 . _:genid4888 . _:genid4888 "A type of Fourier-transform infrared spectroscopy evidence that is used in an automatic assertion."^^ . _:genid4888 "ECO:SN"^^ . . _:genid4889 . _:genid4890 . _:genid4892 _:genid4891 . _:genid4890 _:genid4892 . _:genid4891 . _:genid4891 . _:genid4891 . _:genid4892 . _:genid4889 _:genid4890 . _:genid4889 . . . "IDA"^^ . "A type of heat capacity-based evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "calorimetry evidence"^^ . "eco"^^ . "ECO:0006230"^^ . "heat capacity-based evidence used in manual assertion"^^ . _:genid4893 . _:genid4893 . _:genid4893 . _:genid4893 . _:genid4893 "true"^^ . _:genid4894 . _:genid4894 . _:genid4894 . _:genid4894 "A type of heat capacity-based evidence that is used in a manual assertion."^^ . _:genid4894 "ECO:SN"^^ . . _:genid4895 . _:genid4896 . _:genid4898 _:genid4897 . _:genid4896 _:genid4898 . _:genid4897 . _:genid4897 . _:genid4897 . _:genid4898 . _:genid4895 _:genid4896 . _:genid4895 . . . "IEA"^^ . "A type of heat capacity-based evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "calorimetry evidence"^^ . "eco"^^ . "ECO:0006231"^^ . "heat capacity-based evidence used in automatic assertion"^^ . _:genid4899 . _:genid4899 . _:genid4899 . _:genid4899 . _:genid4899 "true"^^ . _:genid4900 . _:genid4900 . _:genid4900 . _:genid4900 "A type of heat capacity-based evidence that is used in an automatic assertion."^^ . _:genid4900 "ECO:SN"^^ . . _:genid4901 . _:genid4902 . _:genid4904 _:genid4903 . _:genid4902 _:genid4904 . _:genid4903 . _:genid4903 . _:genid4903 . _:genid4904 . _:genid4901 _:genid4902 . _:genid4901 . . . "IDA"^^ . "A type of differential scanning calorimetry evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "DSC"^^ . "eco"^^ . "ECO:0006232"^^ . "differential scanning calorimetry evidence used in manual assertion"^^ . _:genid4905 . _:genid4905 . _:genid4905 . _:genid4905 . _:genid4905 "true"^^ . _:genid4906 . _:genid4906 . _:genid4906 . _:genid4906 "A type of differential scanning calorimetry evidence that is used in a manual assertion."^^ . _:genid4906 "ECO:SN"^^ . . _:genid4907 . _:genid4908 . _:genid4910 _:genid4909 . _:genid4908 _:genid4910 . _:genid4909 . _:genid4909 . _:genid4909 . _:genid4910 . _:genid4907 _:genid4908 . _:genid4907 . . . "IEA"^^ . "A type of differential scanning calorimetry evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "DSC"^^ . "eco"^^ . "ECO:0006233"^^ . "differential scanning calorimetry evidence used in automatic assertion"^^ . _:genid4911 . _:genid4911 . _:genid4911 . _:genid4911 . _:genid4911 "true"^^ . _:genid4912 . _:genid4912 . _:genid4912 . _:genid4912 "A type of differential scanning calorimetry evidence that is used in an automatic assertion."^^ . _:genid4912 "ECO:SN"^^ . . _:genid4913 . _:genid4914 . _:genid4916 _:genid4915 . _:genid4914 _:genid4916 . _:genid4915 . _:genid4915 . _:genid4915 . _:genid4916 . _:genid4913 _:genid4914 . _:genid4913 . . . "IDA"^^ . "A type of selective antibody-based structural conformation evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006234"^^ . "selective antibody-based structural conformation evidence used in manual assertion"^^ . _:genid4917 . _:genid4917 . _:genid4917 . _:genid4917 . _:genid4917 "true"^^ . _:genid4918 . _:genid4918 . _:genid4918 . _:genid4918 "A type of selective antibody-based structural conformation evidence that is used in a manual assertion."^^ . _:genid4918 "ECO:SN"^^ . . _:genid4919 . _:genid4920 . _:genid4922 _:genid4921 . _:genid4920 _:genid4922 . _:genid4921 . _:genid4921 . _:genid4921 . _:genid4922 . _:genid4919 _:genid4920 . _:genid4919 . . . . "IEA"^^ . "A type of selective antibody-based structural conformation evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006235"^^ . "selective antibody-based structural conformation evidence used in automatic assertion"^^ . _:genid4923 . _:genid4923 . _:genid4923 . _:genid4923 . _:genid4923 "true"^^ . _:genid4924 . _:genid4924 . _:genid4924 . _:genid4924 . _:genid4924 "true"^^ . _:genid4925 . _:genid4925 . _:genid4925 . _:genid4925 "A type of selective antibody-based structural conformation evidence that is used in an automatic assertion."^^ . _:genid4925 "ECO:SN"^^ . . _:genid4926 . _:genid4927 . _:genid4929 _:genid4928 . _:genid4927 _:genid4929 . _:genid4928 . _:genid4928 . _:genid4928 . _:genid4929 . _:genid4926 _:genid4927 . _:genid4926 . . . "EXP"^^ . "A type of protein hydrogen-deuterium exchange mass spectrometry evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "HDX-MS"^^ . "eco"^^ . "ECO:0006236"^^ . "protein hydrogen-deuterium exchange mass spectrometry evidence used in manual assertion"^^ . _:genid4930 . _:genid4930 . _:genid4930 . _:genid4930 . _:genid4930 "true"^^ . _:genid4931 . _:genid4931 . _:genid4931 . _:genid4931 "A type of protein hydrogen-deuterium exchange mass spectrometry evidence that is used in a manual assertion."^^ . _:genid4931 "ECO:SN"^^ . . _:genid4932 . _:genid4933 . _:genid4935 _:genid4934 . _:genid4933 _:genid4935 . _:genid4934 . _:genid4934 . _:genid4934 . _:genid4935 . _:genid4932 _:genid4933 . _:genid4932 . . . "IEA"^^ . "A type of protein hydrogen-deuterium exchange mass spectrometry evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "HDX-MS"^^ . "eco"^^ . "ECO:0006237"^^ . "protein hydrogen-deuterium exchange mass spectrometry evidence used in automatic assertion"^^ . _:genid4936 . _:genid4936 . _:genid4936 . _:genid4936 . _:genid4936 "true"^^ . _:genid4937 . _:genid4937 . _:genid4937 . _:genid4937 "A type of protein hydrogen-deuterium exchange mass spectrometry evidence that is used in an automatic assertion."^^ . _:genid4937 "ECO:SN"^^ . . . "A type of reporter gene assay evidence based on the fusion of the galK gene to a specific promoter for the expression of the enzyme galactokinase."^^ . "OMP:DebbySiegele"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006238"^^ . "galactokinase reporter gene assay evidence"^^ . _:genid4938 . _:genid4938 . _:genid4938 . _:genid4938 "A type of reporter gene assay evidence based on the fusion of the galK gene to a specific promoter for the expression of the enzyme galactokinase."^^ . _:genid4938 "url:https://www.sciencedirect.com/science/article/pii/007668796608039X"^^ . . . "A type of RNA-sequencing evidence based on sequencing of the 3' ends of cDNA molecules that are selected by presence of a polyadenylated tail."^^ . "NCBI-RefSeq:MurphyTerence"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006239"^^ . "polyadenylated transcript 3'-end-sequencing evidence"^^ . _:genid4939 . _:genid4939 . _:genid4939 . _:genid4939 "A type of RNA-sequencing evidence based on sequencing of the 3' ends of cDNA molecules that are selected by presence of a polyadenylated tail."^^ . _:genid4939 "PMID:31617559"^^ . . . "A type of colony morphology phenotypic evidence based on the presence or absence of a visually apparent boundary formed between colonies of multiple isolates or strains of the same microbial species growing on a solid surface such as that of an agar culture medium."^^ . "OMP:DebbySiegele"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006240"^^ . "colony boundary assay evidence"^^ . _:genid4940 . _:genid4940 . _:genid4940 . _:genid4940 "A type of colony morphology phenotypic evidence based on the presence or absence of a visually apparent boundary formed between colonies of multiple isolates or strains of the same microbial species growing on a solid surface such as that of an agar culture medium."^^ . _:genid4940 "PMID:18621670"^^ . . _:genid4941 . _:genid4942 . _:genid4944 _:genid4943 . _:genid4942 _:genid4944 . _:genid4943 . _:genid4943 . _:genid4943 . _:genid4944 . _:genid4941 _:genid4942 . _:genid4941 . . . "IEP"^^ . "A type of galactokinase reporter gene assay evidence that is used in a manual assertion."^^ . "OMP:DebbySiegele"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006241"^^ . "galactokinase reporter gene assay evidence used in manual assertion"^^ . _:genid4945 . _:genid4945 . _:genid4945 . _:genid4945 . _:genid4945 "true"^^ . _:genid4946 . _:genid4946 . _:genid4946 . _:genid4946 "A type of galactokinase reporter gene assay evidence that is used in a manual assertion."^^ . _:genid4946 "ECO:SN"^^ . . _:genid4947 . _:genid4948 . _:genid4950 _:genid4949 . _:genid4948 _:genid4950 . _:genid4949 . _:genid4949 . _:genid4949 . _:genid4950 . _:genid4947 _:genid4948 . _:genid4947 . . . "IEA"^^ . "A type of galactokinase reporter gene assay evidence that is used in an automatic assertion."^^ . "OMP:DebbySiegele"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006242"^^ . "galactokinase reporter gene assay evidence used in automatic assertion"^^ . _:genid4951 . _:genid4951 . _:genid4951 . _:genid4951 . _:genid4951 "true"^^ . _:genid4952 . _:genid4952 . _:genid4952 . _:genid4952 "A type of galactokinase reporter gene assay evidence that is used in an automatic assertion."^^ . _:genid4952 "ECO:SN"^^ . . _:genid4953 . _:genid4954 . _:genid4956 _:genid4955 . _:genid4954 _:genid4956 . _:genid4955 . _:genid4955 . _:genid4955 . _:genid4956 . _:genid4953 _:genid4954 . _:genid4953 . . . "IEP"^^ . "A type of polyadenylated transcript 3'-end-sequencing evidence that is used in a manual assertion."^^ . "NCBI-RefSeq:MurphyTerence"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006243"^^ . "polyadenylated transcript 3'-end-sequencing evidence used in manual assertion"^^ . _:genid4957 . _:genid4957 . _:genid4957 . _:genid4957 . _:genid4957 "true"^^ . _:genid4958 . _:genid4958 . _:genid4958 . _:genid4958 "A type of polyadenylated transcript 3'-end-sequencing evidence that is used in a manual assertion."^^ . _:genid4958 "ECO:SN"^^ . . _:genid4959 . _:genid4960 . _:genid4962 _:genid4961 . _:genid4960 _:genid4962 . _:genid4961 . _:genid4961 . _:genid4961 . _:genid4962 . _:genid4959 _:genid4960 . _:genid4959 . . . "IEA"^^ . "A type of polyadenylated transcript 3'-end-sequencing evidence that is used in an automatic assertion."^^ . "NCBI-RefSeq:MurphyTerence"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006244"^^ . "polyadenylated transcript 3'-end-sequencing evidence used in automatic assertion"^^ . _:genid4963 . _:genid4963 . _:genid4963 . _:genid4963 . _:genid4963 "true"^^ . _:genid4964 . _:genid4964 . _:genid4964 . _:genid4964 "A type of polyadenylated transcript 3'-end-sequencing evidence that is used in an automatic assertion."^^ . _:genid4964 "ECO:SN"^^ . . _:genid4965 . _:genid4966 . _:genid4968 _:genid4967 . _:genid4966 _:genid4968 . _:genid4967 . _:genid4967 . _:genid4967 . _:genid4968 . _:genid4965 _:genid4966 . _:genid4965 . . . "EXP"^^ . "A type of colony boundary assay evidence that is used in a manual assertion."^^ . "OMP:DebbySiegele"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006245"^^ . "colony boundary assay evidence used in manual assertion"^^ . _:genid4969 . _:genid4969 . _:genid4969 . _:genid4969 . _:genid4969 "true"^^ . _:genid4970 . _:genid4970 . _:genid4970 . _:genid4970 "A type of colony boundary assay evidence that is used in a manual assertion."^^ . _:genid4970 "ECO:SN"^^ . . _:genid4971 . _:genid4972 . _:genid4974 _:genid4973 . _:genid4972 _:genid4974 . _:genid4973 . _:genid4973 . _:genid4973 . _:genid4974 . _:genid4971 _:genid4972 . _:genid4971 . . . "IEA"^^ . "A type of colony boundary assay evidence that is used in an automatic assertion."^^ . "OMP:DebbySiegele"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006246"^^ . "colony boundary assay evidence used in automatic assertion"^^ . _:genid4975 . _:genid4975 . _:genid4975 . _:genid4975 . _:genid4975 "true"^^ . _:genid4976 . _:genid4976 . _:genid4976 . _:genid4976 "A type of colony boundary assay evidence that is used in an automatic assertion."^^ . _:genid4976 "ECO:SN"^^ . . . "A type of molecule detection assay evidence where the hydrodynamic behaviour of macromolecules is used to study their size, shape and interactions, by spinning the sample solution at high centrifugal field (up to above 100000 rpm and 1000000 g), and monitoring the evolution of sample concentration profile versus the axis of rotation."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "AUC"^^ . "eco"^^ . "ECO:0006247"^^ . "analytical ultracentrifugation evidence"^^ . _:genid4977 . _:genid4977 . _:genid4977 . _:genid4977 "A type of molecule detection assay evidence where the hydrodynamic behaviour of macromolecules is used to study their size, shape and interactions, by spinning the sample solution at high centrifugal field (up to above 100000 rpm and 1000000 g), and monitoring the evolution of sample concentration profile versus the axis of rotation."^^ . _:genid4977 "PMID:12192063"^^ . . . "A type of physical interaction evidence based on the measurement of the change in the degree of polarization of a fluorophore upon binding to a molecular partner."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "FP"^^ . "eco"^^ . "ECO:0006248"^^ . "fluorescence polarization evidence"^^ . _:genid4978 . _:genid4978 . _:genid4978 . _:genid4978 "A type of physical interaction evidence based on the measurement of the change in the degree of polarization of a fluorophore upon binding to a molecular partner."^^ . _:genid4978 "PMID:21372817"^^ . . "OBSOLETE A type of protein binding evidence resulting from an affinity purification in-vitro technique used to detect physical interactions between two or more proteins, where a molecule of interest - a \"bait\" - is immobilized and incubated with a protein source containing putative \"prey\" proteins."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006249"^^ . "This term has been obsoleted as this is same as the term bait-prey hybrid interaction evidence."^^ . "obsolete bait-prey protein pull-down evidence"^^ . "true"^^ . _:genid4979 . _:genid4979 . _:genid4979 . _:genid4979 "OBSOLETE A type of protein binding evidence resulting from an affinity purification in-vitro technique used to detect physical interactions between two or more proteins, where a molecule of interest - a \"bait\" - is immobilized and incubated with a protein source containing putative \"prey\" proteins."^^ . _:genid4979 "PMID:28667618"^^ . . . "A type of electron microscopy evidence where a heavy metal is evaporated onto surface adsorbed molecules and macromolecular assemblies allowing high-contrast visualization of both individual macromolecules and the surface structure of macromolecular assemblies."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "RS-TEM"^^ . "eco"^^ . "ECO:0006250"^^ . "rotary shadowing electron microscopy evidence"^^ . _:genid4980 . _:genid4980 . _:genid4980 . _:genid4980 "A type of electron microscopy evidence where a heavy metal is evaporated onto surface adsorbed molecules and macromolecular assemblies allowing high-contrast visualization of both individual macromolecules and the surface structure of macromolecular assemblies."^^ . _:genid4980 "PMID:19247619"^^ . . . "A type of mass spectrometry evidence resulting from the ionization of polar functional groups producing multiple charged ions followed by the detection of ion cyclotron frequencies within a magnetic field, making it suitable for the study of large molecules (>2 kDa)."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "ESI FT-ICR MS"^^ . "eco"^^ . "ECO:0006251"^^ . "electrospray ionization fourier transform ion cyclotron resonance mass spectrometry evidence"^^ . _:genid4981 . _:genid4981 . _:genid4981 . _:genid4981 "A type of mass spectrometry evidence resulting from the ionization of polar functional groups producing multiple charged ions followed by the detection of ion cyclotron frequencies within a magnetic field, making it suitable for the study of large molecules (>2 kDa)."^^ . _:genid4981 "PMID:10575730"^^ . . . "A type of experimental evidence in which particles in strong constant magnetic field are perturbed by a weak oscillating magnetic field and the resulting eletromagnetic signal is captured."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006252"^^ . "magnetic resonance evidence"^^ . _:genid4982 . _:genid4982 . _:genid4982 . _:genid4982 "A type of experimental evidence in which particles in strong constant magnetic field are perturbed by a weak oscillating magnetic field and the resulting eletromagnetic signal is captured."^^ . _:genid4982 "ECO:MG"^^ . . . "A type of magnetic resonance evidence in which unpaired electrons in a strong constant magnetic field are perturbed by a weak oscillating magnetic field and the resulting electromagnetic signal is captured."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "EPR"^^ . "ESR"^^ . "eco"^^ . "ECO:0006253"^^ . "electron paramagnetic resonance evidence"^^ . _:genid4983 . _:genid4983 . _:genid4983 . _:genid4983 "A type of magnetic resonance evidence in which unpaired electrons in a strong constant magnetic field are perturbed by a weak oscillating magnetic field and the resulting electromagnetic signal is captured."^^ . _:genid4983 "PMID:21826602"^^ . _:genid4983 "url:https://en.wikipedia.org/wiki/Electron_paramagnetic_resonance"^^ . . . "A type of electron paramagnetic resonance evidence where the signal is obtained by labeling the protein in specific sites with a functional group (most often a nitroxide) containing an unpaired electron using site-directed mutagenesis."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "SDSL"^^ . "eco"^^ . "ECO:0006254"^^ . "site-directed spin-labelling electron paramagnetic resonance evidence"^^ . _:genid4984 . _:genid4984 . _:genid4984 . _:genid4984 "A type of electron paramagnetic resonance evidence where the signal is obtained by labeling the protein in specific sites with a functional group (most often a nitroxide) containing an unpaired electron using site-directed mutagenesis."^^ . _:genid4984 "PMID:21826602"^^ . _:genid4984 "url:https://en.wikipedia.org/wiki/Site-directed_spin_labeling"^^ . . . "A type of direct assay evidence where the removal of glycan groups from a substrate (RNA, DNA, or protein) is detected."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006255"^^ . "deglycosylation assay evidence"^^ . _:genid4985 . _:genid4985 . _:genid4985 . _:genid4985 "A type of direct assay evidence where the removal of glycan groups from a substrate (RNA, DNA, or protein) is detected."^^ . _:genid4985 "url:https://en.wikipedia.org/wiki/Glycosylation"^^ . . . "A type of physical interaction evidence that is based on the detection of a protein-protein interaction between a bait and prey protein by reconstitution of a reporter protein serving as a detectable entity (usually an enzyme or a fluorescent protein), the two halves of which are each attached separately to the bait and prey."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006256"^^ . "protein fragment functional complementation evidence"^^ . _:genid4986 . _:genid4986 . _:genid4986 . _:genid4986 "A type of physical interaction evidence that is based on the detection of a protein-protein interaction between a bait and prey protein by reconstitution of a reporter protein serving as a detectable entity (usually an enzyme or a fluorescent protein), the two halves of which are each attached separately to the bait and prey."^^ . _:genid4986 "PMID:31274323"^^ . . . "A type of protein fragment functional complementaion evidence where the interaction between bait and prey assemble a functional beta galactosidase enzyme."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006257"^^ . "beta galactosidase functional complementation evidence"^^ . _:genid4987 . _:genid4987 . _:genid4987 . _:genid4987 "A type of protein fragment functional complementaion evidence where the interaction between bait and prey assemble a functional beta galactosidase enzyme."^^ . _:genid4987 "PMID:9237989"^^ . . . "A type of protein fragment functional complementaion evidence where the interaction between bait and prey assemble a transcriptional activation complex consisting of the GAL4 DNA-binding domain and the transactivation domain from the herpes simplex virus protein VP16."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006258"^^ . "GAL4-VP16 functional complementation evidence"^^ . _:genid4988 . _:genid4988 . _:genid4988 . _:genid4988 "A type of protein fragment functional complementaion evidence where the interaction between bait and prey assemble a transcriptional activation complex consisting of the GAL4 DNA-binding domain and the transactivation domain from the herpes simplex virus protein VP16."^^ . _:genid4988 "PSI-MI:0728"^^ . . . . "A type of spectrophotometry evidence used to determine a structural fingerprint of the molecule in solution by probing its vibrational modes via the inelastic scattering of photons (called Raman scattering)."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "ROA"^^ . "Raman optical activity"^^ . "eco"^^ . "ECO:0006259"^^ . "Raman spectroscopy evidence"^^ . _:genid4989 . _:genid4989 . _:genid4989 . _:genid4989 "A type of spectrophotometry evidence used to determine a structural fingerprint of the molecule in solution by probing its vibrational modes via the inelastic scattering of photons (called Raman scattering)."^^ . _:genid4989 "url:https://en.wikipedia.org/wiki/Raman_spectroscopy"^^ . . . "A type of heat capacity-based evidence in which the denaturation temperature of a protein sample is measured under varying conditions, such as pH, redox potential, concentration of other molecules or changes in the proteoform, to determine the effect of these factors on protein thermal stability."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006260"^^ . "protein thermal shift assay evidence"^^ . _:genid4990 . _:genid4990 . _:genid4990 . _:genid4990 "A type of heat capacity-based evidence in which the denaturation temperature of a protein sample is measured under varying conditions, such as pH, redox potential, concentration of other molecules or changes in the proteoform, to determine the effect of these factors on protein thermal stability."^^ . _:genid4990 "url:https://en.wikipedia.org/wiki/Thermal_shift_assay"^^ . . . . "A type of physical interaction evidence resulting from measuring the change of the fluorescent activity of a molecule as a function of binding to a non-fluorescent partner and its movement in a microspcopic thermal gradient affecting the intensity of fluorescence."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "MST"^^ . "eco"^^ . "ECO:0006261"^^ . "microscale thermophoresis evidence"^^ . _:genid4991 . _:genid4991 . _:genid4991 . _:genid4991 "A type of physical interaction evidence resulting from measuring the change of the fluorescent activity of a molecule as a function of binding to a non-fluorescent partner and its movement in a microspcopic thermal gradient affecting the intensity of fluorescence."^^ . _:genid4991 "PMID:23270813"^^ . _:genid4991 "url:https://en.wikipedia.org/wiki/Microscale_thermophoresis"^^ . . . "A type of gel electrophoresis evidence resulting from the use of non-denaturing conditions so that the proteins being measured are in their native structural states."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "native gel"^^ . "BN-PAGE"^^ . "CN-PAGE"^^ . "QPNC-PAGE"^^ . "native PAGE"^^ . "eco"^^ . "ECO:0006262"^^ . "native protein gel electrophoresis evidence"^^ . _:genid4992 . _:genid4992 . _:genid4992 . _:genid4992 "A type of gel electrophoresis evidence resulting from the use of non-denaturing conditions so that the proteins being measured are in their native structural states."^^ . _:genid4992 "url:https://en.wikipedia.org/wiki/Gel_electrophoresis_of_proteins"^^ . . . "A type of direct assay evidence where the optical properties of a solution is measured in the visible light spectrum, assessing the haziness or cloudiness as a result of the properties of the solutes or the changes in their material states."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006263"^^ . "turbidity measurement evidence"^^ . _:genid4993 . _:genid4993 . _:genid4993 . _:genid4993 "A type of direct assay evidence where the optical properties of a solution is measured in the visible light spectrum, assessing the haziness or cloudiness as a result of the properties of the solutes or the changes in their material states."^^ . _:genid4993 "url:https://en.wikipedia.org/wiki/Turbidity"^^ . . . "A type of affinity evidence derived from an experimental setup where the binding properties of a ligand are assessed by measuring the competition with another ligand with already known binding properties."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "competition assay"^^ . "eco"^^ . "ECO:0006264"^^ . "competitive binding evidence"^^ . _:genid4994 . _:genid4994 . _:genid4994 . _:genid4994 "A type of affinity evidence derived from an experimental setup where the binding properties of a ligand are assessed by measuring the competition with another ligand with already known binding properties."^^ . _:genid4994 "PMID:21115850"^^ . . . "A type of structure determination evidence obtained by monitoring structural changes of a protein as a response to changes of an environmental parameter, such as pH or temperature, or the concentration of a denaturant, such as urea."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "protein denaturation assay"^^ . "eco"^^ . "ECO:0006265"^^ . "protein unfolding evidence"^^ . _:genid4995 . _:genid4995 . _:genid4995 . _:genid4995 "A type of structure determination evidence obtained by monitoring structural changes of a protein as a response to changes of an environmental parameter, such as pH or temperature, or the concentration of a denaturant, such as urea."^^ . _:genid4995 "url:https://en.wikipedia.org/wiki/Equilibrium_unfolding"^^ . . . "A type of protein unfolding evidence where the unfolding of the protein is triggered by increasing concentrations of urea."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "chemical denaturation"^^ . "chemical unfolding"^^ . "eco"^^ . "ECO:0006266"^^ . "urea-induced protein unfolding evidence"^^ . _:genid4996 . _:genid4996 . _:genid4996 . _:genid4996 "A type of protein unfolding evidence where the unfolding of the protein is triggered by increasing concentrations of urea."^^ . _:genid4996 "PMID:19708649"^^ . . . "A type of protein unfolding evidence where the unfolding of the protein is triggered by changes in pH."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006267"^^ . "pH-induced protein unfolding evidence"^^ . _:genid4997 . _:genid4997 . _:genid4997 . _:genid4997 "A type of protein unfolding evidence where the unfolding of the protein is triggered by changes in pH."^^ . _:genid4997 "PMID:23185611"^^ . . . "A type of protein unfolding evidence where the unfolding of the protein is triggered by changes in temperature."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "thermal dentauration"^^ . "thermal unfolding"^^ . "eco"^^ . "ECO:0006268"^^ . "temperature-induced protein unfolding evidence"^^ . _:genid4998 . _:genid4998 . _:genid4998 . _:genid4998 "A type of protein unfolding evidence where the unfolding of the protein is triggered by changes in temperature."^^ . _:genid4998 "PMID:23185611"^^ . . . "A type of cell-based assay evidence resulting from the analysis of cells irreversibly binding to each other."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006269"^^ . "cell aggregation evidence"^^ . _:genid4999 . _:genid4999 . _:genid4999 . _:genid4999 "A type of cell-based assay evidence resulting from the analysis of cells irreversibly binding to each other."^^ . _:genid4999 "PMID:24092433"^^ . . . . "A type of affinity evidence resulting from the qualitative and quantitative analysis of the affinity with which a protein binds to RNA."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006270"^^ . "RNA-protein binding evidence"^^ . _:genid5000 . _:genid5000 . _:genid5000 . _:genid5000 "A type of affinity evidence resulting from the qualitative and quantitative analysis of the affinity with which a protein binds to RNA."^^ . _:genid5000 "PMID:30804549"^^ . . . . "A type of microscopy evidence that is obtained by using the fluorescence of the studied sample instead of or in addition to the scattering, reflection, attenuation or absorption of light."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006271"^^ . "fluorescence microscopy evidence"^^ . _:genid5001 . _:genid5001 . _:genid5001 . _:genid5001 "A type of microscopy evidence that is obtained by using the fluorescence of the studied sample instead of or in addition to the scattering, reflection, attenuation or absorption of light."^^ . _:genid5001 "url:https://en.wikipedia.org/wiki/Fluorescence_microscope"^^ . . . "A type of direct assay evidence where the viscosity of a solution is measured to quantify the material properties of the solution, or the changes of these properties in response to changing composition or environmental factors."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "viscometry"^^ . "eco"^^ . "ECO:0006272"^^ . "viscosity measurement evidence"^^ . _:genid5002 . _:genid5002 . _:genid5002 . _:genid5002 "A type of direct assay evidence where the viscosity of a solution is measured to quantify the material properties of the solution, or the changes of these properties in response to changing composition or environmental factors."^^ . _:genid5002 "url:https://en.wikipedia.org/wiki/Viscometer"^^ . . . . "A type of physical interaction evidence derived from the decrease (quenching) of fluorescence as a result of the interaction between a fluorescence donor and acceptor in their excited state."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "quenching"^^ . "Dexter"^^ . "FRET"^^ . "exciplex"^^ . "eco"^^ . "ECO:0006273"^^ . "dynamic fluorescence quenching evidence"^^ . _:genid5003 . _:genid5003 . _:genid5003 . _:genid5003 "A type of physical interaction evidence derived from the decrease (quenching) of fluorescence as a result of the interaction between a fluorescence donor and acceptor in their excited state."^^ . _:genid5003 "url:https://en.wikipedia.org/wiki/Quenching_(fluorescence)"^^ . . . . "A type of physical interaction evidence derived from the decrease (quenching) of fluorescence as a result of the intramolecular interaction between a fluorescence donor and acceptor creating a non-fluorescent ground state."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "quenching"^^ . "eco"^^ . "ECO:0006274"^^ . "static fluorescence quenching evidence"^^ . _:genid5004 . _:genid5004 . _:genid5004 . _:genid5004 "A type of physical interaction evidence derived from the decrease (quenching) of fluorescence as a result of the intramolecular interaction between a fluorescence donor and acceptor creating a non-fluorescent ground state."^^ . _:genid5004 "url:https://en.wikipedia.org/wiki/Quenching_(fluorescence)"^^ . . _:genid5005 . _:genid5006 . _:genid5008 _:genid5007 . _:genid5006 _:genid5008 . _:genid5007 . _:genid5007 . _:genid5007 . _:genid5008 . _:genid5005 _:genid5006 . _:genid5005 . . . "EXP"^^ . "A type of analytical ultracentrifugation evidence that is used in a manual assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "AUC"^^ . "eco"^^ . "ECO:0006275"^^ . "analytical ultracentrifugation evidence used in manual assertion"^^ . _:genid5009 . _:genid5009 . _:genid5009 . _:genid5009 . _:genid5009 "true"^^ . _:genid5010 . _:genid5010 . _:genid5010 . _:genid5010 "A type of analytical ultracentrifugation evidence that is used in a manual assertion."^^ . _:genid5010 "ECO:SN"^^ . . _:genid5011 . _:genid5012 . _:genid5014 _:genid5013 . _:genid5012 _:genid5014 . _:genid5013 . _:genid5013 . _:genid5013 . _:genid5014 . _:genid5011 _:genid5012 . _:genid5011 . . . "IEA"^^ . "A type of analytical ultracentrifugation evidence that is used in an automatic assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "AUC"^^ . "eco"^^ . "ECO:0006276"^^ . "analytical ultracentrifugation evidence used in automatic assertion"^^ . _:genid5015 . _:genid5015 . _:genid5015 . _:genid5015 . _:genid5015 "true"^^ . _:genid5016 . _:genid5016 . _:genid5016 . _:genid5016 "A type of analytical ultracentrifugation evidence that is used in an automatic assertion."^^ . _:genid5016 "ECO:SN"^^ . . _:genid5017 . _:genid5018 . _:genid5020 _:genid5019 . _:genid5018 _:genid5020 . _:genid5019 . _:genid5019 . _:genid5019 . _:genid5020 . _:genid5017 _:genid5018 . _:genid5017 . . . "IPI"^^ . "A type of fluorescence polarization evidence that is used in a manual assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "FP"^^ . "eco"^^ . "ECO:0006277"^^ . "fluorescence polarization evidence used in manual assertion"^^ . _:genid5021 . _:genid5021 . _:genid5021 . _:genid5021 . _:genid5021 "true"^^ . _:genid5022 . _:genid5022 . _:genid5022 . _:genid5022 "A type of fluorescence polarization evidence that is used in a manual assertion."^^ . _:genid5022 "ECO:SN"^^ . . _:genid5023 . _:genid5024 . _:genid5026 _:genid5025 . _:genid5024 _:genid5026 . _:genid5025 . _:genid5025 . _:genid5025 . _:genid5026 . _:genid5023 _:genid5024 . _:genid5023 . . . "IEA"^^ . "A type of fluorescence polarization evidence that is used in an automatic assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "FP"^^ . "eco"^^ . "ECO:0006278"^^ . "fluorescence polarization evidence used in automatic assertion"^^ . _:genid5027 . _:genid5027 . _:genid5027 . _:genid5027 . _:genid5027 "true"^^ . _:genid5028 . _:genid5028 . _:genid5028 . _:genid5028 "A type of fluorescence polarization evidence that is used in an automatic assertion."^^ . _:genid5028 "ECO:SN"^^ . . "OBSOLETE A type of bait-prey protein pull-down evidence that is used in a manual assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006279"^^ . "obsolete bait-prey protein pull-down evidence used in manual assertion"^^ . "true"^^ . _:genid5029 . _:genid5029 . _:genid5029 . _:genid5029 "OBSOLETE A type of bait-prey protein pull-down evidence that is used in a manual assertion."^^ . _:genid5029 "ECO:SN"^^ . . "OBSOLETE A type of bait-prey protein pull-down evidence that is used in an automatic assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006280"^^ . "obsolete bait-prey protein pull-down evidence used in automatic assertion"^^ . "true"^^ . _:genid5030 . _:genid5030 . _:genid5030 . _:genid5030 "OBSOLETE A type of bait-prey protein pull-down evidence that is used in an automatic assertion."^^ . _:genid5030 "ECO:SN"^^ . . _:genid5031 . _:genid5032 . _:genid5034 _:genid5033 . _:genid5032 _:genid5034 . _:genid5033 . _:genid5033 . _:genid5033 . _:genid5034 . _:genid5031 _:genid5032 . _:genid5031 . . . "IDA"^^ . "A type of rotary shadowing electron microscopy evidence that is used in a manual assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "RS-TEM"^^ . "eco"^^ . "ECO:0006281"^^ . "rotary shadowing electron microscopy evidence used in manual assertion"^^ . _:genid5035 . _:genid5035 . _:genid5035 . _:genid5035 . _:genid5035 "true"^^ . _:genid5036 . _:genid5036 . _:genid5036 . _:genid5036 "A type of rotary shadowing electron microscopy evidence that is used in a manual assertion."^^ . _:genid5036 "ECO:SN"^^ . . _:genid5037 . _:genid5038 . _:genid5040 _:genid5039 . _:genid5038 _:genid5040 . _:genid5039 . _:genid5039 . _:genid5039 . _:genid5040 . _:genid5037 _:genid5038 . _:genid5037 . . . "IEA"^^ . "A type of rotary shadowing electron microscopy evidence that is used in an automatic assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "RS-TEM"^^ . "eco"^^ . "ECO:0006282"^^ . "rotary shadowing electron microscopy evidence used in automatic assertion"^^ . _:genid5041 . _:genid5041 . _:genid5041 . _:genid5041 . _:genid5041 "true"^^ . _:genid5042 . _:genid5042 . _:genid5042 . _:genid5042 "A type of rotary shadowing electron microscopy evidence that is used in an automatic assertion."^^ . _:genid5042 "ECO:SN"^^ . . _:genid5043 . _:genid5044 . _:genid5046 _:genid5045 . _:genid5044 _:genid5046 . _:genid5045 . _:genid5045 . _:genid5045 . _:genid5046 . _:genid5043 _:genid5044 . _:genid5043 . . . "EXP"^^ . "A type of electrospray ionization fourier transform ion cyclotron resonance mass spectrometry evidence that is used in a manual assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "ESI FT-ICR MS"^^ . "eco"^^ . "ECO:0006283"^^ . "electrospray ionization fourier transform ion cyclotron resonance mass spectrometry evidence used in manual assertion"^^ . _:genid5047 . _:genid5047 . _:genid5047 . _:genid5047 . _:genid5047 "true"^^ . _:genid5048 . _:genid5048 . _:genid5048 . _:genid5048 "A type of electrospray ionization fourier transform ion cyclotron resonance mass spectrometry evidence that is used in a manual assertion."^^ . _:genid5048 "ECO:SN"^^ . . _:genid5049 . _:genid5050 . _:genid5052 _:genid5051 . _:genid5050 _:genid5052 . _:genid5051 . _:genid5051 . _:genid5051 . _:genid5052 . _:genid5049 _:genid5050 . _:genid5049 . . . "IEA"^^ . "A type of electrospray ionization fourier transform ion cyclotron resonance mass spectrometry evidence that is used in an automatic assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "ESI FT-ICR MS"^^ . "eco"^^ . "ECO:0006284"^^ . "electrospray ionization fourier transform ion cyclotron resonance mass spectrometry evidence used in automatic assertion"^^ . _:genid5053 . _:genid5053 . _:genid5053 . _:genid5053 . _:genid5053 "true"^^ . _:genid5054 . _:genid5054 . _:genid5054 . _:genid5054 "A type of electrospray ionization fourier transform ion cyclotron resonance mass spectrometry evidence that is used in an automatic assertion."^^ . _:genid5054 "ECO:SN"^^ . . _:genid5055 . _:genid5056 . _:genid5058 _:genid5057 . _:genid5056 _:genid5058 . _:genid5057 . _:genid5057 . _:genid5057 . _:genid5058 . _:genid5055 _:genid5056 . _:genid5055 . . . "EXP"^^ . "A type of magnetic resonance evidence that is used in a manual assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006285"^^ . "magnetic resonance evidence used in manual assertion"^^ . _:genid5059 . _:genid5059 . _:genid5059 . _:genid5059 . _:genid5059 "true"^^ . _:genid5060 . _:genid5060 . _:genid5060 . _:genid5060 "A type of magnetic resonance evidence that is used in a manual assertion."^^ . _:genid5060 "ECO:SN"^^ . . _:genid5061 . _:genid5062 . _:genid5064 _:genid5063 . _:genid5062 _:genid5064 . _:genid5063 . _:genid5063 . _:genid5063 . _:genid5064 . _:genid5061 _:genid5062 . _:genid5061 . . . "IEA"^^ . "A type of magnetic resonance evidence that is used in an automatic assertion."^^ . "DisProt:FedericaQuaglia"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006286"^^ . "magnetic resonance evidence used in automatic assertion"^^ . _:genid5065 . _:genid5065 . _:genid5065 . _:genid5065 . _:genid5065 "true"^^ . _:genid5066 . _:genid5066 . _:genid5066 . _:genid5066 "A type of magnetic resonance evidence that is used in an automatic assertion."^^ . _:genid5066 "ECO:SN"^^ . . _:genid5067 . _:genid5068 . _:genid5070 _:genid5069 . _:genid5068 _:genid5070 . _:genid5069 . _:genid5069 . _:genid5069 . _:genid5070 . _:genid5067 _:genid5068 . _:genid5067 . . . "EXP"^^ . "A type of electron paramagnetic resonance evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "EPR"^^ . "ESR"^^ . "eco"^^ . "ECO:0006287"^^ . "electron paramagnetic resonance evidence used in manual assertion"^^ . _:genid5071 . _:genid5071 . _:genid5071 . _:genid5071 . _:genid5071 "true"^^ . _:genid5072 . _:genid5072 . _:genid5072 . _:genid5072 "A type of electron paramagnetic resonance evidence that is used in a manual assertion."^^ . _:genid5072 "ECO:SN"^^ . . _:genid5073 . _:genid5074 . _:genid5076 _:genid5075 . _:genid5074 _:genid5076 . _:genid5075 . _:genid5075 . _:genid5075 . _:genid5076 . _:genid5073 _:genid5074 . _:genid5073 . . . "IEA"^^ . "A type of electron paramagnetic resonance evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "EPR"^^ . "ESR"^^ . "eco"^^ . "ECO:0006288"^^ . "electron paramagnetic resonance evidence used in automatic assertion"^^ . _:genid5077 . _:genid5077 . _:genid5077 . _:genid5077 . _:genid5077 "true"^^ . _:genid5078 . _:genid5078 . _:genid5078 . _:genid5078 "A type of electron paramagnetic resonance evidence that is used in an automatic assertion."^^ . _:genid5078 "ECO:SN"^^ . . _:genid5079 . _:genid5080 . _:genid5082 _:genid5081 . _:genid5080 _:genid5082 . _:genid5081 . _:genid5081 . _:genid5081 . _:genid5082 . _:genid5079 _:genid5080 . _:genid5079 . . . "EXP"^^ . "A type of site-directed spin-labelling electron paramagnetic resonance evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "SDSL"^^ . "eco"^^ . "ECO:0006289"^^ . "site-directed spin-labelling electron paramagnetic resonance evidence used in manual assertion"^^ . _:genid5083 . _:genid5083 . _:genid5083 . _:genid5083 . _:genid5083 "true"^^ . _:genid5084 . _:genid5084 . _:genid5084 . _:genid5084 "A type of site-directed spin-labelling electron paramagnetic resonance evidence that is used in a manual assertion."^^ . _:genid5084 "ECO:SN"^^ . . _:genid5085 . _:genid5086 . _:genid5088 _:genid5087 . _:genid5086 _:genid5088 . _:genid5087 . _:genid5087 . _:genid5087 . _:genid5088 . _:genid5085 _:genid5086 . _:genid5085 . . . "IEA"^^ . "A type of site-directed spin-labelling electron paramagnetic resonance evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "SDSL"^^ . "eco"^^ . "ECO:0006290"^^ . "site-directed spin-labelling electron paramagnetic resonance evidence used in automatic assertion"^^ . _:genid5089 . _:genid5089 . _:genid5089 . _:genid5089 . _:genid5089 "true"^^ . _:genid5090 . _:genid5090 . _:genid5090 . _:genid5090 "A type of site-directed spin-labelling electron paramagnetic resonance evidence that is used in an automatic assertion."^^ . _:genid5090 "ECO:SN"^^ . . _:genid5091 . _:genid5092 . _:genid5094 _:genid5093 . _:genid5092 _:genid5094 . _:genid5093 . _:genid5093 . _:genid5093 . _:genid5094 . _:genid5091 _:genid5092 . _:genid5091 . . . "IDA"^^ . "A type of deglycosylation assay evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006291"^^ . "deglycosylation assay evidence used in manual assertion"^^ . _:genid5095 . _:genid5095 . _:genid5095 . _:genid5095 . _:genid5095 "true"^^ . _:genid5096 . _:genid5096 . _:genid5096 . _:genid5096 "A type of deglycosylation assay evidence that is used in a manual assertion."^^ . _:genid5096 "ECO:SN"^^ . . _:genid5097 . _:genid5098 . _:genid5100 _:genid5099 . _:genid5098 _:genid5100 . _:genid5099 . _:genid5099 . _:genid5099 . _:genid5100 . _:genid5097 _:genid5098 . _:genid5097 . . . "IEA"^^ . "A type of deglycosylation assay evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006292"^^ . "deglycosylation assay evidence used in automatic assertion"^^ . _:genid5101 . _:genid5101 . _:genid5101 . _:genid5101 . _:genid5101 "true"^^ . _:genid5102 . _:genid5102 . _:genid5102 . _:genid5102 "A type of deglycosylation assay evidence that is used in an automatic assertion."^^ . _:genid5102 "ECO:SN"^^ . . _:genid5103 . _:genid5104 . _:genid5106 _:genid5105 . _:genid5104 _:genid5106 . _:genid5105 . _:genid5105 . _:genid5105 . _:genid5106 . _:genid5103 _:genid5104 . _:genid5103 . . . "IPI"^^ . "A type of protein fragment functional complementation evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006293"^^ . "protein fragment functional complementation evidence used in manual assertion"^^ . _:genid5107 . _:genid5107 . _:genid5107 . _:genid5107 . _:genid5107 "true"^^ . _:genid5108 . _:genid5108 . _:genid5108 . _:genid5108 "A type of protein fragment functional complementation evidence that is used in a manual assertion."^^ . _:genid5108 "ECO:SN"^^ . . _:genid5109 . _:genid5110 . _:genid5112 _:genid5111 . _:genid5110 _:genid5112 . _:genid5111 . _:genid5111 . _:genid5111 . _:genid5112 . _:genid5109 _:genid5110 . _:genid5109 . . . "IEA"^^ . "A type of protein fragment functional complementation evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006294"^^ . "protein fragment functional complementation evidence used in automatic assertion"^^ . _:genid5113 . _:genid5113 . _:genid5113 . _:genid5113 . _:genid5113 "true"^^ . _:genid5114 . _:genid5114 . _:genid5114 . _:genid5114 "A type of protein fragment functional complementation evidence that is used in an automatic assertion."^^ . _:genid5114 "ECO:SN"^^ . . _:genid5115 . _:genid5116 . _:genid5118 _:genid5117 . _:genid5116 _:genid5118 . _:genid5117 . _:genid5117 . _:genid5117 . _:genid5118 . _:genid5115 _:genid5116 . _:genid5115 . . . "IPI"^^ . "A type of beta galactosidase functional complementation evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006295"^^ . "beta galactosidase functional complementation evidence used in manual assertion"^^ . _:genid5119 . _:genid5119 . _:genid5119 . _:genid5119 . _:genid5119 "true"^^ . _:genid5120 . _:genid5120 . _:genid5120 . _:genid5120 "A type of beta galactosidase functional complementation evidence that is used in a manual assertion."^^ . _:genid5120 "ECO:SN"^^ . . _:genid5121 . _:genid5122 . _:genid5124 _:genid5123 . _:genid5122 _:genid5124 . _:genid5123 . _:genid5123 . _:genid5123 . _:genid5124 . _:genid5121 _:genid5122 . _:genid5121 . . . "IEA"^^ . "A type of beta galactosidase functional complementation evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006296"^^ . "beta galactosidase functional complementation evidence used in automatic assertion"^^ . _:genid5125 . _:genid5125 . _:genid5125 . _:genid5125 . _:genid5125 "true"^^ . _:genid5126 . _:genid5126 . _:genid5126 . _:genid5126 "A type of beta galactosidase functional complementation evidence that is used in an automatic assertion."^^ . _:genid5126 "ECO:SN"^^ . . _:genid5127 . _:genid5128 . _:genid5130 _:genid5129 . _:genid5128 _:genid5130 . _:genid5129 . _:genid5129 . _:genid5129 . _:genid5130 . _:genid5127 _:genid5128 . _:genid5127 . . . "IPI"^^ . "A type of GAL4-VP16 functional complementation evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006297"^^ . "GAL4-VP16 functional complementation evidence used in manual assertion"^^ . _:genid5131 . _:genid5131 . _:genid5131 . _:genid5131 . _:genid5131 "true"^^ . _:genid5132 . _:genid5132 . _:genid5132 . _:genid5132 "A type of GAL4-VP16 functional complementation evidence that is used in a manual assertion."^^ . _:genid5132 "ECO:SN"^^ . . _:genid5133 . _:genid5134 . _:genid5136 _:genid5135 . _:genid5134 _:genid5136 . _:genid5135 . _:genid5135 . _:genid5135 . _:genid5136 . _:genid5133 _:genid5134 . _:genid5133 . . . "IEA"^^ . "A type of GAL4-VP16 functional complementation evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006298"^^ . "GAL4-VP16 functional complementation evidence used in automatic assertion"^^ . _:genid5137 . _:genid5137 . _:genid5137 . _:genid5137 . _:genid5137 "true"^^ . _:genid5138 . _:genid5138 . _:genid5138 . _:genid5138 "A type of GAL4-VP16 functional complementation evidence that is used in an automatic assertion."^^ . _:genid5138 "ECO:SN"^^ . . _:genid5139 . _:genid5140 . _:genid5142 _:genid5141 . _:genid5140 _:genid5142 . _:genid5141 . _:genid5141 . _:genid5141 . _:genid5142 . _:genid5139 _:genid5140 . _:genid5139 . . . "EXP"^^ . "A type of Raman spectroscopy evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "ROA"^^ . "Raman optical activity"^^ . "eco"^^ . "ECO:0006299"^^ . "Raman spectroscopy evidence used in manual assertion"^^ . _:genid5143 . _:genid5143 . _:genid5143 . _:genid5143 . _:genid5143 "true"^^ . _:genid5144 . _:genid5144 . _:genid5144 . _:genid5144 "A type of Raman spectroscopy evidence that is used in a manual assertion."^^ . _:genid5144 "ECO:SN"^^ . . _:genid5145 . _:genid5146 . _:genid5148 _:genid5147 . _:genid5146 _:genid5148 . _:genid5147 . _:genid5147 . _:genid5147 . _:genid5148 . _:genid5145 _:genid5146 . _:genid5145 . . . . "IEA"^^ . "A type of Raman spectroscopy evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "ROA"^^ . "Raman optical activity"^^ . "eco"^^ . "ECO:0006300"^^ . "Raman spectroscopy evidence used in automatic assertion"^^ . _:genid5149 . _:genid5149 . _:genid5149 . _:genid5149 . _:genid5149 "true"^^ . _:genid5150 . _:genid5150 . _:genid5150 . _:genid5150 . _:genid5150 "true"^^ . _:genid5151 . _:genid5151 . _:genid5151 . _:genid5151 "A type of Raman spectroscopy evidence that is used in an automatic assertion."^^ . _:genid5151 "ECO:SN"^^ . . _:genid5152 . _:genid5153 . _:genid5155 _:genid5154 . _:genid5153 _:genid5155 . _:genid5154 . _:genid5154 . _:genid5154 . _:genid5155 . _:genid5152 _:genid5153 . _:genid5152 . . . "IDA"^^ . "A type of protein thermal shift assay evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006301"^^ . "protein thermal shift assay evidence used in manual assertion"^^ . _:genid5156 . _:genid5156 . _:genid5156 . _:genid5156 . _:genid5156 "true"^^ . _:genid5157 . _:genid5157 . _:genid5157 . _:genid5157 "A type of protein thermal shift assay evidence that is used in a manual assertion."^^ . _:genid5157 "ECO:SN"^^ . . _:genid5158 . _:genid5159 . _:genid5161 _:genid5160 . _:genid5159 _:genid5161 . _:genid5160 . _:genid5160 . _:genid5160 . _:genid5161 . _:genid5158 _:genid5159 . _:genid5158 . . . "IEA"^^ . "A type of protein thermal shift assay evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006302"^^ . "protein thermal shift assay evidence used in automatic assertion"^^ . _:genid5162 . _:genid5162 . _:genid5162 . _:genid5162 . _:genid5162 "true"^^ . _:genid5163 . _:genid5163 . _:genid5163 . _:genid5163 "A type of protein thermal shift assay evidence that is used in an automatic assertion."^^ . _:genid5163 "ECO:SN"^^ . . _:genid5164 . _:genid5165 . _:genid5167 _:genid5166 . _:genid5165 _:genid5167 . _:genid5166 . _:genid5166 . _:genid5166 . _:genid5167 . _:genid5164 _:genid5165 . _:genid5164 . . . . "IPI"^^ . "A type of microscale thermophoresis evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "MST"^^ . "eco"^^ . "ECO:0006303"^^ . "microscale thermophoresis evidence used in manual assertion"^^ . _:genid5168 . _:genid5168 . _:genid5168 . _:genid5168 . _:genid5168 "true"^^ . _:genid5169 . _:genid5169 . _:genid5169 . _:genid5169 . _:genid5169 "true"^^ . _:genid5170 . _:genid5170 . _:genid5170 . _:genid5170 "A type of microscale thermophoresis evidence that is used in a manual assertion."^^ . _:genid5170 "ECO:SN"^^ . . _:genid5171 . _:genid5172 . _:genid5174 _:genid5173 . _:genid5172 _:genid5174 . _:genid5173 . _:genid5173 . _:genid5173 . _:genid5174 . _:genid5171 _:genid5172 . _:genid5171 . . . . "IEA"^^ . "A type of microscale thermophoresis evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "MST"^^ . "eco"^^ . "ECO:0006304"^^ . "microscale thermophoresis evidence used in automatic assertion"^^ . _:genid5175 . _:genid5175 . _:genid5175 . _:genid5175 . _:genid5175 "true"^^ . _:genid5176 . _:genid5176 . _:genid5176 . _:genid5176 . _:genid5176 "true"^^ . _:genid5177 . _:genid5177 . _:genid5177 . _:genid5177 "A type of microscale thermophoresis evidence that is used in an automatic assertion."^^ . _:genid5177 "ECO:SN"^^ . . _:genid5178 . _:genid5179 . _:genid5181 _:genid5180 . _:genid5179 _:genid5181 . _:genid5180 . _:genid5180 . _:genid5180 . _:genid5181 . _:genid5178 _:genid5179 . _:genid5178 . . . "IDA"^^ . "A type of native protein gel electrophoresis evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "native gel"^^ . "BN-PAGE"^^ . "CN-PAGE"^^ . "QPNC-PAGE"^^ . "native PAGE"^^ . "eco"^^ . "ECO:0006305"^^ . "native protein gel electrophoresis evidence used in manual assertion"^^ . _:genid5182 . _:genid5182 . _:genid5182 . _:genid5182 . _:genid5182 "true"^^ . _:genid5183 . _:genid5183 . _:genid5183 . _:genid5183 "A type of native protein gel electrophoresis evidence that is used in a manual assertion."^^ . _:genid5183 "ECO:SN"^^ . . _:genid5184 . _:genid5185 . _:genid5187 _:genid5186 . _:genid5185 _:genid5187 . _:genid5186 . _:genid5186 . _:genid5186 . _:genid5187 . _:genid5184 _:genid5185 . _:genid5184 . . . "IEA"^^ . "A type of native protein gel electrophoresis evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "native gel"^^ . "BN-PAGE"^^ . "CN-PAGE"^^ . "QPNC-PAGE"^^ . "native PAGE"^^ . "eco"^^ . "ECO:0006306"^^ . "native protein gel electrophoresis evidence used in automatic assertion"^^ . _:genid5188 . _:genid5188 . _:genid5188 . _:genid5188 . _:genid5188 "true"^^ . _:genid5189 . _:genid5189 . _:genid5189 . _:genid5189 "A type of native protein gel electrophoresis evidence that is used in an automatic assertion."^^ . _:genid5189 "ECO:SN"^^ . . _:genid5190 . _:genid5191 . _:genid5193 _:genid5192 . _:genid5191 _:genid5193 . _:genid5192 . _:genid5192 . _:genid5192 . _:genid5193 . _:genid5190 _:genid5191 . _:genid5190 . . . "IDA"^^ . "A type of turbidity measurement evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006307"^^ . "turbidity measurement evidence used in manual assertion"^^ . _:genid5194 . _:genid5194 . _:genid5194 . _:genid5194 . _:genid5194 "true"^^ . _:genid5195 . _:genid5195 . _:genid5195 . _:genid5195 "A type of turbidity measurement evidence that is used in a manual assertion."^^ . _:genid5195 "ECO:SN"^^ . . _:genid5196 . _:genid5197 . _:genid5199 _:genid5198 . _:genid5197 _:genid5199 . _:genid5198 . _:genid5198 . _:genid5198 . _:genid5199 . _:genid5196 _:genid5197 . _:genid5196 . . . "IEA"^^ . "A type of turbidity measurement evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006308"^^ . "turbidity measurement evidence used in automatic assertion"^^ . _:genid5200 . _:genid5200 . _:genid5200 . _:genid5200 . _:genid5200 "true"^^ . _:genid5201 . _:genid5201 . _:genid5201 . _:genid5201 "A type of turbidity measurement evidence that is used in an automatic assertion."^^ . _:genid5201 "ECO:SN"^^ . . _:genid5202 . _:genid5203 . _:genid5205 _:genid5204 . _:genid5203 _:genid5205 . _:genid5204 . _:genid5204 . _:genid5204 . _:genid5205 . _:genid5202 _:genid5203 . _:genid5202 . . . "IPI"^^ . "A type of competitive binding evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "competition assay"^^ . "eco"^^ . "ECO:0006309"^^ . "competitive binding evidence used in manual assertion"^^ . _:genid5206 . _:genid5206 . _:genid5206 . _:genid5206 . _:genid5206 "true"^^ . _:genid5207 . _:genid5207 . _:genid5207 . _:genid5207 "A type of competitive binding evidence that is used in a manual assertion."^^ . _:genid5207 "ECO:SN"^^ . . _:genid5208 . _:genid5209 . _:genid5211 _:genid5210 . _:genid5209 _:genid5211 . _:genid5210 . _:genid5210 . _:genid5210 . _:genid5211 . _:genid5208 _:genid5209 . _:genid5208 . . . "IEA"^^ . "A type of competitive binding evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "competition assay"^^ . "eco"^^ . "ECO:0006310"^^ . "competitive binding evidence used in automatic assertion"^^ . _:genid5212 . _:genid5212 . _:genid5212 . _:genid5212 . _:genid5212 "true"^^ . _:genid5213 . _:genid5213 . _:genid5213 . _:genid5213 "A type of competitive binding evidence that is used in an automatic assertion."^^ . _:genid5213 "ECO:SN"^^ . . _:genid5214 . _:genid5215 . _:genid5217 _:genid5216 . _:genid5215 _:genid5217 . _:genid5216 . _:genid5216 . _:genid5216 . _:genid5217 . _:genid5214 _:genid5215 . _:genid5214 . . . "EXP"^^ . "A type of protein unfolding evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "protein denaturation assay"^^ . "eco"^^ . "ECO:0006311"^^ . "protein unfolding evidence used in manual assertion"^^ . _:genid5218 . _:genid5218 . _:genid5218 . _:genid5218 . _:genid5218 "true"^^ . _:genid5219 . _:genid5219 . _:genid5219 . _:genid5219 "A type of protein unfolding evidence that is used in a manual assertion."^^ . _:genid5219 "ECO:SN"^^ . . _:genid5220 . _:genid5221 . _:genid5223 _:genid5222 . _:genid5221 _:genid5223 . _:genid5222 . _:genid5222 . _:genid5222 . _:genid5223 . _:genid5220 _:genid5221 . _:genid5220 . . . "IEA"^^ . "A type of protein unfolding evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "protein denaturation assay"^^ . "eco"^^ . "ECO:0006312"^^ . "protein unfolding evidence used in automatic assertion"^^ . _:genid5224 . _:genid5224 . _:genid5224 . _:genid5224 . _:genid5224 "true"^^ . _:genid5225 . _:genid5225 . _:genid5225 . _:genid5225 "A type of protein unfolding evidence that is used in an automatic assertion."^^ . _:genid5225 "ECO:SN"^^ . . _:genid5226 . _:genid5227 . _:genid5229 _:genid5228 . _:genid5227 _:genid5229 . _:genid5228 . _:genid5228 . _:genid5228 . _:genid5229 . _:genid5226 _:genid5227 . _:genid5226 . . . "EXP"^^ . "A type of urea-induced protein unfolding evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "chemical denaturation"^^ . "chemical unfolding"^^ . "eco"^^ . "ECO:0006313"^^ . "urea-induced protein unfolding evidence used in manual assertion"^^ . _:genid5230 . _:genid5230 . _:genid5230 . _:genid5230 . _:genid5230 "true"^^ . _:genid5231 . _:genid5231 . _:genid5231 . _:genid5231 "A type of urea-induced protein unfolding evidence that is used in a manual assertion."^^ . _:genid5231 "ECO:SN"^^ . . _:genid5232 . _:genid5233 . _:genid5235 _:genid5234 . _:genid5233 _:genid5235 . _:genid5234 . _:genid5234 . _:genid5234 . _:genid5235 . _:genid5232 _:genid5233 . _:genid5232 . . . "IEA"^^ . "A type of urea-induced protein unfolding evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "chemical denaturation"^^ . "chemical unfolding"^^ . "eco"^^ . "ECO:0006314"^^ . "urea-induced protein unfolding evidence used in automatic assertion"^^ . _:genid5236 . _:genid5236 . _:genid5236 . _:genid5236 . _:genid5236 "true"^^ . _:genid5237 . _:genid5237 . _:genid5237 . _:genid5237 "A type of urea-induced protein unfolding evidence that is used in an automatic assertion."^^ . _:genid5237 "ECO:SN"^^ . . _:genid5238 . _:genid5239 . _:genid5241 _:genid5240 . _:genid5239 _:genid5241 . _:genid5240 . _:genid5240 . _:genid5240 . _:genid5241 . _:genid5238 _:genid5239 . _:genid5238 . . . "EXP"^^ . "A type of pH-induced protein unfolding evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006315"^^ . "pH-induced protein unfolding evidence used in manual assertion"^^ . _:genid5242 . _:genid5242 . _:genid5242 . _:genid5242 . _:genid5242 "true"^^ . _:genid5243 . _:genid5243 . _:genid5243 . _:genid5243 "A type of pH-induced protein unfolding evidence that is used in a manual assertion."^^ . _:genid5243 "ECO:SN"^^ . . _:genid5244 . _:genid5245 . _:genid5247 _:genid5246 . _:genid5245 _:genid5247 . _:genid5246 . _:genid5246 . _:genid5246 . _:genid5247 . _:genid5244 _:genid5245 . _:genid5244 . . . "IEA"^^ . "A type of pH-induced protein unfolding evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006316"^^ . "pH-induced protein unfolding evidence used in automatic assertion"^^ . _:genid5248 . _:genid5248 . _:genid5248 . _:genid5248 . _:genid5248 "true"^^ . _:genid5249 . _:genid5249 . _:genid5249 . _:genid5249 "A type of pH-induced protein unfolding evidence that is used in an automatic assertion."^^ . _:genid5249 "ECO:SN"^^ . . _:genid5250 . _:genid5251 . _:genid5253 _:genid5252 . _:genid5251 _:genid5253 . _:genid5252 . _:genid5252 . _:genid5252 . _:genid5253 . _:genid5250 _:genid5251 . _:genid5250 . . . "EXP"^^ . "A type of temperature-induced protein unfolding evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "thermal dentauration"^^ . "thermal unfolding"^^ . "eco"^^ . "ECO:0006317"^^ . "temperature-induced protein unfolding evidence used in manual assertion"^^ . _:genid5254 . _:genid5254 . _:genid5254 . _:genid5254 . _:genid5254 "true"^^ . _:genid5255 . _:genid5255 . _:genid5255 . _:genid5255 "A type of temperature-induced protein unfolding evidence that is used in a manual assertion."^^ . _:genid5255 "ECO:SN"^^ . . _:genid5256 . _:genid5257 . _:genid5259 _:genid5258 . _:genid5257 _:genid5259 . _:genid5258 . _:genid5258 . _:genid5258 . _:genid5259 . _:genid5256 _:genid5257 . _:genid5256 . . . "IEA"^^ . "A type of temperature-induced protein unfolding evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "thermal dentauration"^^ . "thermal unfolding"^^ . "eco"^^ . "ECO:0006318"^^ . "temperature-induced protein unfolding evidence used in automatic assertion"^^ . _:genid5260 . _:genid5260 . _:genid5260 . _:genid5260 . _:genid5260 "true"^^ . _:genid5261 . _:genid5261 . _:genid5261 . _:genid5261 "A type of temperature-induced protein unfolding evidence that is used in an automatic assertion."^^ . _:genid5261 "ECO:SN"^^ . . _:genid5262 . _:genid5263 . _:genid5265 _:genid5264 . _:genid5263 _:genid5265 . _:genid5264 . _:genid5264 . _:genid5264 . _:genid5265 . _:genid5262 _:genid5263 . _:genid5262 . . . "IDA"^^ . "A type of cell aggregation evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006319"^^ . "cell aggregation evidence used in manual assertion"^^ . _:genid5266 . _:genid5266 . _:genid5266 . _:genid5266 . _:genid5266 "true"^^ . _:genid5267 . _:genid5267 . _:genid5267 . _:genid5267 "A type of cell aggregation evidence that is used in a manual assertion."^^ . _:genid5267 "ECO:SN"^^ . . _:genid5268 . _:genid5269 . _:genid5271 _:genid5270 . _:genid5269 _:genid5271 . _:genid5270 . _:genid5270 . _:genid5270 . _:genid5271 . _:genid5268 _:genid5269 . _:genid5268 . . . "IEA"^^ . "A type of cell aggregation evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006320"^^ . "cell aggregation evidence used in automatic assertion"^^ . _:genid5272 . _:genid5272 . _:genid5272 . _:genid5272 . _:genid5272 "true"^^ . _:genid5273 . _:genid5273 . _:genid5273 . _:genid5273 "A type of cell aggregation evidence that is used in an automatic assertion."^^ . _:genid5273 "ECO:SN"^^ . . _:genid5274 . _:genid5275 . _:genid5277 _:genid5276 . _:genid5275 _:genid5277 . _:genid5276 . _:genid5276 . _:genid5276 . _:genid5277 . _:genid5274 _:genid5275 . _:genid5274 . . . . "IPI"^^ . "A type of RNA-protein binding evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006321"^^ . "RNA-protein binding evidence used in manual assertion"^^ . _:genid5278 . _:genid5278 . _:genid5278 . _:genid5278 . _:genid5278 "true"^^ . _:genid5279 . _:genid5279 . _:genid5279 . _:genid5279 . _:genid5279 "true"^^ . _:genid5280 . _:genid5280 . _:genid5280 . _:genid5280 "A type of RNA-protein binding evidence that is used in a manual assertion."^^ . _:genid5280 "ECO:SN"^^ . . _:genid5281 . _:genid5282 . _:genid5284 _:genid5283 . _:genid5282 _:genid5284 . _:genid5283 . _:genid5283 . _:genid5283 . _:genid5284 . _:genid5281 _:genid5282 . _:genid5281 . . . . "IEA"^^ . "A type of RNA-protein binding evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006322"^^ . "RNA-protein binding evidence used in automatic assertion"^^ . _:genid5285 . _:genid5285 . _:genid5285 . _:genid5285 . _:genid5285 "true"^^ . _:genid5286 . _:genid5286 . _:genid5286 . _:genid5286 . _:genid5286 "true"^^ . _:genid5287 . _:genid5287 . _:genid5287 . _:genid5287 "A type of RNA-protein binding evidence that is used in an automatic assertion."^^ . _:genid5287 "ECO:SN"^^ . . _:genid5288 . _:genid5289 . _:genid5291 _:genid5290 . _:genid5289 _:genid5291 . _:genid5290 . _:genid5290 . _:genid5290 . _:genid5291 . _:genid5288 _:genid5289 . _:genid5288 . . . . "IDA"^^ . "A type of fluorescence microscopy evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006323"^^ . "fluorescence microscopy evidence used in manual assertion"^^ . _:genid5292 . _:genid5292 . _:genid5292 . _:genid5292 . _:genid5292 "true"^^ . _:genid5293 . _:genid5293 . _:genid5293 . _:genid5293 . _:genid5293 "true"^^ . _:genid5294 . _:genid5294 . _:genid5294 . _:genid5294 "A type of fluorescence microscopy evidence that is used in a manual assertion."^^ . _:genid5294 "ECO:SN"^^ . . _:genid5295 . _:genid5296 . _:genid5298 _:genid5297 . _:genid5296 _:genid5298 . _:genid5297 . _:genid5297 . _:genid5297 . _:genid5298 . _:genid5295 _:genid5296 . _:genid5295 . . . . "IEA"^^ . "A type of fluorescence microscopy evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "eco"^^ . "ECO:0006324"^^ . "fluorescence microscopy evidence used in automatic assertion"^^ . _:genid5299 . _:genid5299 . _:genid5299 . _:genid5299 . _:genid5299 "true"^^ . _:genid5300 . _:genid5300 . _:genid5300 . _:genid5300 . _:genid5300 "true"^^ . _:genid5301 . _:genid5301 . _:genid5301 . _:genid5301 "A type of fluorescence microscopy evidence that is used in an automatic assertion."^^ . _:genid5301 "ECO:SN"^^ . . _:genid5302 . _:genid5303 . _:genid5305 _:genid5304 . _:genid5303 _:genid5305 . _:genid5304 . _:genid5304 . _:genid5304 . _:genid5305 . _:genid5302 _:genid5303 . _:genid5302 . . . "IDA"^^ . "A type of viscosity measurement evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "viscometry"^^ . "eco"^^ . "ECO:0006325"^^ . "viscosity measurement evidence used in manual assertion"^^ . _:genid5306 . _:genid5306 . _:genid5306 . _:genid5306 . _:genid5306 "true"^^ . _:genid5307 . _:genid5307 . _:genid5307 . _:genid5307 "A type of viscosity measurement evidence that is used in a manual assertion."^^ . _:genid5307 "ECO:SN"^^ . . _:genid5308 . _:genid5309 . _:genid5311 _:genid5310 . _:genid5309 _:genid5311 . _:genid5310 . _:genid5310 . _:genid5310 . _:genid5311 . _:genid5308 _:genid5309 . _:genid5308 . . . "IEA"^^ . "A type of viscosity measurement evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "viscometry"^^ . "eco"^^ . "ECO:0006326"^^ . "viscosity measurement evidence used in automatic assertion"^^ . _:genid5312 . _:genid5312 . _:genid5312 . _:genid5312 . _:genid5312 "true"^^ . _:genid5313 . _:genid5313 . _:genid5313 . _:genid5313 "A type of viscosity measurement evidence that is used in an automatic assertion."^^ . _:genid5313 "ECO:SN"^^ . . _:genid5314 . _:genid5315 . _:genid5317 _:genid5316 . _:genid5315 _:genid5317 . _:genid5316 . _:genid5316 . _:genid5316 . _:genid5317 . _:genid5314 _:genid5315 . _:genid5314 . . . . "IPI"^^ . "A type of dynamic fluorescence quenching evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "quenching"^^ . "Dexter"^^ . "FRET"^^ . "exciplex"^^ . "eco"^^ . "ECO:0006327"^^ . "dynamic fluorescence quenching evidence used in manual assertion"^^ . _:genid5318 . _:genid5318 . _:genid5318 . _:genid5318 . _:genid5318 "true"^^ . _:genid5319 . _:genid5319 . _:genid5319 . _:genid5319 . _:genid5319 "true"^^ . _:genid5320 . _:genid5320 . _:genid5320 . _:genid5320 "A type of dynamic fluorescence quenching evidence that is used in a manual assertion."^^ . _:genid5320 "ECO:SN"^^ . . _:genid5321 . _:genid5322 . _:genid5324 _:genid5323 . _:genid5322 _:genid5324 . _:genid5323 . _:genid5323 . _:genid5323 . _:genid5324 . _:genid5321 _:genid5322 . _:genid5321 . . . . "IEA"^^ . "A type of dynamic fluorescence quenching evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "quenching"^^ . "Dexter"^^ . "FRET"^^ . "exciplex"^^ . "eco"^^ . "ECO:0006328"^^ . "dynamic fluorescence quenching evidence used in automatic assertion"^^ . _:genid5325 . _:genid5325 . _:genid5325 . _:genid5325 . _:genid5325 "true"^^ . _:genid5326 . _:genid5326 . _:genid5326 . _:genid5326 . _:genid5326 "true"^^ . _:genid5327 . _:genid5327 . _:genid5327 . _:genid5327 "A type of dynamic fluorescence quenching evidence that is used in an automatic assertion."^^ . _:genid5327 "ECO:SN"^^ . . _:genid5328 . _:genid5329 . _:genid5331 _:genid5330 . _:genid5329 _:genid5331 . _:genid5330 . _:genid5330 . _:genid5330 . _:genid5331 . _:genid5328 _:genid5329 . _:genid5328 . . . . "IPI"^^ . "A type of static fluorescence quenching evidence that is used in a manual assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "quenching"^^ . "eco"^^ . "ECO:0006329"^^ . "static fluorescence quenching evidence used in manual assertion"^^ . _:genid5332 . _:genid5332 . _:genid5332 . _:genid5332 . _:genid5332 "true"^^ . _:genid5333 . _:genid5333 . _:genid5333 . _:genid5333 . _:genid5333 "true"^^ . _:genid5334 . _:genid5334 . _:genid5334 . _:genid5334 "A type of static fluorescence quenching evidence that is used in a manual assertion."^^ . _:genid5334 "ECO:SN"^^ . . _:genid5335 . _:genid5336 . _:genid5338 _:genid5337 . _:genid5336 _:genid5338 . _:genid5337 . _:genid5337 . _:genid5337 . _:genid5338 . _:genid5335 _:genid5336 . _:genid5335 . . . . "IEA"^^ . "A type of static fluorescence quenching evidence that is used in an automatic assertion."^^ . "DisProt:BalintMeszaros"^^ . "snadendla"^^ . "quenching"^^ . "eco"^^ . "ECO:0006330"^^ . "static fluorescence quenching evidence used in automatic assertion"^^ . _:genid5339 . _:genid5339 . _:genid5339 . _:genid5339 . _:genid5339 "true"^^ . _:genid5340 . _:genid5340 . _:genid5340 . _:genid5340 . _:genid5340 "true"^^ . _:genid5341 . _:genid5341 . _:genid5341 . _:genid5341 "A type of static fluorescence quenching evidence that is used in an automatic assertion."^^ . _:genid5341 "ECO:SN"^^ . . . . "A type of high throughput evidence derived from high throughput analysis of differences in alleles of a corresponding gene."^^ . "GOC"^^ . "rctauber"^^ . "2017-10-05T07:39:47Z"^^ . "high throughput mutant phenotype evidence"^^ . "eco"^^ . "ECO:0007000"^^ . "high throughput mutant phenotypic evidence"^^ . _:genid5342 . _:genid5342 . _:genid5342 . _:genid5342 "A type of high throughput evidence derived from high throughput analysis of differences in alleles of a corresponding gene."^^ . _:genid5342 "GO:IMP"^^ . . _:genid5343 . _:genid5344 . _:genid5346 _:genid5345 . _:genid5344 _:genid5346 . _:genid5345 . _:genid5345 . _:genid5345 . _:genid5346 . _:genid5343 _:genid5344 . _:genid5343 . . . . "HMP"^^ . "A type of high throughput mutant phenotypic evidence that is used in a manual assertion."^^ . "GOC"^^ . "rctauber"^^ . "2017-10-05T07:39:47Z"^^ . "GOECO:HMP"^^ . "HMP"^^ . "high throughput mutant phenotype evidence used in manual assertion"^^ . "inferred from high throughput mutant phenotype"^^ . "eco"^^ . "ECO:0007001"^^ . "When using the HMP evidence code, the guidelines for IMP should be adhered to (http://geneontology.org/page/imp-inferred-mutant-phenotype)"^^ . "high throughput mutant phenotypic evidence used in manual assertion"^^ . _:genid5347 . _:genid5347 . _:genid5347 . _:genid5347 . _:genid5347 "true"^^ . _:genid5348 . _:genid5348 . _:genid5348 . _:genid5348 . _:genid5348 "true"^^ . _:genid5349 . _:genid5349 . _:genid5349 . _:genid5349 "HMP"^^ . _:genid5349 "Default"^^ . _:genid5350 . _:genid5350 . _:genid5350 . _:genid5350 "A type of high throughput mutant phenotypic evidence that is used in a manual assertion."^^ . _:genid5350 "GO:IMP"^^ . _:genid5351 . _:genid5351 . _:genid5351 . _:genid5351 "GOECO:HMP"^^ . _:genid5351 "inferred from high throughput mutant phenotype"^^ . _:genid5352 . _:genid5352 . _:genid5352 . _:genid5352 "HMP"^^ . _:genid5352 "GOECO:HMP"^^ . _:genid5353 . _:genid5353 . _:genid5353 . _:genid5353 "inferred from high throughput mutant phenotype"^^ . _:genid5353 "GOECO:HMP"^^ . . . . "A type of high throughput evidence resulting from the high throughput analysis of the effect that a given gene has on another gene or genes, and products."^^ . "GOC"^^ . "rctauber"^^ . "2017-10-05T07:39:47Z"^^ . "high throughput genetic interaction evidence"^^ . "eco"^^ . "ECO:0007002"^^ . "high throughput genetic interaction phenotypic evidence"^^ . _:genid5354 . _:genid5354 . _:genid5354 . _:genid5354 "A type of high throughput evidence resulting from the high throughput analysis of the effect that a given gene has on another gene or genes, and products."^^ . _:genid5354 "PMID:11822023"^^ . . _:genid5355 . _:genid5356 . _:genid5358 _:genid5357 . _:genid5356 _:genid5358 . _:genid5357 . _:genid5357 . _:genid5357 . _:genid5358 . _:genid5355 _:genid5356 . _:genid5355 . . . . "HGI"^^ . "A type of high throughput genetic interaction phenotypic evidence that is used in a manual assertion."^^ . "GOC"^^ . "rctauber"^^ . "2017-10-05T07:39:47Z"^^ . "GOECO:HGI"^^ . "HGI"^^ . "high throughput genetic interaction evidence used in manual assertion"^^ . "inferred from high throughput genetic interaction"^^ . "eco"^^ . "ECO:0007003"^^ . "When using the HGI evidence code, the guidelines for IGI should be adhered to (http://geneontology.org/page/igi-inferred-genetic-interaction)"^^ . "high throughput genetic interaction phenotypic evidence used in manual assertion"^^ . _:genid5359 . _:genid5359 . _:genid5359 . _:genid5359 . _:genid5359 "true"^^ . _:genid5360 . _:genid5360 . _:genid5360 . _:genid5360 . _:genid5360 "true"^^ . _:genid5361 . _:genid5361 . _:genid5361 . _:genid5361 "HGI"^^ . _:genid5361 "Default"^^ . _:genid5362 . _:genid5362 . _:genid5362 . _:genid5362 "A type of high throughput genetic interaction phenotypic evidence that is used in a manual assertion."^^ . _:genid5362 "PMID:11822023"^^ . _:genid5363 . _:genid5363 . _:genid5363 . _:genid5363 "GOECO:HGI"^^ . _:genid5363 "inferred from high throughput genetic interaction"^^ . _:genid5364 . _:genid5364 . _:genid5364 . _:genid5364 "HGI"^^ . _:genid5364 "GOECO:HGI"^^ . _:genid5365 . _:genid5365 . _:genid5365 . _:genid5365 "inferred from high throughput genetic interaction"^^ . _:genid5365 "GOECO:HGI"^^ . . . . "A type of high throughput evidence derived from the high throughput direct measurement of some aspect of a biological feature."^^ . "GOC"^^ . "rctauber"^^ . "2017-10-05T07:39:47Z"^^ . "eco"^^ . "ECO:0007004"^^ . "high throughput direct assay evidence"^^ . _:genid5366 . _:genid5366 . _:genid5366 . _:genid5366 "A type of high throughput evidence derived from the high throughput direct measurement of some aspect of a biological feature."^^ . _:genid5366 "ECO:MCC"^^ . . _:genid5367 . _:genid5368 . _:genid5370 _:genid5369 . _:genid5368 _:genid5370 . _:genid5369 . _:genid5369 . _:genid5369 . _:genid5370 . _:genid5367 _:genid5368 . _:genid5367 . . . . "HDA"^^ . "A type of high throughput evidence that is used in a manual assertion derived from the high throughput direct measurement of some aspect of a biological feature."^^ . "GOC"^^ . "rctauber"^^ . "2017-10-05T07:39:47Z"^^ . "GOECO:HDA"^^ . "HDA"^^ . "inferred from high throughput direct assay"^^ . "eco"^^ . "ECO:0007005"^^ . "When using the HDA evidence code, the guidelines for IDA should be adhered to (http://geneontology.org/page/ida-inferred-direct-assay)"^^ . "high throughput direct assay evidence used in manual assertion"^^ . _:genid5371 . _:genid5371 . _:genid5371 . _:genid5371 . _:genid5371 "true"^^ . _:genid5372 . _:genid5372 . _:genid5372 . _:genid5372 . _:genid5372 "true"^^ . _:genid5373 . _:genid5373 . _:genid5373 . _:genid5373 "HDA"^^ . _:genid5373 "Default"^^ . _:genid5374 . _:genid5374 . _:genid5374 . _:genid5374 "A type of high throughput evidence that is used in a manual assertion derived from the high throughput direct measurement of some aspect of a biological feature."^^ . _:genid5374 "ECO:MCC"^^ . _:genid5375 . _:genid5375 . _:genid5375 . _:genid5375 "GOECO:HDA"^^ . _:genid5375 "inferred from high throughput direct assay"^^ . _:genid5376 . _:genid5376 . _:genid5376 . _:genid5376 "HDA"^^ . _:genid5376 "GOECO:HDA"^^ . _:genid5377 . _:genid5377 . _:genid5377 . _:genid5377 "inferred from high throughput direct assay"^^ . _:genid5377 "GOECO:HDA"^^ . . . . "A type of high throughput evidence derived from the high throughput characterization of gene expression."^^ . "GOC"^^ . "rctauber"^^ . "2017-10-05T07:39:47Z"^^ . "eco"^^ . "ECO:0007006"^^ . "high throughput expression pattern evidence"^^ . _:genid5378 . _:genid5378 . _:genid5378 . _:genid5378 "A type of high throughput evidence derived from the high throughput characterization of gene expression."^^ . _:genid5378 "GO:IEP"^^ . . _:genid5379 . _:genid5380 . _:genid5382 _:genid5381 . _:genid5380 _:genid5382 . _:genid5381 . _:genid5381 . _:genid5381 . _:genid5382 . _:genid5379 _:genid5380 . _:genid5379 . . . . "HEP"^^ . "A type of high throughput evidence that is used in a manual assertion derived from the high throughput characterization of gene expression."^^ . "GOC"^^ . "rctauber"^^ . "2017-10-05T07:39:47Z"^^ . "GOECO:HEP"^^ . "HEP"^^ . "inferred from high throughput expression pattern"^^ . "eco"^^ . "ECO:0007007"^^ . "When using the HEP evidence code, the guidelines for EXP should be adhered to (http://geneontology.org/page/iep-inferred-expression-pattern)"^^ . "high throughput expression pattern evidence used in manual assertion"^^ . _:genid5383 . _:genid5383 . _:genid5383 . _:genid5383 . _:genid5383 "true"^^ . _:genid5384 . _:genid5384 . _:genid5384 . _:genid5384 . _:genid5384 "true"^^ . _:genid5385 . _:genid5385 . _:genid5385 . _:genid5385 "HEP"^^ . _:genid5385 "Default"^^ . _:genid5386 . _:genid5386 . _:genid5386 . _:genid5386 "A type of high throughput evidence that is used in a manual assertion derived from the high throughput characterization of gene expression."^^ . _:genid5386 "GO:IEP"^^ . _:genid5387 . _:genid5387 . _:genid5387 . _:genid5387 "GOECO:HEP"^^ . _:genid5387 "inferred from high throughput expression pattern"^^ . _:genid5388 . _:genid5388 . _:genid5388 . _:genid5388 "HEP"^^ . _:genid5388 "GOECO:HEP"^^ . _:genid5389 . _:genid5389 . _:genid5389 . _:genid5389 "inferred from high throughput expression pattern"^^ . _:genid5389 "GOECO:HEP"^^ . . . "A type of protein binding evidence in which radioactive ligands are used to measure receptor-ligand interactions, such as in determining selectivity for a particular ligand."^^ . "fjungo"^^ . "rctauber"^^ . "2017-12-15T10:46:19Z"^^ . "radioactive ligand binding assay evidence"^^ . "radiometric ligand-binding assay evidence"^^ . "competitive binding assay evidence"^^ . "eco"^^ . "ECO:0007008"^^ . "radioligand binding assay evidence"^^ . _:genid5390 . _:genid5390 . _:genid5390 . _:genid5390 "A type of protein binding evidence in which radioactive ligands are used to measure receptor-ligand interactions, such as in determining selectivity for a particular ligand."^^ . _:genid5390 "PMID:27471749"^^ . . _:genid5391 . _:genid5392 . _:genid5394 _:genid5393 . _:genid5392 _:genid5394 . _:genid5393 . _:genid5393 . _:genid5393 . _:genid5394 . _:genid5391 _:genid5392 . _:genid5391 . . . "IPI"^^ . "A type of radioligand binding assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2017-12-15T10:48:44Z"^^ . "radioactive ligand binding assay evidence"^^ . "eco"^^ . "competitive binding assay evidence"^^ . "ECO:0007009"^^ . "radioligand binding assay evidence used in manual assertion"^^ . _:genid5395 . _:genid5395 . _:genid5395 . _:genid5395 . _:genid5395 "true"^^ . _:genid5396 . _:genid5396 . _:genid5396 . _:genid5396 "A type of radioligand binding assay evidence that is used in a manual assertion."^^ . _:genid5396 "ECO:RCT"^^ . . _:genid5397 . _:genid5398 . _:genid5400 _:genid5399 . _:genid5398 _:genid5400 . _:genid5399 . _:genid5399 . _:genid5399 . _:genid5402 _:genid5401 . _:genid5400 _:genid5402 . _:genid5401 . _:genid5401 . _:genid5401 . _:genid5402 . _:genid5397 _:genid5398 . _:genid5397 . . "A type of combinatorial evidence in which the author draws a conclusion based on a combination of prior scientific background knowledge and evidence from one or more experiments."^^ . "sbello"^^ . "rctauber"^^ . "2018-02-15T11:17:11Z"^^ . "combinatorial evidence from author knowledge and experimental evidence"^^ . "eco"^^ . "ECO:0007011"^^ . "combinatorial experimental and author inference evidence"^^ . _:genid5403 . _:genid5403 . _:genid5403 . _:genid5403 . _:genid5403 "true"^^ . _:genid5404 . _:genid5404 . _:genid5404 . _:genid5404 "A type of combinatorial evidence in which the author draws a conclusion based on a combination of prior scientific background knowledge and evidence from one or more experiments."^^ . _:genid5404 "ECO:RCT"^^ . . _:genid5405 . _:genid5406 . _:genid5408 _:genid5407 . _:genid5406 _:genid5408 . _:genid5407 . _:genid5407 . _:genid5407 . _:genid5410 _:genid5409 . _:genid5408 _:genid5410 . _:genid5409 . _:genid5409 . _:genid5409 . _:genid5410 . _:genid5405 _:genid5406 . _:genid5405 . . "A type of combinatorial evidence in which the curator draws a conclusion based on a combination of prior scientific background knowledge and evidence from one or more experiments."^^ . "ZFIN"^^ . "rctauber"^^ . "2018-02-15T11:17:11Z"^^ . "combinatorial evidence from curator knowledge and experimental evidence"^^ . "eco"^^ . "ECO:0007012"^^ . "combinatorial experimental and curator inference evidence"^^ . _:genid5411 . _:genid5411 . _:genid5411 . _:genid5411 . _:genid5411 "true"^^ . _:genid5412 . _:genid5412 . _:genid5412 . _:genid5412 "A type of combinatorial evidence in which the curator draws a conclusion based on a combination of prior scientific background knowledge and evidence from one or more experiments."^^ . _:genid5412 "ECO:RCT"^^ . . _:genid5413 . _:genid5414 . _:genid5416 _:genid5415 . _:genid5414 _:genid5416 . _:genid5415 . _:genid5415 . _:genid5415 . _:genid5416 . _:genid5413 _:genid5414 . _:genid5413 . . . "A type of combinatorial evidence from author knowledge and experimental evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-02-15T11:22:10Z"^^ . "combinatorial evidence from author knowledge and experimental evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007013"^^ . "combinatorial experimental and author inference evidence used in manual assertion"^^ . _:genid5417 . _:genid5417 . _:genid5417 . _:genid5417 . _:genid5417 "true"^^ . _:genid5418 . _:genid5418 . _:genid5418 . _:genid5418 "A type of combinatorial evidence from author knowledge and experimental evidence that is used in a manual assertion."^^ . _:genid5418 "ECO:RCT"^^ . . _:genid5419 . _:genid5420 . _:genid5422 _:genid5421 . _:genid5420 _:genid5422 . _:genid5421 . _:genid5421 . _:genid5421 . _:genid5422 . _:genid5419 _:genid5420 . _:genid5419 . . . "A type of combinatorial evidence from curator knowledge and experimental evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-02-15T11:22:10Z"^^ . "combinatorial evidence from curator knowledge and experimental evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007014"^^ . "combinatorial experimental and curator inference evidence used in manual assertion"^^ . _:genid5423 . _:genid5423 . _:genid5423 . _:genid5423 . _:genid5423 "true"^^ . _:genid5424 . _:genid5424 . _:genid5424 . _:genid5424 "A type of combinatorial evidence from curator knowledge and experimental evidence that is used in a manual assertion."^^ . _:genid5424 "ECO:RCT"^^ . . . "A type of substance quantification evidence where an electrical gradient potential is applied to analyze an analyte of interest, resulting in a measurement amount of electrical current across the potential range applied."^^ . "SynGO"^^ . "rctauber"^^ . "2018-02-28T12:11:00Z"^^ . "eco"^^ . "ECO:0007015"^^ . "voltammetry evidence"^^ . _:genid5425 . _:genid5425 . _:genid5425 . _:genid5425 "A type of substance quantification evidence where an electrical gradient potential is applied to analyze an analyte of interest, resulting in a measurement amount of electrical current across the potential range applied."^^ . _:genid5425 "PMID:28127962"^^ . . _:genid5426 . _:genid5427 . _:genid5429 _:genid5428 . _:genid5427 _:genid5429 . _:genid5428 . _:genid5428 . _:genid5428 . _:genid5429 . _:genid5426 _:genid5427 . _:genid5426 . . . "IDA"^^ . "A type of voltammetry evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-02-28T12:12:34Z"^^ . "eco"^^ . "ECO:0007016"^^ . "voltammetry evidence used in manual assertion"^^ . _:genid5430 . _:genid5430 . _:genid5430 . _:genid5430 . _:genid5430 "true"^^ . _:genid5431 . _:genid5431 . _:genid5431 . _:genid5431 "A type of voltammetry evidence that is used in a manual assertion."^^ . _:genid5431 "ECO:RCT"^^ . . . "A type of fluorescence evidence where a molecule tagged with a fluorescent protein is exposed to ultraviolet or blue light to shift the spectral emission properties for visualization."^^ . "SynGO"^^ . "rctauber"^^ . "2018-03-02T09:01:00Z"^^ . "eco"^^ . "ECO:0007017"^^ . "photoconversion evidence"^^ . _:genid5432 . _:genid5432 . _:genid5432 . _:genid5432 "A type of fluorescence evidence where a molecule tagged with a fluorescent protein is exposed to ultraviolet or blue light to shift the spectral emission properties for visualization."^^ . _:genid5432 "ECO:RCT"^^ . _:genid5432 "PMID:28574633"^^ . . _:genid5433 . _:genid5434 . _:genid5436 _:genid5435 . _:genid5434 _:genid5436 . _:genid5435 . _:genid5435 . _:genid5435 . _:genid5436 . _:genid5433 _:genid5434 . _:genid5433 . . . "IDA"^^ . "A type of photoconversion evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-03-02T09:05:04Z"^^ . "eco"^^ . "ECO:0007018"^^ . "photoconversion evidence used in manual assertion"^^ . _:genid5437 . _:genid5437 . _:genid5437 . _:genid5437 . _:genid5437 "true"^^ . _:genid5438 . _:genid5438 . _:genid5438 . _:genid5438 "A type of photoconversion evidence that is used in a manual assertion."^^ . _:genid5438 "ECO:RCT"^^ . . . "A type of immunological assay evidence that involves observation of visible clumping of antibody and antigen into a complex."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "agglutination assay evidence"^^ . "ECO:0007019"^^ . "agglutination test evidence"^^ . _:genid5439 . _:genid5439 . _:genid5439 . _:genid5439 "A type of immunological assay evidence that involves observation of visible clumping of antibody and antigen into a complex."^^ . _:genid5439 "URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC380037/"^^ . . _:genid5440 . _:genid5441 . _:genid5443 _:genid5442 . _:genid5441 _:genid5443 . _:genid5442 . _:genid5442 . _:genid5442 . _:genid5443 . _:genid5440 _:genid5441 . _:genid5440 . . . "IPI"^^ . "A type of agglutination test evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "agglutination assay evidence"^^ . "ECO:0007020"^^ . "agglutination test evidence used in manual assertion"^^ . _:genid5444 . _:genid5444 . _:genid5444 . _:genid5444 . _:genid5444 "true"^^ . _:genid5445 . _:genid5445 . _:genid5445 . _:genid5445 "A type of agglutination test evidence that is used in a manual assertion."^^ . _:genid5445 "ECO:RCT"^^ . . . "A type of agglutination test evidence that involves observaiton of visible clumping of antibody and antigen into a complex on a slide."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007021"^^ . "slide agglutination test evidence"^^ . _:genid5446 . _:genid5446 . _:genid5446 . _:genid5446 "A type of agglutination test evidence that involves observaiton of visible clumping of antibody and antigen into a complex on a slide."^^ . _:genid5446 "URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC380037/"^^ . . _:genid5447 . _:genid5448 . _:genid5450 _:genid5449 . _:genid5448 _:genid5450 . _:genid5449 . _:genid5449 . _:genid5449 . _:genid5450 . _:genid5447 _:genid5448 . _:genid5447 . . . "IPI"^^ . "A type of slide agglutination test evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007022"^^ . "slide agglutination test evidence used in manual assertion"^^ . _:genid5451 . _:genid5451 . _:genid5451 . _:genid5451 . _:genid5451 "true"^^ . _:genid5452 . _:genid5452 . _:genid5452 . _:genid5452 "A type of slide agglutination test evidence that is used in a manual assertion."^^ . _:genid5452 "ECO:RCT"^^ . . . "A type of agglutination test evidence that results in detection of nonagglutinating antibodies or complement proteins on red blood cells in vivo."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "direct antihuman globulin test (DAT)"^^ . "ECO:0007023"^^ . "direct Coombs test evidence"^^ . _:genid5453 . _:genid5453 . _:genid5453 . _:genid5453 "A type of agglutination test evidence that results in detection of nonagglutinating antibodies or complement proteins on red blood cells in vivo."^^ . _:genid5453 "URL:https://courses.lumenlearning.com/microbiology/chapter/agglutination-assays/"^^ . . _:genid5454 . _:genid5455 . _:genid5457 _:genid5456 . _:genid5455 _:genid5457 . _:genid5456 . _:genid5456 . _:genid5456 . _:genid5457 . _:genid5454 _:genid5455 . _:genid5454 . . . "IPI"^^ . "A type of direct Coombs test evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "direct antihuman globulin test (DAT)"^^ . "ECO:0007024"^^ . "direct Coombs test evidence used in manual assertion"^^ . _:genid5458 . _:genid5458 . _:genid5458 . _:genid5458 . _:genid5458 "true"^^ . _:genid5459 . _:genid5459 . _:genid5459 . _:genid5459 "A type of direct Coombs test evidence that is used in a manual assertion."^^ . _:genid5459 "ECO:RCT"^^ . . . "A type of agglutination test evidence that results in screening of antibodies against red blood cell antigens (other than the A and B antigens) that are unbound in a patient's serum in vitro."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "indirect antiglobulin test (IAT)"^^ . "ECO:0007025"^^ . "indirect Coombs test evidence"^^ . _:genid5460 . _:genid5460 . _:genid5460 . _:genid5460 "A type of agglutination test evidence that results in screening of antibodies against red blood cell antigens (other than the A and B antigens) that are unbound in a patient's serum in vitro."^^ . _:genid5460 "URL:https://courses.lumenlearning.com/microbiology/chapter/agglutination-assays/"^^ . . _:genid5461 . _:genid5462 . _:genid5464 _:genid5463 . _:genid5462 _:genid5464 . _:genid5463 . _:genid5463 . _:genid5463 . _:genid5464 . _:genid5461 _:genid5462 . _:genid5461 . . . "IPI"^^ . "A type of indirect Coombs test evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "indirect antiglobulin test (IAT)"^^ . "ECO:0007026"^^ . "indirect Coombs test evidence used in manual assertion"^^ . _:genid5465 . _:genid5465 . _:genid5465 . _:genid5465 . _:genid5465 "true"^^ . _:genid5466 . _:genid5466 . _:genid5466 . _:genid5466 "A type of indirect Coombs test evidence that is used in a manual assertion."^^ . _:genid5466 "ECO:RCT"^^ . . . "A type of agglutination test evidence where some bacteria and viruses cross-link red blood cells and clump together."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007027"^^ . "direct hemagglutination assay evidence"^^ . _:genid5467 . _:genid5467 . _:genid5467 . _:genid5467 "A type of agglutination test evidence where some bacteria and viruses cross-link red blood cells and clump together."^^ . _:genid5467 "URL:https://courses.lumenlearning.com/microbiology/chapter/agglutination-assays/"^^ . . _:genid5468 . _:genid5469 . _:genid5471 _:genid5470 . _:genid5469 _:genid5471 . _:genid5470 . _:genid5470 . _:genid5470 . _:genid5471 . _:genid5468 _:genid5469 . _:genid5468 . . . "IPI"^^ . "A type of direct hemagglutination assay evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007028"^^ . "direct hemagglutination assay evidence used in manual assertion"^^ . _:genid5472 . _:genid5472 . _:genid5472 . _:genid5472 . _:genid5472 "true"^^ . _:genid5473 . _:genid5473 . _:genid5473 . _:genid5473 "A type of direct hemagglutination assay evidence that is used in a manual assertion."^^ . _:genid5473 "ECO:RCT"^^ . . . "A type of agglutination test evidence where antiviral antibodies in a patient's serum or in a lab-produced antiserum neutralize the virus and block it from agglutinating the red blood cells."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007029"^^ . "viral hemagglutination inhibition assay evidence"^^ . _:genid5474 . _:genid5474 . _:genid5474 . _:genid5474 "A type of agglutination test evidence where antiviral antibodies in a patient's serum or in a lab-produced antiserum neutralize the virus and block it from agglutinating the red blood cells."^^ . _:genid5474 "URL:https://courses.lumenlearning.com/microbiology/chapter/agglutination-assays/"^^ . . _:genid5475 . _:genid5476 . _:genid5478 _:genid5477 . _:genid5476 _:genid5478 . _:genid5477 . _:genid5477 . _:genid5477 . _:genid5478 . _:genid5475 _:genid5476 . _:genid5475 . . . "IPI"^^ . "A type of viral hemagglutination inhibition assay evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007030"^^ . "viral hemagglutination inhibition assay evidence used in manual assertion"^^ . _:genid5479 . _:genid5479 . _:genid5479 . _:genid5479 . _:genid5479 "true"^^ . _:genid5480 . _:genid5480 . _:genid5480 . _:genid5480 "A type of viral hemagglutination inhibition assay evidence that is used in a manual assertion."^^ . _:genid5480 "ECO:RCT"^^ . . . "A type of immunological assay evidence that results in the detection of presence of specific antibodies in the patient's serum based on the use of complement, a biologically labile serum factor."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007031"^^ . "compement fixation assay evidence"^^ . _:genid5481 . _:genid5481 . _:genid5481 . _:genid5481 "A type of immunological assay evidence that results in the detection of presence of specific antibodies in the patient's serum based on the use of complement, a biologically labile serum factor."^^ . _:genid5481 "URL:http://laboratoryinfo.com/complement-fixation-test/"^^ . . _:genid5482 . _:genid5483 . _:genid5485 _:genid5484 . _:genid5483 _:genid5485 . _:genid5484 . _:genid5484 . _:genid5484 . _:genid5485 . _:genid5482 _:genid5483 . _:genid5482 . . . "IPI"^^ . "A type of compement fixation assay evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007032"^^ . "compement fixation assay evidence used in manual assertion"^^ . _:genid5486 . _:genid5486 . _:genid5486 . _:genid5486 . _:genid5486 "true"^^ . _:genid5487 . _:genid5487 . _:genid5487 . _:genid5487 "A type of compement fixation assay evidence that is used in a manual assertion."^^ . _:genid5487 "ECO:RCT"^^ . . . "A type of immunogical assay evidence that results in detection of specific neutralizing antibodies in a sample."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007033"^^ . "neutralization test assay evidence"^^ . _:genid5488 . _:genid5488 . _:genid5488 . _:genid5488 "A type of immunogical assay evidence that results in detection of specific neutralizing antibodies in a sample."^^ . _:genid5488 "PMID:24899440"^^ . _:genid5488 "url:http://www.creative-biolabs.com/drug-discovery/therapeutics/neutralization-assay.htm?gclid=Cj0KEQjwqvvLBRDIt-D7q7iqiOcBEiQAxi68ERRz00a0x9sWSKSLDu7d5-kMi4AdiLNdUq1mXzePdywaArli8P8HAQ)"^^ . . _:genid5489 . _:genid5490 . _:genid5492 _:genid5491 . _:genid5490 _:genid5492 . _:genid5491 . _:genid5491 . _:genid5491 . _:genid5492 . _:genid5489 _:genid5490 . _:genid5489 . . . "IPI"^^ . "A type of neutralization test assay evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007034"^^ . "neutralization test assay evidence used in manual assertion"^^ . _:genid5493 . _:genid5493 . _:genid5493 . _:genid5493 . _:genid5493 "true"^^ . _:genid5494 . _:genid5494 . _:genid5494 . _:genid5494 "A type of neutralization test assay evidence that is used in a manual assertion."^^ . _:genid5494 "ECO:RCT"^^ . . . "A type of transport assay evidence where the rate of copper transport is estimated."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007035"^^ . "copper transport assay evidence"^^ . _:genid5495 . _:genid5495 . _:genid5495 . _:genid5495 "A type of transport assay evidence where the rate of copper transport is estimated."^^ . _:genid5495 "URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689948/"^^ . . _:genid5496 . _:genid5497 . _:genid5499 _:genid5498 . _:genid5497 _:genid5499 . _:genid5498 . _:genid5498 . _:genid5498 . _:genid5499 . _:genid5496 _:genid5497 . _:genid5496 . . . "IDA"^^ . "A type of copper transport assay evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007036"^^ . "copper transport assay evidence used in manual assertion"^^ . _:genid5500 . _:genid5500 . _:genid5500 . _:genid5500 . _:genid5500 "true"^^ . _:genid5501 . _:genid5501 . _:genid5501 . _:genid5501 "A type of copper transport assay evidence that is used in a manual assertion."^^ . _:genid5501 "ECO:RCT"^^ . . . "A type of staining evidence that involves the use of the redox dye 5-cyano-2,3-ditolyl tetrazolium chloride to evaluate the respiratory activity of cells."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "CTC staining"^^ . "ECO:0007037"^^ . "5-cyano-2,3-ditolyl tetrazolium chloride staining evidence"^^ . _:genid5502 . _:genid5502 . _:genid5502 . _:genid5502 "A type of staining evidence that involves the use of the redox dye 5-cyano-2,3-ditolyl tetrazolium chloride to evaluate the respiratory activity of cells."^^ . _:genid5502 "PMID:1622256"^^ . . _:genid5503 . _:genid5504 . _:genid5506 _:genid5505 . _:genid5504 _:genid5506 . _:genid5505 . _:genid5505 . _:genid5505 . _:genid5506 . _:genid5503 _:genid5504 . _:genid5503 . . . "IDA"^^ . "A type of 5-cyano-2,3-ditolyl tetrazolium chloride staining evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "CTC staining"^^ . "ECO:0007038"^^ . "5-cyano-2,3-ditolyl tetrazolium chloride staining evidence used in manual assertion"^^ . _:genid5507 . _:genid5507 . _:genid5507 . _:genid5507 . _:genid5507 "true"^^ . _:genid5508 . _:genid5508 . _:genid5508 . _:genid5508 "A type of 5-cyano-2,3-ditolyl tetrazolium chloride staining evidence that is used in a manual assertion."^^ . _:genid5508 "ECO:RCT"^^ . . . _:genid5509 . _:genid5509 . _:genid5509 . _:genid5509 . _:genid5510 . _:genid5510 . _:genid5510 . _:genid5510 . _:genid5511 . _:genid5511 . _:genid5512 . _:genid5513 . _:genid5515 _:genid5514 . _:genid5513 _:genid5515 . _:genid5514 . _:genid5514 . _:genid5514 . _:genid5515 . _:genid5512 _:genid5513 . _:genid5511 _:genid5512 . _:genid5511 . _:genid5516 . _:genid5516 . _:genid5517 . _:genid5518 . _:genid5520 _:genid5519 . _:genid5518 _:genid5520 . _:genid5519 . _:genid5519 . _:genid5521 . _:genid5521 . _:genid5521 . _:genid5519 _:genid5521 . _:genid5520 . _:genid5517 _:genid5518 . _:genid5516 _:genid5517 . _:genid5516 . "A type of cell growth assay evidence resulting in direct quantification of infectious virons and antiviral substances through the counting of discrete plaques (infectious units and cellular dead zones) in cell culture."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007039"^^ . "plaque assay evidence"^^ . _:genid5522 . _:genid5522 . _:genid5522 . _:genid5522 "A type of cell growth assay evidence resulting in direct quantification of infectious virons and antiviral substances through the counting of discrete plaques (infectious units and cellular dead zones) in cell culture."^^ . _:genid5522 "PMID:25407402"^^ . . _:genid5523 . _:genid5524 . _:genid5526 _:genid5525 . _:genid5524 _:genid5526 . _:genid5525 . _:genid5525 . _:genid5525 . _:genid5526 . _:genid5523 _:genid5524 . _:genid5523 . . . "IDA"^^ . "A type of plaque assay evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007040"^^ . "plaque assay evidence used in manual assertion"^^ . _:genid5527 . _:genid5527 . _:genid5527 . _:genid5527 . _:genid5527 "true"^^ . _:genid5528 . _:genid5528 . _:genid5528 . _:genid5528 "A type of plaque assay evidence that is used in a manual assertion."^^ . _:genid5528 "ECO:RCT"^^ . . . "A type of fluorescence microscopy evidence where the light source is mounted above the specimen and the excitation light passes through the microscope objective lens on its way toward the specimen."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007041"^^ . "epifluorescence microscopy evidence"^^ . _:genid5529 . _:genid5529 . _:genid5529 . _:genid5529 "A type of fluorescence microscopy evidence where the light source is mounted above the specimen and the excitation light passes through the microscope objective lens on its way toward the specimen."^^ . _:genid5529 "URL:http://www.rsc.org/publishing/journals/prospect/ontology.asp?id=CMO:0001096|URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4713126/"^^ . . _:genid5530 . _:genid5531 . _:genid5533 _:genid5532 . _:genid5531 _:genid5533 . _:genid5532 . _:genid5532 . _:genid5532 . _:genid5533 . _:genid5530 _:genid5531 . _:genid5530 . . . "IDA"^^ . "A type of epifluorescence microscopy evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007042"^^ . "epifluorescence microscopy evidence used in manual assertion"^^ . _:genid5534 . _:genid5534 . _:genid5534 . _:genid5534 . _:genid5534 "true"^^ . _:genid5535 . _:genid5535 . _:genid5535 . _:genid5535 "A type of epifluorescence microscopy evidence that is used in a manual assertion."^^ . _:genid5535 "ECO:RCT"^^ . . . "A type of electron microscopy evidence where a beam of electrons are transmitted through an ultra thin specimen forming an image which is magnified and focused onto an imaging device, such as a fluorescent screen, on a layer of photographic film, or to be detected by a sensor such as a CCD camera."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "TEM"^^ . "conventional transmission electron microscopy(CTEM)"^^ . "ECO:0007043"^^ . "transmission electron microscopy evidence"^^ . _:genid5536 . _:genid5536 . _:genid5536 . _:genid5536 "A type of electron microscopy evidence where a beam of electrons are transmitted through an ultra thin specimen forming an image which is magnified and focused onto an imaging device, such as a fluorescent screen, on a layer of photographic film, or to be detected by a sensor such as a CCD camera."^^ . _:genid5536 "ERO:0000329|URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3907272/"^^ . . _:genid5537 . _:genid5538 . _:genid5540 _:genid5539 . _:genid5538 _:genid5540 . _:genid5539 . _:genid5539 . _:genid5539 . _:genid5540 . _:genid5537 _:genid5538 . _:genid5537 . . . "IDA"^^ . "A type of transmission electron microscopy evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "TEM"^^ . "conventional transmission electron microscopy(CTEM)"^^ . "ECO:0007044"^^ . "transmission electron microscopy evidence used in manual assertion"^^ . _:genid5541 . _:genid5541 . _:genid5541 . _:genid5541 . _:genid5541 "true"^^ . _:genid5542 . _:genid5542 . _:genid5542 . _:genid5542 "A type of transmission electron microscopy evidence that is used in a manual assertion."^^ . _:genid5542 "ECO:RCT"^^ . . . "With a general growth of the recombinant mycobacterial strains resulting in minimal change, the cell morphology was further examined using the scanning electron microscopy (SEM) technique. As shown in Fig. 5B, the cell lengthened when 20 ng/mL tetracycline was added to the medium to induce expression of the antisense mtrA mRNA (right panel)." . "A type of electron microscopy evidence where a focused beam of high-energy electrons is used to generate a variety of signals at the surface of solid specimens."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007045"^^ . "scanning electron microscopy evidence"^^ . _:genid5543 . _:genid5543 . _:genid5543 . _:genid5543 "With a general growth of the recombinant mycobacterial strains resulting in minimal change, the cell morphology was further examined using the scanning electron microscopy (SEM) technique. As shown in Fig. 5B, the cell lengthened when 20 ng/mL tetracycline was added to the medium to induce expression of the antisense mtrA mRNA (right panel)." . _:genid5543 "PMID:20843371"^^ . _:genid5544 . _:genid5544 . _:genid5544 . _:genid5544 "A type of electron microscopy evidence where a focused beam of high-energy electrons is used to generate a variety of signals at the surface of solid specimens."^^ . _:genid5544 "URL:https://serc.carleton.edu/research_education/geochemsheets/techniques/SEM.html"^^ . . _:genid5545 . _:genid5546 . _:genid5548 _:genid5547 . _:genid5546 _:genid5548 . _:genid5547 . _:genid5547 . _:genid5547 . _:genid5548 . _:genid5545 _:genid5546 . _:genid5545 . . . "IDA"^^ . "A type of scanning electron microscopy evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007046"^^ . "scanning electron microscopy evidence used in manual assertion"^^ . _:genid5549 . _:genid5549 . _:genid5549 . _:genid5549 . _:genid5549 "true"^^ . _:genid5550 . _:genid5550 . _:genid5550 . _:genid5550 "A type of scanning electron microscopy evidence that is used in a manual assertion."^^ . _:genid5550 "ECO:RCT"^^ . . . "A type of microscopy evidence where a serial images are taken at regular time points to capture the dynamics of what is being observed."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007047"^^ . "time-lapsed microscopy evidence"^^ . _:genid5551 . _:genid5551 . _:genid5551 . _:genid5551 "A type of microscopy evidence where a serial images are taken at regular time points to capture the dynamics of what is being observed."^^ . _:genid5551 "URL:https://www.nature.com/subjects/time-lapse-imaging"^^ . . _:genid5552 . _:genid5553 . _:genid5555 _:genid5554 . _:genid5553 _:genid5555 . _:genid5554 . _:genid5554 . _:genid5554 . _:genid5555 . _:genid5552 _:genid5553 . _:genid5552 . . . "IDA"^^ . "A type of time-lapsed microscopy evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007048"^^ . "time-lapsed microscopy evidence used in manual assertion"^^ . _:genid5556 . _:genid5556 . _:genid5556 . _:genid5556 . _:genid5556 "true"^^ . _:genid5557 . _:genid5557 . _:genid5557 . _:genid5557 "A type of time-lapsed microscopy evidence that is used in a manual assertion."^^ . _:genid5557 "ECO:RCT"^^ . . . "A type of microscopy evidence where a transparent specimen is illuminated with visible light and small phase shifts in the light passing through the specimen are used to produce an image."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007049"^^ . "phase contrast microscopy evidence"^^ . _:genid5558 . _:genid5558 . _:genid5558 . _:genid5558 "A type of microscopy evidence where a transparent specimen is illuminated with visible light and small phase shifts in the light passing through the specimen are used to produce an image."^^ . _:genid5558 "CHMO:0000110"^^ . . _:genid5559 . _:genid5560 . _:genid5562 _:genid5561 . _:genid5560 _:genid5562 . _:genid5561 . _:genid5561 . _:genid5561 . _:genid5562 . _:genid5559 _:genid5560 . _:genid5559 . . . "IDA"^^ . "A type of phase contrast microscopy evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007050"^^ . "phase contrast microscopy evidence used in manual assertion"^^ . _:genid5563 . _:genid5563 . _:genid5563 . _:genid5563 . _:genid5563 "true"^^ . _:genid5564 . _:genid5564 . _:genid5564 . _:genid5564 "A type of phase contrast microscopy evidence that is used in a manual assertion."^^ . _:genid5564 "ECO:RCT"^^ . . . "A type of microscopy evidence where a sample is illuminated with transmitted white light from below and observed from above."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007051"^^ . "transmitted light brightfied mircoscopy evidence"^^ . _:genid5565 . _:genid5565 . _:genid5565 . _:genid5565 "A type of microscopy evidence where a sample is illuminated with transmitted white light from below and observed from above."^^ . _:genid5565 "BAO:0000457"^^ . . _:genid5566 . _:genid5567 . _:genid5569 _:genid5568 . _:genid5567 _:genid5569 . _:genid5568 . _:genid5568 . _:genid5568 . _:genid5569 . _:genid5566 _:genid5567 . _:genid5566 . . . "IDA"^^ . "A type of transmitted light brightfied mircoscopy evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007052"^^ . "transmitted light brightfied mircoscopy evidence used in manual assertion"^^ . _:genid5570 . _:genid5570 . _:genid5570 . _:genid5570 . _:genid5570 "true"^^ . _:genid5571 . _:genid5571 . _:genid5571 . _:genid5571 "A type of transmitted light brightfied mircoscopy evidence that is used in a manual assertion."^^ . _:genid5571 "ECO:RCT"^^ . . . "A type of microscopy evidence that results in a bright image without glare and minimum heating of the specimen by employing both field and an aperture iris diaphragm for illumination."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007053"^^ . "koehler illumination microscopy evidence"^^ . _:genid5572 . _:genid5572 . _:genid5572 . _:genid5572 "A type of microscopy evidence that results in a bright image without glare and minimum heating of the specimen by employing both field and an aperture iris diaphragm for illumination."^^ . _:genid5572 "URL:http://www.gonda.ucla.edu/bri_core/kohler.htm"^^ . . _:genid5573 . _:genid5574 . _:genid5576 _:genid5575 . _:genid5574 _:genid5576 . _:genid5575 . _:genid5575 . _:genid5575 . _:genid5576 . _:genid5573 _:genid5574 . _:genid5573 . . . "IDA"^^ . "A type of koehler illumination microscopy evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007054"^^ . "koehler illumination microscopy evidence used in manual assertion"^^ . _:genid5577 . _:genid5577 . _:genid5577 . _:genid5577 . _:genid5577 "true"^^ . _:genid5578 . _:genid5578 . _:genid5578 . _:genid5578 "A type of koehler illumination microscopy evidence that is used in a manual assertion."^^ . _:genid5578 "ECO:RCT"^^ . . . "A type of microscopy evidence that results in visualization of living cells and transparent specimens by taking advantage of differences in the light refraction of different parts of the specimen."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "DIC microscopy"^^ . "NIC microscopy"^^ . "Nomarski interference contrast microscopy"^^ . "Nomarski microscopy"^^ . "ECO:0007055"^^ . "differential interference contrast microscopy evidence"^^ . _:genid5579 . _:genid5579 . _:genid5579 . _:genid5579 "A type of microscopy evidence that results in visualization of living cells and transparent specimens by taking advantage of differences in the light refraction of different parts of the specimen."^^ . _:genid5579 "URL:http://www.microscopemaster.com/differential-interference-contrast.html"^^ . . _:genid5580 . _:genid5581 . _:genid5583 _:genid5582 . _:genid5581 _:genid5583 . _:genid5582 . _:genid5582 . _:genid5582 . _:genid5583 . _:genid5580 _:genid5581 . _:genid5580 . . . "IDA"^^ . "A type of differential interference contrast microscopy evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "DIC microscopy"^^ . "NIC microscopy"^^ . "Nomarski interference contrast microscopy"^^ . "Nomarski microscopy"^^ . "ECO:0007056"^^ . "differential interference contrast microscopy evidence used in manual assertion"^^ . _:genid5584 . _:genid5584 . _:genid5584 . _:genid5584 . _:genid5584 "true"^^ . _:genid5585 . _:genid5585 . _:genid5585 . _:genid5585 "A type of differential interference contrast microscopy evidence that is used in a manual assertion."^^ . _:genid5585 "ECO:RCT"^^ . . . "A type of confocal microscopy evidence that results in creation of a continuous confocal multi-colour mosaic from thousands of individually captured images."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "EFLCM"^^ . "ECO:0007057"^^ . "extended field laser confocal microscopy evidence"^^ . _:genid5586 . _:genid5586 . _:genid5586 . _:genid5586 "A type of confocal microscopy evidence that results in creation of a continuous confocal multi-colour mosaic from thousands of individually captured images."^^ . _:genid5586 "PMID:18627634"^^ . . _:genid5587 . _:genid5588 . _:genid5590 _:genid5589 . _:genid5588 _:genid5590 . _:genid5589 . _:genid5589 . _:genid5589 . _:genid5590 . _:genid5587 _:genid5588 . _:genid5587 . . . "IDA"^^ . "A type of extended field laser confocal microscopy evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "EFLCM"^^ . "ECO:0007058"^^ . "extended field laser confocal microscopy evidence used in manual assertion"^^ . _:genid5591 . _:genid5591 . _:genid5591 . _:genid5591 . _:genid5591 "true"^^ . _:genid5592 . _:genid5592 . _:genid5592 . _:genid5592 "A type of extended field laser confocal microscopy evidence that is used in a manual assertion."^^ . _:genid5592 "ECO:RCT"^^ . . . "A type of confocal microscopy evidence that results in an image that is built up pixel-by-pixel by collecting the emitted photons from the fluorophores in the sample by passing a laser beam through a light source aperture which is then focused by an objective lens into a small area on the surface of the sample.\n"^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "CLSM"^^ . "LSCM"^^ . "confocal laser scanning fluorescence microscopy"^^ . "confocal-laser scanning microscopy"^^ . "fluorescence confocal scanning laser microscopy"^^ . "scanning confocal fluorescence microscopy"^^ . "ECO:0007059"^^ . "confocal laser scanning microscopy evidence"^^ . _:genid5593 . _:genid5593 . _:genid5593 . _:genid5593 "A type of confocal microscopy evidence that results in an image that is built up pixel-by-pixel by collecting the emitted photons from the fluorophores in the sample by passing a laser beam through a light source aperture which is then focused by an objective lens into a small area on the surface of the sample.\n"^^ . _:genid5593 "URL:http://bitesizebio.com/19958/what-is-confocal-laser-scanning-microscopy/"^^ . . _:genid5594 . _:genid5595 . _:genid5597 _:genid5596 . _:genid5595 _:genid5597 . _:genid5596 . _:genid5596 . _:genid5596 . _:genid5597 . _:genid5594 _:genid5595 . _:genid5594 . . . "IDA"^^ . "A type of confocal laser scanning microscopy evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "CLSM"^^ . "LSCM"^^ . "confocal laser scanning fluorescence microscopy"^^ . "confocal-laser scanning microscopy"^^ . "fluorescence confocal scanning laser microscopy"^^ . "scanning confocal fluorescence microscopy"^^ . "ECO:0007060"^^ . "confocal laser scanning microscopy evidence used in manual assertion"^^ . _:genid5598 . _:genid5598 . _:genid5598 . _:genid5598 . _:genid5598 "true"^^ . _:genid5599 . _:genid5599 . _:genid5599 . _:genid5599 "A type of confocal laser scanning microscopy evidence that is used in a manual assertion."^^ . _:genid5599 "ECO:RCT"^^ . . . "A type of structure determination evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight, diffusion and interaction strength by illuminating the sample with a laser beam and the scattered intensity is probed at a certain angle by a detector."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007061"^^ . "light scattering evidence"^^ . _:genid5600 . _:genid5600 . _:genid5600 . _:genid5600 "A type of structure determination evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight, diffusion and interaction strength by illuminating the sample with a laser beam and the scattered intensity is probed at a certain angle by a detector."^^ . _:genid5600 "PMID:9013660"^^ . _:genid5600 "url:http://www.lsinstruments.ch/technology/dynamic_light_scattering_dls/"^^ . _:genid5600 "url:http://www.soft-matter.uni-tuebingen.de/index.html?dls.html"^^ . . _:genid5601 . _:genid5602 . _:genid5604 _:genid5603 . _:genid5602 _:genid5604 . _:genid5603 . _:genid5603 . _:genid5603 . _:genid5604 . _:genid5601 _:genid5602 . _:genid5601 . . . "EXP"^^ . "A type of light scattering evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007062"^^ . "light scattering evidence used in manual assertion"^^ . _:genid5605 . _:genid5605 . _:genid5605 . _:genid5605 . _:genid5605 "true"^^ . _:genid5606 . _:genid5606 . _:genid5606 . _:genid5606 "A type of light scattering evidence that is used in a manual assertion."^^ . _:genid5606 "ECO:RCT"^^ . . . "A type of light scattering evidence derived by analyzing the fluctuations in the internsity of the scattered light by the particles in motion."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "Photon Correlation Spectroscopy"^^ . "Quasi-Elastic Light Scattering"^^ . "ECO:0007063"^^ . "dynamic light scattering assay evidence"^^ . _:genid5607 . _:genid5607 . _:genid5607 . _:genid5607 "A type of light scattering evidence derived by analyzing the fluctuations in the internsity of the scattered light by the particles in motion."^^ . _:genid5607 "PMID:9013660"^^ . _:genid5607 "url:http://www.soft-matter.uni-tuebingen.de/index.html?dls.html"^^ . . _:genid5608 . _:genid5609 . _:genid5611 _:genid5610 . _:genid5609 _:genid5611 . _:genid5610 . _:genid5610 . _:genid5610 . _:genid5611 . _:genid5608 _:genid5609 . _:genid5608 . . . "EXP"^^ . "A type of dynamic light scattering assay evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "Photon Correlation Spectroscopy"^^ . "Quasi-Elastic Light Scattering"^^ . "ECO:0007064"^^ . "dynamic light scattering assay evidence used in manual assertion"^^ . _:genid5612 . _:genid5612 . _:genid5612 . _:genid5612 . _:genid5612 "true"^^ . _:genid5613 . _:genid5613 . _:genid5613 . _:genid5613 "A type of dynamic light scattering assay evidence that is used in a manual assertion."^^ . _:genid5613 "ECO:RCT"^^ . . . "A type of light scattering evidence derived by measuring the average intensity of scattered light by the particles at multiple angles."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "Rayleigh scattering"^^ . "ECO:0007065"^^ . "static light scattering assay evidence"^^ . _:genid5614 . _:genid5614 . _:genid5614 . _:genid5614 "A type of light scattering evidence derived by measuring the average intensity of scattered light by the particles at multiple angles."^^ . _:genid5614 "PMID:9013660"^^ . . _:genid5615 . _:genid5616 . _:genid5618 _:genid5617 . _:genid5616 _:genid5618 . _:genid5617 . _:genid5617 . _:genid5617 . _:genid5618 . _:genid5615 _:genid5616 . _:genid5615 . . . "EXP"^^ . "A type of static light scattering assay evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "Rayleigh scattering"^^ . "ECO:0007066"^^ . "static light scattering assay evidence used in manual assertion"^^ . _:genid5619 . _:genid5619 . _:genid5619 . _:genid5619 . _:genid5619 "true"^^ . _:genid5620 . _:genid5620 . _:genid5620 . _:genid5620 "A type of static light scattering assay evidence that is used in a manual assertion."^^ . _:genid5620 "ECO:RCT"^^ . . . "A type of colony morphology phenotypic evidence resulting from the formation of papillae (microcolonies) that protrude outwards from the main colony by mutant cells."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "colony papillation assay evidence"^^ . "ECO:0007067"^^ . "colony papillation assay phenotypic evidence"^^ . _:genid5621 . _:genid5621 . _:genid5621 . _:genid5621 "A type of colony morphology phenotypic evidence resulting from the formation of papillae (microcolonies) that protrude outwards from the main colony by mutant cells."^^ . _:genid5621 "PMID:27447898" . . _:genid5622 . _:genid5623 . _:genid5625 _:genid5624 . _:genid5623 _:genid5625 . _:genid5624 . _:genid5624 . _:genid5624 . _:genid5625 . _:genid5622 _:genid5623 . _:genid5622 . . . "EXP"^^ . "A type of colony papillation assay phenotypic evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "colony papillation assay evidence used in manual assertion"^^ . "ECO:0007068"^^ . "colony papillation assay phenotypic evidence used in manual assertion"^^ . _:genid5626 . _:genid5626 . _:genid5626 . _:genid5626 . _:genid5626 "true"^^ . _:genid5627 . _:genid5627 . _:genid5627 . _:genid5627 "A type of colony papillation assay phenotypic evidence that is used in a manual assertion."^^ . _:genid5627 "ECO:RCT"^^ . . . "A type of staining evidence that is derived from the use of gentian violet as a general biological stain and an acid-base indicator."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "gentian violet"^^ . "hexamethyl pararosaniline chloride"^^ . "methyl violet 10B"^^ . "ECO:0007069"^^ . "crystal violet staining evidence"^^ . _:genid5628 . _:genid5628 . _:genid5628 . _:genid5628 "A type of staining evidence that is derived from the use of gentian violet as a general biological stain and an acid-base indicator."^^ . _:genid5628 "BAO:0002468"^^ . . _:genid5629 . _:genid5630 . _:genid5632 _:genid5631 . _:genid5630 _:genid5632 . _:genid5631 . _:genid5631 . _:genid5631 . _:genid5632 . _:genid5629 _:genid5630 . _:genid5629 . . . "IDA"^^ . "A type of crystal violet staining evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "gentian violet"^^ . "hexamethyl pararosaniline chloride"^^ . "methyl violet 10B"^^ . "ECO:0007070"^^ . "crystal violet staining evidence used in manual assertion"^^ . _:genid5633 . _:genid5633 . _:genid5633 . _:genid5633 . _:genid5633 "true"^^ . _:genid5634 . _:genid5634 . _:genid5634 . _:genid5634 "A type of crystal violet staining evidence that is used in a manual assertion."^^ . _:genid5634 "ECO:RCT"^^ . . . _:genid5635 . _:genid5635 . _:genid5636 . _:genid5637 . _:genid5639 _:genid5638 . _:genid5637 _:genid5639 . _:genid5638 . _:genid5638 . _:genid5638 . _:genid5639 . _:genid5636 _:genid5637 . _:genid5635 _:genid5636 . _:genid5635 . "A type of biofilm formation assay evidence derived from in vitro cultivation and evaluation of bacterial biofilms under hydrodynamic conditions of flow."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007071"^^ . "flow cell biofilm assay evidence"^^ . _:genid5640 . _:genid5640 . _:genid5640 . _:genid5640 "A type of biofilm formation assay evidence derived from in vitro cultivation and evaluation of bacterial biofilms under hydrodynamic conditions of flow."^^ . _:genid5640 "URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3438488/"^^ . . _:genid5641 . _:genid5642 . _:genid5644 _:genid5643 . _:genid5642 _:genid5644 . _:genid5643 . _:genid5643 . _:genid5643 . _:genid5644 . _:genid5641 _:genid5642 . _:genid5641 . . . "IDA"^^ . "A type of flow cell biofilm assay evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007072"^^ . "flow cell biofilm assay evidence used in manual assertion"^^ . _:genid5645 . _:genid5645 . _:genid5645 . _:genid5645 . _:genid5645 "true"^^ . _:genid5646 . _:genid5646 . _:genid5646 . _:genid5646 "A type of flow cell biofilm assay evidence that is used in a manual assertion."^^ . _:genid5646 "ECO:RCT"^^ . . . "A type of bait-prey hybrid interaction evidence that involves the detection of protein-protein interaction by fusing the protein target (the \"bait\") to RNA polymerase and fusing protein or peptide library to be analyzed (the \"prey\") to DNA-binding domain."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007073"^^ . "bacterial 2-hybrid assay evidence"^^ . _:genid5647 . _:genid5647 . _:genid5647 . _:genid5647 "A type of bait-prey hybrid interaction evidence that involves the detection of protein-protein interaction by fusing the protein target (the \"bait\") to RNA polymerase and fusing protein or peptide library to be analyzed (the \"prey\") to DNA-binding domain."^^ . _:genid5647 "URL:http://www.pnas.org/content/97/13/7382.full.pdf"^^ . . _:genid5648 . _:genid5649 . _:genid5651 _:genid5650 . _:genid5649 _:genid5651 . _:genid5650 . _:genid5650 . _:genid5650 . _:genid5651 . _:genid5648 _:genid5649 . _:genid5648 . . . "IPI"^^ . "A type of bacterial 2-hybrid assay evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007074"^^ . "bacterial 2-hybrid assay evidence used in manual assertion"^^ . _:genid5652 . _:genid5652 . _:genid5652 . _:genid5652 . _:genid5652 "true"^^ . _:genid5653 . _:genid5653 . _:genid5653 . _:genid5653 "A type of bacterial 2-hybrid assay evidence that is used in a manual assertion."^^ . _:genid5653 "ECO:RCT"^^ . . . "A type of experimental phenotypic evidence that results from the comparison of phenotype profiles (the physical and biochemical traits of organisms in particular environments) across multiple strains; that is, a meta-analysis of a set of phenotypic patterns from many tests in response to a series of changing genetic and/or environmental factors."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007075"^^ . "A phenome is defined as the SET of physical and biochemical traits, or, as the SET of all phenotypes expressed, i.e. a phenome is defined as the sum total of all phenotypic traits."^^ . "D.S. notes: I think this term is meant to be used for high throughput experiments where a large number of mutants is screened for their ability to grow in a large number of conditions. The individual mutants can then clustered based on the similarity of their phenotypic profiles-whether they grew or didn't grow across all the conditions. The goal being to try to identify genes whose products function in the same biological pathways based on their having similar phenotypes across multiple conditions."^^ . "phenomic profiling assay evidence"^^ . _:genid5654 . _:genid5654 . _:genid5654 . _:genid5654 "A type of experimental phenotypic evidence that results from the comparison of phenotype profiles (the physical and biochemical traits of organisms in particular environments) across multiple strains; that is, a meta-analysis of a set of phenotypic patterns from many tests in response to a series of changing genetic and/or environmental factors."^^ . _:genid5654 "EDAM:topic:3298"^^ . _:genid5654 "PMID:2118507"^^ . . _:genid5655 . _:genid5656 . _:genid5658 _:genid5657 . _:genid5656 _:genid5658 . _:genid5657 . _:genid5657 . _:genid5657 . _:genid5658 . _:genid5655 _:genid5656 . _:genid5655 . . . "EXP"^^ . "A type of phenomic profiling assay evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007076"^^ . "phenomic profiling assay evidence used in manual assertion"^^ . _:genid5659 . _:genid5659 . _:genid5659 . _:genid5659 . _:genid5659 "true"^^ . _:genid5660 . _:genid5660 . _:genid5660 . _:genid5660 "A type of phenomic profiling assay evidence that is used in a manual assertion."^^ . _:genid5660 "ECO:RCT"^^ . . . "A type of experimental phenotypic evidence resulting from studying the physical characteristics of an assemblage of microorganisms growing on a solid surface such as the surface of an agar culture medium."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "colony morphology evidence"^^ . "ECO:0007077"^^ . "colony morphology phenotypic evidence"^^ . _:genid5661 . _:genid5661 . _:genid5661 . _:genid5661 "A type of experimental phenotypic evidence resulting from studying the physical characteristics of an assemblage of microorganisms growing on a solid surface such as the surface of an agar culture medium."^^ . _:genid5661 "OMP:0000100"^^ . . _:genid5662 . _:genid5663 . _:genid5665 _:genid5664 . _:genid5663 _:genid5665 . _:genid5664 . _:genid5664 . _:genid5664 . _:genid5665 . _:genid5662 _:genid5663 . _:genid5662 . . . "EXP"^^ . "A type of colony morphology phenotypic evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "colony morphology evidence used in manual assertion"^^ . "ECO:0007078"^^ . "colony morphology phenotypic evidence used in manual assertion"^^ . _:genid5666 . _:genid5666 . _:genid5666 . _:genid5666 . _:genid5666 "true"^^ . _:genid5667 . _:genid5667 . _:genid5667 . _:genid5667 "A type of colony morphology phenotypic evidence that is used in a manual assertion."^^ . _:genid5667 "ECO:RCT"^^ . . . "A type of colony morphology evidence resulting from studying the colony pigmentation."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "colony color evidence"^^ . "colony pigmentation"^^ . "ECO:0007079"^^ . "colony color phenotypic evidence"^^ . _:genid5668 . _:genid5668 . _:genid5668 . _:genid5668 "A type of colony morphology evidence resulting from studying the colony pigmentation."^^ . _:genid5668 "URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4671912/"^^ . . _:genid5669 . _:genid5670 . _:genid5672 _:genid5671 . _:genid5670 _:genid5672 . _:genid5671 . _:genid5671 . _:genid5671 . _:genid5672 . _:genid5669 _:genid5670 . _:genid5669 . . . "EXP"^^ . "A type of colony color phenotypic evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "colony pigmentation"^^ . "colony color evidence used in manual assertion"^^ . "ECO:0007080"^^ . "colony color phenotypic evidence used in manual assertion"^^ . _:genid5673 . _:genid5673 . _:genid5673 . _:genid5673 . _:genid5673 "true"^^ . _:genid5674 . _:genid5674 . _:genid5674 . _:genid5674 "A type of colony color phenotypic evidence that is used in a manual assertion."^^ . _:genid5674 "ECO:RCT"^^ . . . "A type of colony morphology phenotypic evidence resulting from measuring the area or diameter of the colony."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "colony size evidence"^^ . "ECO:0007081"^^ . "colony size phenotypic evidence"^^ . _:genid5675 . _:genid5675 . _:genid5675 . _:genid5675 "A type of colony morphology phenotypic evidence resulting from measuring the area or diameter of the colony."^^ . _:genid5675 "URL:http://www.nature.com/nrmicro/journal/v4/n4/full/nrmicro1384.html"^^ . . _:genid5676 . _:genid5677 . _:genid5679 _:genid5678 . _:genid5677 _:genid5679 . _:genid5678 . _:genid5678 . _:genid5678 . _:genid5679 . _:genid5676 _:genid5677 . _:genid5676 . . . "EXP"^^ . "A type of colony size phenotypic evidence that is used in an manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "colony size evidence used in manual assertion"^^ . "colony area phenotype evidence"^^ . "colony diameter phenotype evidence"^^ . "ECO:0007082"^^ . "colony size phenotypic evidence used in manual assertion"^^ . _:genid5680 . _:genid5680 . _:genid5680 . _:genid5680 . _:genid5680 "true"^^ . _:genid5681 . _:genid5681 . _:genid5681 . _:genid5681 "A type of colony size phenotypic evidence that is used in an manual assertion."^^ . _:genid5681 "ECO:RCT"^^ . . . _:genid5682 . _:genid5682 . _:genid5682 . _:genid5682 . _:genid5683 . _:genid5683 . _:genid5683 . _:genid5683 . _:genid5684 . _:genid5684 . _:genid5685 . _:genid5686 . _:genid5688 _:genid5687 . _:genid5686 _:genid5688 . _:genid5687 . _:genid5687 . _:genid5687 . _:genid5688 . _:genid5685 _:genid5686 . _:genid5684 _:genid5685 . _:genid5684 . _:genid5689 . _:genid5689 . _:genid5690 . _:genid5691 . _:genid5693 _:genid5692 . _:genid5691 _:genid5693 . _:genid5692 . _:genid5692 . _:genid5694 . _:genid5694 . _:genid5694 . _:genid5692 _:genid5694 . _:genid5693 . _:genid5690 _:genid5691 . _:genid5689 _:genid5690 . _:genid5689 . "A type of cell growth assay evidence resulting from assessing the sensitivity or resistance of bacteria or fungi to an antimicrobial agent or chemical by measuring the size of the zone of inhibition that results when the test organism is grown on a solid surface in the presence of the antimicrobial agent or chemical."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007083"^^ . "zone of inhibition evidence"^^ . _:genid5695 . _:genid5695 . _:genid5695 . _:genid5695 "A type of cell growth assay evidence resulting from assessing the sensitivity or resistance of bacteria or fungi to an antimicrobial agent or chemical by measuring the size of the zone of inhibition that results when the test organism is grown on a solid surface in the presence of the antimicrobial agent or chemical."^^ . _:genid5695 "URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC153338/"^^ . . _:genid5696 . _:genid5697 . _:genid5699 _:genid5698 . _:genid5697 _:genid5699 . _:genid5698 . _:genid5698 . _:genid5698 . _:genid5699 . _:genid5696 _:genid5697 . _:genid5696 . . . "IDA"^^ . "A type of zone of inhibition evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "ECO:0007084"^^ . "zone of inhibition evidence used in manual assertion"^^ . _:genid5700 . _:genid5700 . _:genid5700 . _:genid5700 . _:genid5700 "true"^^ . _:genid5701 . _:genid5701 . _:genid5701 . _:genid5701 "A type of zone of inhibition evidence that is used in a manual assertion."^^ . _:genid5701 "ECO:RCT"^^ . . . _:genid5702 . _:genid5702 . _:genid5702 . _:genid5702 . "A type of zone of inhibition evidence resulting from testing the antimicrobial susceptibility by using predefined, continuous, and exponential gradient of antibiotic concentrations immobilized along a rectangular plastic test strip."^^ . "OMP"^^ . "snadendla"^^ . "2018-03-14T12:44:11Z"^^ . "epsilometer test"^^ . "ECO:0007085"^^ . "Etest evidence"^^ . _:genid5703 . _:genid5703 . _:genid5703 . _:genid5703 "A type of zone of inhibition evidence resulting from testing the antimicrobial susceptibility by using predefined, continuous, and exponential gradient of antibiotic concentrations immobilized along a rectangular plastic test strip."^^ . _:genid5703 "URL:http://www.joponline.org/doi/pdf/10.1902/jop.1992.63.7.576"^^ . . _:genid5704 . _:genid5705 . _:genid5707 _:genid5706 . _:genid5705 _:genid5707 . _:genid5706 . _:genid5706 . _:genid5706 . _:genid5707 . _:genid5704 _:genid5705 . _:genid5704 . . . "IDA"^^ . "A type of Etest evidence that is used in a manual assertion."^^ . "OMP"^^ . "rctauber"^^ . "2018-03-14T12:44:11Z"^^ . "epsilometer test"^^ . "ECO:0007086"^^ . "Etest evidence used in manual assertion"^^ . _:genid5708 . _:genid5708 . _:genid5708 . _:genid5708 . _:genid5708 "true"^^ . _:genid5709 . _:genid5709 . _:genid5709 . _:genid5709 "A type of Etest evidence that is used in a manual assertion."^^ . _:genid5709 "ECO:RCT"^^ . . . "A type of expression pattern evidence in which translation is measured by the positions of ribosomes active in a cell, identified through deep sequencing of ribosome-protected mRNA fragments."^^ . "GOC:VW"^^ . "rctauber"^^ . "2018-03-28T10:27:09Z"^^ . "ribo-seq evidence"^^ . "ribosome footprinting evidence"^^ . "translation profiling"^^ . "translatome profiling"^^ . "eco"^^ . "ECO:0007087"^^ . "ribosome profiling evidence"^^ . _:genid5710 . _:genid5710 . _:genid5710 . _:genid5710 "A type of expression pattern evidence in which translation is measured by the positions of ribosomes active in a cell, identified through deep sequencing of ribosome-protected mRNA fragments."^^ . _:genid5710 "PMID:27015305"^^ . . _:genid5711 . _:genid5712 . _:genid5714 _:genid5713 . _:genid5712 _:genid5714 . _:genid5713 . _:genid5713 . _:genid5713 . _:genid5714 . _:genid5711 _:genid5712 . _:genid5711 . . . "IEP"^^ . "A type of ribosome profiling evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-03-28T10:33:26Z"^^ . "ribo-seq evidence"^^ . "ribosome footprinting evidence"^^ . "eco"^^ . "ECO:0007087"^^ . "ribosome profiling evidence used in manual assertion"^^ . _:genid5715 . _:genid5715 . _:genid5715 . _:genid5715 . _:genid5715 "true"^^ . _:genid5716 . _:genid5716 . _:genid5716 . _:genid5716 "A type of ribosome profiling evidence that is used in a manual assertion."^^ . _:genid5716 "ECO:RCT"^^ . . _:genid5717 . _:genid5718 . _:genid5720 _:genid5719 . _:genid5718 _:genid5720 . _:genid5719 . _:genid5719 . _:genid5719 . _:genid5720 . _:genid5717 _:genid5718 . _:genid5717 . . . "IMP"^^ . "A type of loss-of-function mutant phenotype evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007089"^^ . "loss-of-function mutant phenotype evidence used in manual assertion"^^ . _:genid5721 . _:genid5721 . _:genid5721 . _:genid5721 . _:genid5721 "true"^^ . _:genid5722 . _:genid5722 . _:genid5722 . _:genid5722 . _:genid5722 "true"^^ . _:genid5723 . _:genid5723 . _:genid5723 . _:genid5723 "A type of loss-of-function mutant phenotype evidence that is used in a manual assertion."^^ . _:genid5723 "ECO:RCT"^^ . . _:genid5724 . _:genid5725 . _:genid5727 _:genid5726 . _:genid5725 _:genid5727 . _:genid5726 . _:genid5726 . _:genid5726 . _:genid5727 . _:genid5724 _:genid5725 . _:genid5724 . . . "A type of structural similarity evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007090"^^ . "structural similarity evidence used in manual assertion"^^ . _:genid5728 . _:genid5728 . _:genid5728 . _:genid5728 . _:genid5728 "true"^^ . _:genid5729 . _:genid5729 . _:genid5729 . _:genid5729 . _:genid5729 "true"^^ . _:genid5730 . _:genid5730 . _:genid5730 . _:genid5730 "A type of structural similarity evidence that is used in a manual assertion."^^ . _:genid5730 "ECO:RCT"^^ . . _:genid5731 . _:genid5732 . _:genid5734 _:genid5733 . _:genid5732 _:genid5734 . _:genid5733 . _:genid5733 . _:genid5733 . _:genid5734 . _:genid5731 _:genid5732 . _:genid5731 . . . "IMP"^^ . "A type of gain-of-function mutant phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "gain-of-function mutant phenotype evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007092"^^ . "gain-of-function mutant phenotypic evidence used in manual assertion"^^ . _:genid5735 . _:genid5735 . _:genid5735 . _:genid5735 . _:genid5735 "true"^^ . _:genid5736 . _:genid5736 . _:genid5736 . _:genid5736 . _:genid5736 "true"^^ . _:genid5737 . _:genid5737 . _:genid5737 . _:genid5737 "A type of gain-of-function mutant phenotypic evidence that is used in a manual assertion."^^ . _:genid5737 "ECO:RCT"^^ . . _:genid5738 . _:genid5739 . _:genid5741 _:genid5740 . _:genid5739 _:genid5741 . _:genid5740 . _:genid5740 . _:genid5740 . _:genid5741 . _:genid5738 _:genid5739 . _:genid5738 . . . "EXP"^^ . "A type of voucher specimen phenotypic analysis evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "voucher specimen analysis evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007093"^^ . "voucher specimen phenotypic analysis evidence used in manual assertion"^^ . _:genid5742 . _:genid5742 . _:genid5742 . _:genid5742 . _:genid5742 "true"^^ . _:genid5743 . _:genid5743 . _:genid5743 . _:genid5743 . _:genid5743 "true"^^ . _:genid5744 . _:genid5744 . _:genid5744 . _:genid5744 "A type of voucher specimen phenotypic analysis evidence that is used in a manual assertion."^^ . _:genid5744 "ECO:RCT"^^ . . _:genid5745 . _:genid5746 . _:genid5748 _:genid5747 . _:genid5746 _:genid5748 . _:genid5747 . _:genid5747 . _:genid5747 . _:genid5748 . _:genid5745 _:genid5746 . _:genid5745 . . . "A type of positional similarity evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007094"^^ . "positional similarity evidence used in manual assertion"^^ . _:genid5749 . _:genid5749 . _:genid5749 . _:genid5749 . _:genid5749 "true"^^ . _:genid5750 . _:genid5750 . _:genid5750 . _:genid5750 . _:genid5750 "true"^^ . _:genid5751 . _:genid5751 . _:genid5751 . _:genid5751 "A type of positional similarity evidence that is used in a manual assertion."^^ . _:genid5751 "ECO:RCT"^^ . . _:genid5752 . _:genid5753 . _:genid5755 _:genid5754 . _:genid5753 _:genid5755 . _:genid5754 . _:genid5754 . _:genid5754 . _:genid5755 . _:genid5752 _:genid5753 . _:genid5752 . . . "EXP"^^ . "A type of quantitative trait analysis evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007095"^^ . "quantitative trait analysis evidence used in manual assertion"^^ . _:genid5756 . _:genid5756 . _:genid5756 . _:genid5756 . _:genid5756 "true"^^ . _:genid5757 . _:genid5757 . _:genid5757 . _:genid5757 . _:genid5757 "true"^^ . _:genid5758 . _:genid5758 . _:genid5758 . _:genid5758 "A type of quantitative trait analysis evidence that is used in a manual assertion."^^ . _:genid5758 "ECO:RCT"^^ . . _:genid5759 . _:genid5760 . _:genid5762 _:genid5761 . _:genid5760 _:genid5762 . _:genid5761 . _:genid5761 . _:genid5761 . _:genid5762 . _:genid5759 _:genid5760 . _:genid5759 . . . "A type of compositional similarity evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007096"^^ . "compositional similarity evidence used in manual assertion"^^ . _:genid5763 . _:genid5763 . _:genid5763 . _:genid5763 . _:genid5763 "true"^^ . _:genid5764 . _:genid5764 . _:genid5764 . _:genid5764 . _:genid5764 "true"^^ . _:genid5765 . _:genid5765 . _:genid5765 . _:genid5765 "A type of compositional similarity evidence that is used in a manual assertion."^^ . _:genid5765 "ECO:RCT"^^ . . _:genid5766 . _:genid5767 . _:genid5769 _:genid5768 . _:genid5767 _:genid5769 . _:genid5768 . _:genid5768 . _:genid5768 . _:genid5769 . _:genid5766 _:genid5767 . _:genid5766 . . . "A type of developmental similarity evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007097"^^ . "developmental similarity evidence used in manual assertion"^^ . _:genid5770 . _:genid5770 . _:genid5770 . _:genid5770 . _:genid5770 "true"^^ . _:genid5771 . _:genid5771 . _:genid5771 . _:genid5771 . _:genid5771 "true"^^ . _:genid5772 . _:genid5772 . _:genid5772 . _:genid5772 "A type of developmental similarity evidence that is used in a manual assertion."^^ . _:genid5772 "ECO:RCT"^^ . . _:genid5773 . _:genid5774 . _:genid5776 _:genid5775 . _:genid5774 _:genid5776 . _:genid5775 . _:genid5775 . _:genid5775 . _:genid5776 . _:genid5773 _:genid5774 . _:genid5773 . . . "A type of morphological similarity evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007098"^^ . "morphological similarity evidence used in manual assertion"^^ . _:genid5777 . _:genid5777 . _:genid5777 . _:genid5777 . _:genid5777 "true"^^ . _:genid5778 . _:genid5778 . _:genid5778 . _:genid5778 . _:genid5778 "true"^^ . _:genid5779 . _:genid5779 . _:genid5779 . _:genid5779 "A type of morphological similarity evidence that is used in a manual assertion."^^ . _:genid5779 "ECO:RCT"^^ . . _:genid5780 . _:genid5781 . _:genid5783 _:genid5782 . _:genid5781 _:genid5783 . _:genid5782 . _:genid5782 . _:genid5782 . _:genid5783 . _:genid5780 _:genid5781 . _:genid5780 . . . "A type of gene expression similarity evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007099"^^ . "gene expression similarity evidence used in manual assertion"^^ . _:genid5784 . _:genid5784 . _:genid5784 . _:genid5784 . _:genid5784 "true"^^ . _:genid5785 . _:genid5785 . _:genid5785 . _:genid5785 . _:genid5785 "true"^^ . _:genid5786 . _:genid5786 . _:genid5786 . _:genid5786 "A type of gene expression similarity evidence that is used in a manual assertion."^^ . _:genid5786 "ECO:RCT"^^ . . _:genid5787 . _:genid5788 . _:genid5790 _:genid5789 . _:genid5788 _:genid5790 . _:genid5789 . _:genid5789 . _:genid5789 . _:genid5790 . _:genid5787 _:genid5788 . _:genid5787 . . . "IDA"^^ . "A type of methylation-specific polymerase chain reaction evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007100"^^ . "methylation-specific polymerase chain reaction evidence used in manual assertion"^^ . _:genid5791 . _:genid5791 . _:genid5791 . _:genid5791 . _:genid5791 "true"^^ . _:genid5792 . _:genid5792 . _:genid5792 . _:genid5792 . _:genid5792 "true"^^ . _:genid5793 . _:genid5793 . _:genid5793 . _:genid5793 "A type of methylation-specific polymerase chain reaction evidence that is used in a manual assertion."^^ . _:genid5793 "ECO:RCT"^^ . . _:genid5794 . _:genid5795 . _:genid5797 _:genid5796 . _:genid5795 _:genid5797 . _:genid5796 . _:genid5796 . _:genid5796 . _:genid5797 . _:genid5794 _:genid5795 . _:genid5794 . . . "EXP"^^ . "A type of southern hybridization evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007101"^^ . "southern hybridization evidence used in manual assertion"^^ . _:genid5798 . _:genid5798 . _:genid5798 . _:genid5798 . _:genid5798 "true"^^ . _:genid5799 . _:genid5799 . _:genid5799 . _:genid5799 . _:genid5799 "true"^^ . _:genid5800 . _:genid5800 . _:genid5800 . _:genid5800 "A type of southern hybridization evidence that is used in a manual assertion."^^ . _:genid5800 "ECO:RCT"^^ . . _:genid5801 . _:genid5802 . _:genid5804 _:genid5803 . _:genid5802 _:genid5804 . _:genid5803 . _:genid5803 . _:genid5803 . _:genid5804 . _:genid5801 _:genid5802 . _:genid5801 . . . "IDA"^^ . "A type of intermethylated site amplification evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007102"^^ . "intermethylated site amplification evidence used in manual assertion"^^ . _:genid5805 . _:genid5805 . _:genid5805 . _:genid5805 . _:genid5805 "true"^^ . _:genid5806 . _:genid5806 . _:genid5806 . _:genid5806 . _:genid5806 "true"^^ . _:genid5807 . _:genid5807 . _:genid5807 . _:genid5807 "A type of intermethylated site amplification evidence that is used in a manual assertion."^^ . _:genid5807 "ECO:RCT"^^ . . _:genid5808 . _:genid5809 . _:genid5811 _:genid5810 . _:genid5809 _:genid5811 . _:genid5810 . _:genid5810 . _:genid5810 . _:genid5811 . _:genid5808 _:genid5809 . _:genid5808 . . . "IDA"^^ . "A type of epitope-tagged protein immunolocalization evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007103"^^ . "epitope-tagged protein immunolocalization evidence used in manual assertion"^^ . _:genid5812 . _:genid5812 . _:genid5812 . _:genid5812 . _:genid5812 "true"^^ . _:genid5813 . _:genid5813 . _:genid5813 . _:genid5813 . _:genid5813 "true"^^ . _:genid5814 . _:genid5814 . _:genid5814 . _:genid5814 "A type of epitope-tagged protein immunolocalization evidence that is used in a manual assertion."^^ . _:genid5814 "ECO:RCT"^^ . . _:genid5815 . _:genid5816 . _:genid5818 _:genid5817 . _:genid5816 _:genid5818 . _:genid5817 . _:genid5817 . _:genid5817 . _:genid5818 . _:genid5815 _:genid5816 . _:genid5815 . . . "IDA"^^ . "A type of co-fractionation evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007104"^^ . "co-fractionation evidence used in manual assertion"^^ . _:genid5819 . _:genid5819 . _:genid5819 . _:genid5819 . _:genid5819 "true"^^ . _:genid5820 . _:genid5820 . _:genid5820 . _:genid5820 . _:genid5820 "true"^^ . _:genid5821 . _:genid5821 . _:genid5821 . _:genid5821 "A type of co-fractionation evidence that is used in a manual assertion."^^ . _:genid5821 "ECO:RCT"^^ . . _:genid5822 . _:genid5823 . _:genid5825 _:genid5824 . _:genid5823 _:genid5825 . _:genid5824 . _:genid5824 . _:genid5824 . _:genid5825 . _:genid5822 _:genid5823 . _:genid5822 . . . "IDA"^^ . "A type of green fluorescent protein fusion protein localization evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007106"^^ . "green fluorescent protein fusion protein localization evidence used in manual assertion"^^ . _:genid5826 . _:genid5826 . _:genid5826 . _:genid5826 . _:genid5826 "true"^^ . _:genid5827 . _:genid5827 . _:genid5827 . _:genid5827 . _:genid5827 "true"^^ . _:genid5828 . _:genid5828 . _:genid5828 . _:genid5828 "A type of green fluorescent protein fusion protein localization evidence that is used in a manual assertion."^^ . _:genid5828 "ECO:RCT"^^ . . _:genid5829 . _:genid5830 . _:genid5832 _:genid5831 . _:genid5830 _:genid5832 . _:genid5831 . _:genid5831 . _:genid5831 . _:genid5832 . _:genid5829 _:genid5830 . _:genid5829 . . . "IDA"^^ . "A type of yellow fluorescent protein fusion protein localization evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007107"^^ . "yellow fluorescent protein fusion protein localization evidence used in manual assertion"^^ . _:genid5833 . _:genid5833 . _:genid5833 . _:genid5833 . _:genid5833 "true"^^ . _:genid5834 . _:genid5834 . _:genid5834 . _:genid5834 . _:genid5834 "true"^^ . _:genid5835 . _:genid5835 . _:genid5835 . _:genid5835 "A type of yellow fluorescent protein fusion protein localization evidence that is used in a manual assertion."^^ . _:genid5835 "ECO:RCT"^^ . . _:genid5836 . _:genid5837 . _:genid5839 _:genid5838 . _:genid5837 _:genid5839 . _:genid5838 . _:genid5838 . _:genid5838 . _:genid5839 . _:genid5836 _:genid5837 . _:genid5836 . . . "IDA"^^ . "A type of beta-glucuronidase fusion protein localization evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007108"^^ . "beta-glucuronidase fusion protein localization evidence used in manual assertion"^^ . _:genid5840 . _:genid5840 . _:genid5840 . _:genid5840 . _:genid5840 "true"^^ . _:genid5841 . _:genid5841 . _:genid5841 . _:genid5841 . _:genid5841 "true"^^ . _:genid5842 . _:genid5842 . _:genid5842 . _:genid5842 "A type of beta-glucuronidase fusion protein localization evidence that is used in a manual assertion."^^ . _:genid5842 "ECO:RCT"^^ . . _:genid5843 . _:genid5844 . _:genid5846 _:genid5845 . _:genid5844 _:genid5846 . _:genid5845 . _:genid5845 . _:genid5845 . _:genid5846 . _:genid5843 _:genid5844 . _:genid5843 . . . "IDA"^^ . "A type of beta-galactosidase fusion protein localization evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007109"^^ . "beta-galactosidase fusion protein localization evidence used in manual assertion"^^ . _:genid5847 . _:genid5847 . _:genid5847 . _:genid5847 . _:genid5847 "true"^^ . _:genid5848 . _:genid5848 . _:genid5848 . _:genid5848 . _:genid5848 "true"^^ . _:genid5849 . _:genid5849 . _:genid5849 . _:genid5849 "A type of beta-galactosidase fusion protein localization evidence that is used in a manual assertion."^^ . _:genid5849 "ECO:RCT"^^ . . _:genid5850 . _:genid5851 . _:genid5853 _:genid5852 . _:genid5851 _:genid5853 . _:genid5852 . _:genid5852 . _:genid5852 . _:genid5853 . _:genid5850 _:genid5851 . _:genid5850 . . . "EXP"^^ . "A type of thin layer chromatography evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007110"^^ . "thin layer chromatography evidence used in manual assertion"^^ . _:genid5854 . _:genid5854 . _:genid5854 . _:genid5854 . _:genid5854 "true"^^ . _:genid5855 . _:genid5855 . _:genid5855 . _:genid5855 . _:genid5855 "true"^^ . _:genid5856 . _:genid5856 . _:genid5856 . _:genid5856 "A type of thin layer chromatography evidence that is used in a manual assertion."^^ . _:genid5856 "ECO:RCT"^^ . . _:genid5857 . _:genid5858 . _:genid5860 _:genid5859 . _:genid5858 _:genid5860 . _:genid5859 . _:genid5859 . _:genid5859 . _:genid5860 . _:genid5857 _:genid5858 . _:genid5857 . . . "IDA"^^ . "A type of in vitro recombinant protein transcription reconstitution assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007111"^^ . "in vitro recombinant protein transcription reconstitution assay evidence used in manual assertion"^^ . _:genid5861 . _:genid5861 . _:genid5861 . _:genid5861 . _:genid5861 "true"^^ . _:genid5862 . _:genid5862 . _:genid5862 . _:genid5862 . _:genid5862 "true"^^ . _:genid5863 . _:genid5863 . _:genid5863 . _:genid5863 "A type of in vitro recombinant protein transcription reconstitution assay evidence that is used in a manual assertion."^^ . _:genid5863 "ECO:RCT"^^ . . _:genid5864 . _:genid5865 . _:genid5867 _:genid5866 . _:genid5865 _:genid5867 . _:genid5866 . _:genid5866 . _:genid5866 . _:genid5867 . _:genid5864 _:genid5865 . _:genid5864 . . . "IDA"^^ . "A type of protein separation followed by direct sequencing evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007112"^^ . "protein separation followed by direct sequencing evidence used in manual assertion"^^ . _:genid5868 . _:genid5868 . _:genid5868 . _:genid5868 . _:genid5868 "true"^^ . _:genid5869 . _:genid5869 . _:genid5869 . _:genid5869 . _:genid5869 "true"^^ . _:genid5870 . _:genid5870 . _:genid5870 . _:genid5870 "A type of protein separation followed by direct sequencing evidence that is used in a manual assertion."^^ . _:genid5870 "ECO:RCT"^^ . . _:genid5871 . _:genid5872 . _:genid5874 _:genid5873 . _:genid5872 _:genid5874 . _:genid5873 . _:genid5873 . _:genid5873 . _:genid5874 . _:genid5871 _:genid5872 . _:genid5871 . . . "IDA"^^ . "A type of protein separation followed by fragment identification evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007113"^^ . "protein separation followed by fragment identification evidence used in manual assertion"^^ . _:genid5875 . _:genid5875 . _:genid5875 . _:genid5875 . _:genid5875 "true"^^ . _:genid5876 . _:genid5876 . _:genid5876 . _:genid5876 . _:genid5876 "true"^^ . _:genid5877 . _:genid5877 . _:genid5877 . _:genid5877 "A type of protein separation followed by fragment identification evidence that is used in a manual assertion."^^ . _:genid5877 "ECO:RCT"^^ . . _:genid5878 . _:genid5879 . _:genid5881 _:genid5880 . _:genid5879 _:genid5881 . _:genid5880 . _:genid5880 . _:genid5880 . _:genid5881 . _:genid5878 _:genid5879 . _:genid5878 . . . "IDA"^^ . "A type of heterologous system uptake evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007114"^^ . "heterologous system uptake evidence used in manual assertion"^^ . _:genid5882 . _:genid5882 . _:genid5882 . _:genid5882 . _:genid5882 "true"^^ . _:genid5883 . _:genid5883 . _:genid5883 . _:genid5883 . _:genid5883 "true"^^ . _:genid5884 . _:genid5884 . _:genid5884 . _:genid5884 "A type of heterologous system uptake evidence that is used in a manual assertion."^^ . _:genid5884 "ECO:RCT"^^ . . _:genid5885 . _:genid5886 . _:genid5888 _:genid5887 . _:genid5886 _:genid5888 . _:genid5887 . _:genid5887 . _:genid5887 . _:genid5888 . _:genid5885 _:genid5886 . _:genid5885 . . . "IDA"^^ . "A type of two-electrode voltage clamp recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007115"^^ . "two-electrode voltage clamp recording evidence used in manual assertion"^^ . _:genid5889 . _:genid5889 . _:genid5889 . _:genid5889 . _:genid5889 "true"^^ . _:genid5890 . _:genid5890 . _:genid5890 . _:genid5890 . _:genid5890 "true"^^ . _:genid5891 . _:genid5891 . _:genid5891 . _:genid5891 "A type of two-electrode voltage clamp recording evidence that is used in a manual assertion."^^ . _:genid5891 "ECO:RCT"^^ . . _:genid5892 . _:genid5893 . _:genid5895 _:genid5894 . _:genid5893 _:genid5895 . _:genid5894 . _:genid5894 . _:genid5894 . _:genid5895 . _:genid5892 _:genid5893 . _:genid5892 . . . "EXP"^^ . "A type of biochemical trait analysis evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007116"^^ . "biochemical trait analysis evidence used in manual assertion"^^ . _:genid5896 . _:genid5896 . _:genid5896 . _:genid5896 . _:genid5896 "true"^^ . _:genid5897 . _:genid5897 . _:genid5897 . _:genid5897 . _:genid5897 "true"^^ . _:genid5898 . _:genid5898 . _:genid5898 . _:genid5898 "A type of biochemical trait analysis evidence that is used in a manual assertion."^^ . _:genid5898 "ECO:RCT"^^ . . _:genid5899 . _:genid5900 . _:genid5902 _:genid5901 . _:genid5900 _:genid5902 . _:genid5901 . _:genid5901 . _:genid5901 . _:genid5902 . _:genid5899 _:genid5900 . _:genid5899 . . . "IMP"^^ . "A type of mutant physiological response evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007117"^^ . "mutant physiological response evidence used in manual assertion"^^ . _:genid5903 . _:genid5903 . _:genid5903 . _:genid5903 . _:genid5903 "true"^^ . _:genid5904 . _:genid5904 . _:genid5904 . _:genid5904 . _:genid5904 "true"^^ . _:genid5905 . _:genid5905 . _:genid5905 . _:genid5905 "A type of mutant physiological response evidence that is used in a manual assertion."^^ . _:genid5905 "ECO:RCT"^^ . . _:genid5906 . _:genid5907 . _:genid5909 _:genid5908 . _:genid5907 _:genid5909 . _:genid5908 . _:genid5908 . _:genid5908 . _:genid5909 . _:genid5906 _:genid5907 . _:genid5906 . . . "IMP"^^ . "A type of mutant visible phenotype evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007118"^^ . "mutant visible phenotype evidence used in manual assertion"^^ . _:genid5910 . _:genid5910 . _:genid5910 . _:genid5910 . _:genid5910 "true"^^ . _:genid5911 . _:genid5911 . _:genid5911 . _:genid5911 . _:genid5911 "true"^^ . _:genid5912 . _:genid5912 . _:genid5912 . _:genid5912 "A type of mutant visible phenotype evidence that is used in a manual assertion."^^ . _:genid5912 "ECO:RCT"^^ . . _:genid5913 . _:genid5914 . _:genid5916 _:genid5915 . _:genid5914 _:genid5916 . _:genid5915 . _:genid5915 . _:genid5915 . _:genid5916 . _:genid5913 _:genid5914 . _:genid5913 . . . "IDA"^^ . "A type of in vivo assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007119"^^ . "in vivo assay evidence used in manual assertion"^^ . _:genid5917 . _:genid5917 . _:genid5917 . _:genid5917 . _:genid5917 "true"^^ . _:genid5918 . _:genid5918 . _:genid5918 . _:genid5918 . _:genid5918 "true"^^ . _:genid5919 . _:genid5919 . _:genid5919 . _:genid5919 "A type of in vivo assay evidence that is used in a manual assertion."^^ . _:genid5919 "ECO:RCT"^^ . . _:genid5920 . _:genid5921 . _:genid5923 _:genid5922 . _:genid5921 _:genid5923 . _:genid5922 . _:genid5922 . _:genid5922 . _:genid5923 . _:genid5920 _:genid5921 . _:genid5920 . . . "EXP"^^ . "A type of animal model system study evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007120"^^ . "animal model system study evidence used in manual assertion"^^ . _:genid5924 . _:genid5924 . _:genid5924 . _:genid5924 . _:genid5924 "true"^^ . _:genid5925 . _:genid5925 . _:genid5925 . _:genid5925 . _:genid5925 "true"^^ . _:genid5926 . _:genid5926 . _:genid5926 . _:genid5926 "A type of animal model system study evidence that is used in a manual assertion."^^ . _:genid5926 "ECO:RCT"^^ . . _:genid5927 . _:genid5928 . _:genid5930 _:genid5929 . _:genid5928 _:genid5930 . _:genid5929 . _:genid5929 . _:genid5929 . _:genid5930 . _:genid5927 _:genid5928 . _:genid5927 . . . "EXP"^^ . "A type of clinical study evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007121"^^ . "clinical study evidence used in manual assertion"^^ . _:genid5931 . _:genid5931 . _:genid5931 . _:genid5931 . _:genid5931 "true"^^ . _:genid5932 . _:genid5932 . _:genid5932 . _:genid5932 . _:genid5932 "true"^^ . _:genid5933 . _:genid5933 . _:genid5933 . _:genid5933 "A type of clinical study evidence that is used in a manual assertion."^^ . _:genid5933 "ECO:RCT"^^ . . _:genid5934 . _:genid5935 . _:genid5937 _:genid5936 . _:genid5935 _:genid5937 . _:genid5936 . _:genid5936 . _:genid5936 . _:genid5937 . _:genid5934 _:genid5935 . _:genid5934 . . . "IDA"^^ . "A type of in vitro assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007122"^^ . "in vitro assay evidence used in manual assertion"^^ . _:genid5938 . _:genid5938 . _:genid5938 . _:genid5938 . _:genid5938 "true"^^ . _:genid5939 . _:genid5939 . _:genid5939 . _:genid5939 . _:genid5939 "true"^^ . _:genid5940 . _:genid5940 . _:genid5940 . _:genid5940 "A type of in vitro assay evidence that is used in a manual assertion."^^ . _:genid5940 "ECO:RCT"^^ . . _:genid5941 . _:genid5942 . _:genid5944 _:genid5943 . _:genid5942 _:genid5944 . _:genid5943 . _:genid5943 . _:genid5943 . _:genid5944 . _:genid5941 _:genid5942 . _:genid5941 . . . . "IDA"^^ . "A type of enzyme inhibition evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007123"^^ . "enzyme inhibition evidence used in manual assertion"^^ . _:genid5945 . _:genid5945 . _:genid5945 . _:genid5945 . _:genid5945 "true"^^ . _:genid5946 . _:genid5946 . _:genid5946 . _:genid5946 . _:genid5946 "true"^^ . _:genid5947 . _:genid5947 . _:genid5947 . _:genid5947 . _:genid5947 "true"^^ . _:genid5948 . _:genid5948 . _:genid5948 . _:genid5948 "A type of enzyme inhibition evidence that is used in a manual assertion."^^ . _:genid5948 "ECO:RCT"^^ . . _:genid5949 . _:genid5950 . _:genid5952 _:genid5951 . _:genid5950 _:genid5952 . _:genid5951 . _:genid5951 . _:genid5951 . _:genid5952 . _:genid5949 _:genid5950 . _:genid5949 . . . "EXP"^^ . "A type of Illumina sequencing evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007125"^^ . "Illumina sequencing evidence used in manual assertion"^^ . _:genid5953 . _:genid5953 . _:genid5953 . _:genid5953 . _:genid5953 "true"^^ . _:genid5954 . _:genid5954 . _:genid5954 . _:genid5954 . _:genid5954 "true"^^ . _:genid5955 . _:genid5955 . _:genid5955 . _:genid5955 "A type of Illumina sequencing evidence that is used in a manual assertion."^^ . _:genid5955 "ECO:RCT"^^ . . _:genid5956 . _:genid5957 . _:genid5959 _:genid5958 . _:genid5957 _:genid5959 . _:genid5958 . _:genid5958 . _:genid5958 . _:genid5959 . _:genid5956 _:genid5957 . _:genid5956 . . . "EXP"^^ . "A type of 454 pyrosequencing evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007126"^^ . "454 pyrosequencing evidence used in manual assertion"^^ . _:genid5960 . _:genid5960 . _:genid5960 . _:genid5960 . _:genid5960 "true"^^ . _:genid5961 . _:genid5961 . _:genid5961 . _:genid5961 . _:genid5961 "true"^^ . _:genid5962 . _:genid5962 . _:genid5962 . _:genid5962 "A type of 454 pyrosequencing evidence that is used in a manual assertion."^^ . _:genid5962 "ECO:RCT"^^ . . _:genid5963 . _:genid5964 . _:genid5966 _:genid5965 . _:genid5964 _:genid5966 . _:genid5965 . _:genid5965 . _:genid5965 . _:genid5966 . _:genid5963 _:genid5964 . _:genid5963 . . . "EXP"^^ . "A type of SOLiD sequencing evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007127"^^ . "SOLiD sequencing evidence used in manual assertion"^^ . _:genid5967 . _:genid5967 . _:genid5967 . _:genid5967 . _:genid5967 "true"^^ . _:genid5968 . _:genid5968 . _:genid5968 . _:genid5968 . _:genid5968 "true"^^ . _:genid5969 . _:genid5969 . _:genid5969 . _:genid5969 "A type of SOLiD sequencing evidence that is used in a manual assertion."^^ . _:genid5969 "ECO:RCT"^^ . . _:genid5970 . _:genid5971 . _:genid5973 _:genid5972 . _:genid5971 _:genid5973 . _:genid5972 . _:genid5972 . _:genid5972 . _:genid5973 . _:genid5970 _:genid5971 . _:genid5970 . . . "EXP"^^ . "A type of chain termination sequencing evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007128"^^ . "chain termination sequencing evidence used in manual assertion"^^ . _:genid5974 . _:genid5974 . _:genid5974 . _:genid5974 . _:genid5974 "true"^^ . _:genid5975 . _:genid5975 . _:genid5975 . _:genid5975 . _:genid5975 "true"^^ . _:genid5976 . _:genid5976 . _:genid5976 . _:genid5976 "A type of chain termination sequencing evidence that is used in a manual assertion."^^ . _:genid5976 "ECO:RCT"^^ . . _:genid5977 . _:genid5978 . _:genid5980 _:genid5979 . _:genid5978 _:genid5980 . _:genid5979 . _:genid5979 . _:genid5979 . _:genid5980 . _:genid5977 _:genid5978 . _:genid5977 . . . "IPI"^^ . "A type of chromatin immunoprecipitation-qPCR evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007129"^^ . "chromatin immunoprecipitation-qPCR evidence used in manual assertion"^^ . _:genid5981 . _:genid5981 . _:genid5981 . _:genid5981 . _:genid5981 "true"^^ . _:genid5982 . _:genid5982 . _:genid5982 . _:genid5982 . _:genid5982 "true"^^ . _:genid5983 . _:genid5983 . _:genid5983 . _:genid5983 "A type of chromatin immunoprecipitation-qPCR evidence that is used in a manual assertion."^^ . _:genid5983 "ECO:RCT"^^ . . _:genid5984 . _:genid5985 . _:genid5987 _:genid5986 . _:genid5985 _:genid5987 . _:genid5986 . _:genid5986 . _:genid5986 . _:genid5987 . _:genid5984 _:genid5985 . _:genid5984 . . . "EXP"^^ . "A type of 4C evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "circularized chromosome conformation capture evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007130"^^ . "4C evidence used in manual assertion"^^ . _:genid5988 . _:genid5988 . _:genid5988 . _:genid5988 . _:genid5988 "true"^^ . _:genid5989 . _:genid5989 . _:genid5989 . _:genid5989 . _:genid5989 "true"^^ . _:genid5990 . _:genid5990 . _:genid5990 . _:genid5990 "A type of 4C evidence that is used in a manual assertion."^^ . _:genid5990 "ECO:RCT"^^ . . _:genid5991 . _:genid5992 . _:genid5994 _:genid5993 . _:genid5992 _:genid5994 . _:genid5993 . _:genid5993 . _:genid5993 . _:genid5994 . _:genid5991 _:genid5992 . _:genid5991 . . . "EXP"^^ . "A type of 5C evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "carbon-copy chromosome conformation capture evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007131"^^ . "5C evidence used in manual assertion"^^ . _:genid5995 . _:genid5995 . _:genid5995 . _:genid5995 . _:genid5995 "true"^^ . _:genid5996 . _:genid5996 . _:genid5996 . _:genid5996 . _:genid5996 "true"^^ . _:genid5997 . _:genid5997 . _:genid5997 . _:genid5997 "A type of 5C evidence that is used in a manual assertion."^^ . _:genid5997 "ECO:RCT"^^ . . _:genid5998 . _:genid5999 . _:genid6001 _:genid6000 . _:genid5999 _:genid6001 . _:genid6000 . _:genid6000 . _:genid6000 . _:genid6001 . _:genid5998 _:genid5999 . _:genid5998 . . . "EXP"^^ . "A type of 3C-qPCR evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "chromosome conformation capture-qPCR evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007133"^^ . "3C-qPCR evidence used in manual assertion"^^ . _:genid6002 . _:genid6002 . _:genid6002 . _:genid6002 . _:genid6002 "true"^^ . _:genid6003 . _:genid6003 . _:genid6003 . _:genid6003 . _:genid6003 "true"^^ . _:genid6004 . _:genid6004 . _:genid6004 . _:genid6004 "A type of 3C-qPCR evidence that is used in a manual assertion."^^ . _:genid6004 "ECO:RCT"^^ . . _:genid6005 . _:genid6006 . _:genid6008 _:genid6007 . _:genid6006 _:genid6008 . _:genid6007 . _:genid6007 . _:genid6007 . _:genid6008 . _:genid6005 _:genid6006 . _:genid6005 . . . "EXP"^^ . "A type of Hi-C evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007134"^^ . "Hi-C evidence used in manual assertion"^^ . _:genid6009 . _:genid6009 . _:genid6009 . _:genid6009 . _:genid6009 "true"^^ . _:genid6010 . _:genid6010 . _:genid6010 . _:genid6010 . _:genid6010 "true"^^ . _:genid6011 . _:genid6011 . _:genid6011 . _:genid6011 "A type of Hi-C evidence that is used in a manual assertion."^^ . _:genid6011 "ECO:RCT"^^ . . _:genid6012 . _:genid6013 . _:genid6015 _:genid6014 . _:genid6013 _:genid6015 . _:genid6014 . _:genid6014 . _:genid6014 . _:genid6015 . _:genid6012 _:genid6013 . _:genid6012 . . . "EXP"^^ . "A type of 3C-seq evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "chromosome conformation capture sequencing evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007135"^^ . "3C-seq evidence used in manual assertion"^^ . _:genid6016 . _:genid6016 . _:genid6016 . _:genid6016 . _:genid6016 "true"^^ . _:genid6017 . _:genid6017 . _:genid6017 . _:genid6017 . _:genid6017 "true"^^ . _:genid6018 . _:genid6018 . _:genid6018 . _:genid6018 "A type of 3C-seq evidence that is used in a manual assertion."^^ . _:genid6018 "ECO:RCT"^^ . . _:genid6019 . _:genid6020 . _:genid6022 _:genid6021 . _:genid6020 _:genid6022 . _:genid6021 . _:genid6021 . _:genid6021 . _:genid6022 . _:genid6019 _:genid6020 . _:genid6019 . . . "EXP"^^ . "A type of environmental perturbation phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "environmental perturbation evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007136"^^ . "environmental perturbation phenotypic evidence used in manual assertion"^^ . _:genid6023 . _:genid6023 . _:genid6023 . _:genid6023 . _:genid6023 "true"^^ . _:genid6024 . _:genid6024 . _:genid6024 . _:genid6024 . _:genid6024 "true"^^ . _:genid6025 . _:genid6025 . _:genid6025 . _:genid6025 "A type of environmental perturbation phenotypic evidence that is used in a manual assertion."^^ . _:genid6025 "ECO:RCT"^^ . . _:genid6026 . _:genid6027 . _:genid6029 _:genid6028 . _:genid6027 _:genid6029 . _:genid6028 . _:genid6028 . _:genid6028 . _:genid6029 . _:genid6026 _:genid6027 . _:genid6026 . . . "EXP"^^ . "A type of tissue ablation phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "tissue ablation evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007137"^^ . "tissue ablation phenotypic evidence used in manual assertion"^^ . _:genid6030 . _:genid6030 . _:genid6030 . _:genid6030 . _:genid6030 "true"^^ . _:genid6031 . _:genid6031 . _:genid6031 . _:genid6031 . _:genid6031 "true"^^ . _:genid6032 . _:genid6032 . _:genid6032 . _:genid6032 "A type of tissue ablation phenotypic evidence that is used in a manual assertion."^^ . _:genid6032 "ECO:RCT"^^ . . _:genid6033 . _:genid6034 . _:genid6036 _:genid6035 . _:genid6034 _:genid6036 . _:genid6035 . _:genid6035 . _:genid6035 . _:genid6036 . _:genid6033 _:genid6034 . _:genid6033 . . . "EXP"^^ . "A type of tissue grafting phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "tissue grafting evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007138"^^ . "tissue grafting phenotypic evidence used in manual assertion"^^ . _:genid6037 . _:genid6037 . _:genid6037 . _:genid6037 . _:genid6037 "true"^^ . _:genid6038 . _:genid6038 . _:genid6038 . _:genid6038 . _:genid6038 "true"^^ . _:genid6039 . _:genid6039 . _:genid6039 . _:genid6039 "A type of tissue grafting phenotypic evidence that is used in a manual assertion."^^ . _:genid6039 "ECO:RCT"^^ . . _:genid6040 . _:genid6041 . _:genid6043 _:genid6042 . _:genid6041 _:genid6043 . _:genid6042 . _:genid6042 . _:genid6042 . _:genid6043 . _:genid6040 _:genid6041 . _:genid6040 . . . "EXP"^^ . "A type of cytochalasin experiment evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007141"^^ . "cytochalasin experiment evidence used in manual assertion"^^ . _:genid6044 . _:genid6044 . _:genid6044 . _:genid6044 . _:genid6044 "true"^^ . _:genid6045 . _:genid6045 . _:genid6045 . _:genid6045 . _:genid6045 "true"^^ . _:genid6046 . _:genid6046 . _:genid6046 . _:genid6046 "A type of cytochalasin experiment evidence that is used in a manual assertion."^^ . _:genid6046 "ECO:RCT"^^ . . _:genid6047 . _:genid6048 . _:genid6050 _:genid6049 . _:genid6048 _:genid6050 . _:genid6049 . _:genid6049 . _:genid6049 . _:genid6050 . _:genid6047 _:genid6048 . _:genid6047 . . . "IDA"^^ . "A type of green fluorescent protein immunolocalization evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007142"^^ . "green fluorescent protein immunolocalization evidence used in manual assertion"^^ . _:genid6051 . _:genid6051 . _:genid6051 . _:genid6051 . _:genid6051 "true"^^ . _:genid6052 . _:genid6052 . _:genid6052 . _:genid6052 . _:genid6052 "true"^^ . _:genid6053 . _:genid6053 . _:genid6053 . _:genid6053 "A type of green fluorescent protein immunolocalization evidence that is used in a manual assertion."^^ . _:genid6053 "ECO:RCT"^^ . . _:genid6054 . _:genid6055 . _:genid6057 _:genid6056 . _:genid6055 _:genid6057 . _:genid6056 . _:genid6056 . _:genid6056 . _:genid6057 . _:genid6054 _:genid6055 . _:genid6054 . . . "IDA"^^ . "A type of beta-galactosidase protein immunolocalization evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007143"^^ . "beta-galactosidase protein immunolocalization evidence used in manual assertion"^^ . _:genid6058 . _:genid6058 . _:genid6058 . _:genid6058 . _:genid6058 "true"^^ . _:genid6059 . _:genid6059 . _:genid6059 . _:genid6059 . _:genid6059 "true"^^ . _:genid6060 . _:genid6060 . _:genid6060 . _:genid6060 "A type of beta-galactosidase protein immunolocalization evidence that is used in a manual assertion."^^ . _:genid6060 "ECO:RCT"^^ . . _:genid6061 . _:genid6062 . _:genid6064 _:genid6063 . _:genid6062 _:genid6064 . _:genid6063 . _:genid6063 . _:genid6063 . _:genid6064 . _:genid6061 _:genid6062 . _:genid6061 . . . "IEP"^^ . "A type of cap analysis of gene expression evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007144"^^ . "cap analysis of gene expression evidence used in manual assertion"^^ . _:genid6065 . _:genid6065 . _:genid6065 . _:genid6065 . _:genid6065 "true"^^ . _:genid6066 . _:genid6066 . _:genid6066 . _:genid6066 . _:genid6066 "true"^^ . _:genid6067 . _:genid6067 . _:genid6067 . _:genid6067 "A type of cap analysis of gene expression evidence that is used in a manual assertion."^^ . _:genid6067 "ECO:RCT"^^ . . _:genid6068 . _:genid6069 . _:genid6071 _:genid6070 . _:genid6069 _:genid6071 . _:genid6070 . _:genid6070 . _:genid6070 . _:genid6071 . _:genid6068 _:genid6069 . _:genid6068 . . . "IEP"^^ . "A type of nano-cap analysis of gene expression evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007145"^^ . "nano-cap analysis of gene expression evidence used in manual assertion"^^ . _:genid6072 . _:genid6072 . _:genid6072 . _:genid6072 . _:genid6072 "true"^^ . _:genid6073 . _:genid6073 . _:genid6073 . _:genid6073 . _:genid6073 "true"^^ . _:genid6074 . _:genid6074 . _:genid6074 . _:genid6074 "A type of nano-cap analysis of gene expression evidence that is used in a manual assertion."^^ . _:genid6074 "ECO:RCT"^^ . . _:genid6075 . _:genid6076 . _:genid6078 _:genid6077 . _:genid6076 _:genid6078 . _:genid6077 . _:genid6077 . _:genid6077 . _:genid6078 . _:genid6075 _:genid6076 . _:genid6075 . . . "IDA"^^ . "A type of particle size and count assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007146"^^ . "particle size and count assay evidence used in manual assertion"^^ . _:genid6079 . _:genid6079 . _:genid6079 . _:genid6079 . _:genid6079 "true"^^ . _:genid6080 . _:genid6080 . _:genid6080 . _:genid6080 . _:genid6080 "true"^^ . _:genid6081 . _:genid6081 . _:genid6081 . _:genid6081 "A type of particle size and count assay evidence that is used in a manual assertion."^^ . _:genid6081 "ECO:RCT"^^ . . _:genid6082 . _:genid6083 . _:genid6085 _:genid6084 . _:genid6083 _:genid6085 . _:genid6084 . _:genid6084 . _:genid6084 . _:genid6085 . _:genid6082 _:genid6083 . _:genid6082 . . . "IDA"^^ . "A type of competitive growth assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007147"^^ . "competitive growth assay evidence used in manual assertion"^^ . _:genid6086 . _:genid6086 . _:genid6086 . _:genid6086 . _:genid6086 "true"^^ . _:genid6087 . _:genid6087 . _:genid6087 . _:genid6087 . _:genid6087 "true"^^ . _:genid6088 . _:genid6088 . _:genid6088 . _:genid6088 "A type of competitive growth assay evidence that is used in a manual assertion."^^ . _:genid6088 "ECO:RCT"^^ . . _:genid6089 . _:genid6090 . _:genid6092 _:genid6091 . _:genid6090 _:genid6092 . _:genid6091 . _:genid6091 . _:genid6091 . _:genid6092 . _:genid6089 _:genid6090 . _:genid6089 . . . "IDA"^^ . "A type of pulsed-field gel electrophoresis evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007148"^^ . "pulsed-field gel electrophoresis evidence used in manual assertion"^^ . _:genid6093 . _:genid6093 . _:genid6093 . _:genid6093 . _:genid6093 "true"^^ . _:genid6094 . _:genid6094 . _:genid6094 . _:genid6094 . _:genid6094 "true"^^ . _:genid6095 . _:genid6095 . _:genid6095 . _:genid6095 "A type of pulsed-field gel electrophoresis evidence that is used in a manual assertion."^^ . _:genid6095 "ECO:RCT"^^ . . _:genid6096 . _:genid6097 . _:genid6099 _:genid6098 . _:genid6097 _:genid6099 . _:genid6098 . _:genid6098 . _:genid6098 . _:genid6099 . _:genid6096 _:genid6097 . _:genid6096 . . . "IDA"^^ . "A type of two-dimensional agarose gel electrophoresis evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007149"^^ . "two-dimensional agarose gel electrophoresis evidence used in manual assertion"^^ . _:genid6100 . _:genid6100 . _:genid6100 . _:genid6100 . _:genid6100 "true"^^ . _:genid6101 . _:genid6101 . _:genid6101 . _:genid6101 . _:genid6101 "true"^^ . _:genid6102 . _:genid6102 . _:genid6102 . _:genid6102 "A type of two-dimensional agarose gel electrophoresis evidence that is used in a manual assertion."^^ . _:genid6102 "ECO:RCT"^^ . . _:genid6103 . _:genid6104 . _:genid6106 _:genid6105 . _:genid6104 _:genid6106 . _:genid6105 . _:genid6105 . _:genid6105 . _:genid6106 . _:genid6103 _:genid6104 . _:genid6103 . . . "EXP"^^ . "A type of plasmid maintenance assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007150"^^ . "plasmid maintenance assay evidence used in manual assertion"^^ . _:genid6107 . _:genid6107 . _:genid6107 . _:genid6107 . _:genid6107 "true"^^ . _:genid6108 . _:genid6108 . _:genid6108 . _:genid6108 . _:genid6108 "true"^^ . _:genid6109 . _:genid6109 . _:genid6109 . _:genid6109 "A type of plasmid maintenance assay evidence that is used in a manual assertion."^^ . _:genid6109 "ECO:RCT"^^ . . _:genid6110 . _:genid6111 . _:genid6113 _:genid6112 . _:genid6111 _:genid6113 . _:genid6112 . _:genid6112 . _:genid6112 . _:genid6113 . _:genid6110 _:genid6111 . _:genid6110 . . . "IDA"^^ . "A type of specific protein inhibition by antibody evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007151"^^ . "specific protein inhibition by antibody evidence used in manual assertion"^^ . _:genid6114 . _:genid6114 . _:genid6114 . _:genid6114 . _:genid6114 "true"^^ . _:genid6115 . _:genid6115 . _:genid6115 . _:genid6115 . _:genid6115 "true"^^ . _:genid6116 . _:genid6116 . _:genid6116 . _:genid6116 "A type of specific protein inhibition by antibody evidence that is used in a manual assertion."^^ . _:genid6116 "ECO:RCT"^^ . . _:genid6117 . _:genid6118 . _:genid6120 _:genid6119 . _:genid6118 _:genid6120 . _:genid6119 . _:genid6119 . _:genid6119 . _:genid6120 . _:genid6117 _:genid6118 . _:genid6117 . . . "ISA"^^ . "A type of single exon transcript confirmation via alignment evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007152"^^ . "single exon transcript confirmation via alignment evidence used in manual assertion"^^ . _:genid6121 . _:genid6121 . _:genid6121 . _:genid6121 . _:genid6121 "true"^^ . _:genid6122 . _:genid6122 . _:genid6122 . _:genid6122 . _:genid6122 "true"^^ . _:genid6123 . _:genid6123 . _:genid6123 . _:genid6123 "A type of single exon transcript confirmation via alignment evidence that is used in a manual assertion."^^ . _:genid6123 "ECO:RCT"^^ . . _:genid6124 . _:genid6125 . _:genid6127 _:genid6126 . _:genid6125 _:genid6127 . _:genid6126 . _:genid6126 . _:genid6126 . _:genid6127 . _:genid6124 _:genid6125 . _:genid6124 . . . "A type of phylogenetic distribution evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007153"^^ . "phylogenetic distribution evidence used in manual assertion"^^ . _:genid6128 . _:genid6128 . _:genid6128 . _:genid6128 . _:genid6128 "true"^^ . _:genid6129 . _:genid6129 . _:genid6129 . _:genid6129 . _:genid6129 "true"^^ . _:genid6130 . _:genid6130 . _:genid6130 . _:genid6130 "A type of phylogenetic distribution evidence that is used in a manual assertion."^^ . _:genid6130 "ECO:RCT"^^ . . _:genid6131 . _:genid6132 . _:genid6134 _:genid6133 . _:genid6132 _:genid6134 . _:genid6133 . _:genid6133 . _:genid6133 . _:genid6134 . _:genid6131 _:genid6132 . _:genid6131 . . . "IEP"^^ . "A type of differential geneset expression evidence from microarray experiment (GSEA, Fisher-exact) that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007154"^^ . "differential geneset expression evidence from microarray experiment (GSEA, Fisher-exact) used in manual assertion"^^ . _:genid6135 . _:genid6135 . _:genid6135 . _:genid6135 . _:genid6135 "true"^^ . _:genid6136 . _:genid6136 . _:genid6136 . _:genid6136 . _:genid6136 "true"^^ . _:genid6137 . _:genid6137 . _:genid6137 . _:genid6137 "A type of differential geneset expression evidence from microarray experiment (GSEA, Fisher-exact) that is used in a manual assertion."^^ . _:genid6137 "ECO:RCT"^^ . . _:genid6138 . _:genid6139 . _:genid6141 _:genid6140 . _:genid6139 _:genid6141 . _:genid6140 . _:genid6140 . _:genid6140 . _:genid6141 . _:genid6138 _:genid6139 . _:genid6138 . . . "IEP"^^ . "A type of differential geneset expression evidence from RNA-seq experiment (GSEA, Fisher-exact) that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007155"^^ . "differential geneset expression evidence from RNA-seq experiment (GSEA, Fisher-exact) used in manual assertion"^^ . _:genid6142 . _:genid6142 . _:genid6142 . _:genid6142 . _:genid6142 "true"^^ . _:genid6143 . _:genid6143 . _:genid6143 . _:genid6143 . _:genid6143 "true"^^ . _:genid6144 . _:genid6144 . _:genid6144 . _:genid6144 "A type of differential geneset expression evidence from RNA-seq experiment (GSEA, Fisher-exact) that is used in a manual assertion."^^ . _:genid6144 "ECO:RCT"^^ . . _:genid6145 . _:genid6146 . _:genid6148 _:genid6147 . _:genid6146 _:genid6148 . _:genid6147 . _:genid6147 . _:genid6147 . _:genid6148 . _:genid6145 _:genid6146 . _:genid6145 . . . "EXP"^^ . "A type of biological target-disease association via drug that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007156"^^ . "biological target-disease association via drug evidence used in manual assertion"^^ . _:genid6149 . _:genid6149 . _:genid6149 . _:genid6149 . _:genid6149 "true"^^ . _:genid6150 . _:genid6150 . _:genid6150 . _:genid6150 . _:genid6150 "true"^^ . _:genid6151 . _:genid6151 . _:genid6151 . _:genid6151 "A type of biological target-disease association via drug that is used in a manual assertion."^^ . _:genid6151 "ECO:RCT"^^ . . _:genid6152 . _:genid6153 . _:genid6155 _:genid6154 . _:genid6153 _:genid6155 . _:genid6154 . _:genid6154 . _:genid6154 . _:genid6155 . _:genid6152 _:genid6153 . _:genid6152 . . . "IDA"^^ . "A type of cell staining evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007157"^^ . "cell staining evidence used in manual assertion"^^ . _:genid6156 . _:genid6156 . _:genid6156 . _:genid6156 . _:genid6156 "true"^^ . _:genid6157 . _:genid6157 . _:genid6157 . _:genid6157 . _:genid6157 "true"^^ . _:genid6158 . _:genid6158 . _:genid6158 . _:genid6158 "A type of cell staining evidence that is used in a manual assertion."^^ . _:genid6158 "ECO:RCT"^^ . . "A type of visual sequence inspection evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007158"^^ . "visual sequence inspection evidence used in manual assertion"^^ . "true"^^ . _:genid6159 . _:genid6159 . _:genid6159 . _:genid6159 "A type of visual sequence inspection evidence that is used in a manual assertion."^^ . _:genid6159 "ECO:RCT"^^ . . _:genid6160 . _:genid6161 . _:genid6163 _:genid6162 . _:genid6161 _:genid6163 . _:genid6162 . _:genid6162 . _:genid6162 . _:genid6163 . _:genid6160 _:genid6161 . _:genid6160 . . . "IDA"^^ . "A type of ATP bioluminescence assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007159"^^ . "ATP bioluminescence assay evidence used in manual assertion"^^ . _:genid6164 . _:genid6164 . _:genid6164 . _:genid6164 . _:genid6164 "true"^^ . _:genid6165 . _:genid6165 . _:genid6165 . _:genid6165 . _:genid6165 "true"^^ . _:genid6166 . _:genid6166 . _:genid6166 . _:genid6166 "A type of ATP bioluminescence assay evidence that is used in a manual assertion."^^ . _:genid6166 "ECO:RCT"^^ . . _:genid6167 . _:genid6168 . _:genid6170 _:genid6169 . _:genid6168 _:genid6170 . _:genid6169 . _:genid6169 . _:genid6169 . _:genid6170 . _:genid6167 _:genid6168 . _:genid6167 . . . "IMP"^^ . "A type of missense mutation phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "missense mutation evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007160"^^ . "missense mutation pohenotypic evidence used in manual assertion"^^ . _:genid6171 . _:genid6171 . _:genid6171 . _:genid6171 . _:genid6171 "true"^^ . _:genid6172 . _:genid6172 . _:genid6172 . _:genid6172 . _:genid6172 "true"^^ . _:genid6173 . _:genid6173 . _:genid6173 . _:genid6173 "A type of missense mutation phenotypic evidence that is used in a manual assertion."^^ . _:genid6173 "ECO:RCT"^^ . . _:genid6174 . _:genid6175 . _:genid6177 _:genid6176 . _:genid6175 _:genid6177 . _:genid6176 . _:genid6176 . _:genid6176 . _:genid6177 . _:genid6174 _:genid6175 . _:genid6174 . . . "IMP"^^ . "A type of nonsense mutation phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "nonsense mutation evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007161"^^ . "nonsense mutation phenotypic evidence used in manual assertion"^^ . _:genid6178 . _:genid6178 . _:genid6178 . _:genid6178 . _:genid6178 "true"^^ . _:genid6179 . _:genid6179 . _:genid6179 . _:genid6179 . _:genid6179 "true"^^ . _:genid6180 . _:genid6180 . _:genid6180 . _:genid6180 "A type of nonsense mutation phenotypic evidence that is used in a manual assertion."^^ . _:genid6180 "ECO:RCT"^^ . . _:genid6181 . _:genid6182 . _:genid6184 _:genid6183 . _:genid6182 _:genid6184 . _:genid6183 . _:genid6183 . _:genid6183 . _:genid6184 . _:genid6181 _:genid6182 . _:genid6181 . . . "IMP"^^ . "A type of silent mutation evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007162"^^ . "silent mutation evidence used in manual assertion"^^ . _:genid6185 . _:genid6185 . _:genid6185 . _:genid6185 . _:genid6185 "true"^^ . _:genid6186 . _:genid6186 . _:genid6186 . _:genid6186 . _:genid6186 "true"^^ . _:genid6187 . _:genid6187 . _:genid6187 . _:genid6187 "A type of silent mutation evidence that is used in a manual assertion."^^ . _:genid6187 "ECO:RCT"^^ . . _:genid6188 . _:genid6189 . _:genid6191 _:genid6190 . _:genid6189 _:genid6191 . _:genid6190 . _:genid6190 . _:genid6190 . _:genid6191 . _:genid6188 _:genid6189 . _:genid6188 . . . "IMP"^^ . "A type of insertion mutation phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "insertion mutation evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007163"^^ . "insertion mutation phenotypic evidence used in manual assertion"^^ . _:genid6192 . _:genid6192 . _:genid6192 . _:genid6192 . _:genid6192 "true"^^ . _:genid6193 . _:genid6193 . _:genid6193 . _:genid6193 . _:genid6193 "true"^^ . _:genid6194 . _:genid6194 . _:genid6194 . _:genid6194 "A type of insertion mutation phenotypic evidence that is used in a manual assertion."^^ . _:genid6194 "ECO:RCT"^^ . . _:genid6195 . _:genid6196 . _:genid6198 _:genid6197 . _:genid6196 _:genid6198 . _:genid6197 . _:genid6197 . _:genid6197 . _:genid6198 . _:genid6195 _:genid6196 . _:genid6195 . . . "EXP"^^ . "A type of duplication mutation evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007164"^^ . "duplication mutation evidence used in manual assertion"^^ . _:genid6199 . _:genid6199 . _:genid6199 . _:genid6199 . _:genid6199 "true"^^ . _:genid6200 . _:genid6200 . _:genid6200 . _:genid6200 . _:genid6200 "true"^^ . _:genid6201 . _:genid6201 . _:genid6201 . _:genid6201 "A type of duplication mutation evidence that is used in a manual assertion."^^ . _:genid6201 "ECO:RCT"^^ . . _:genid6202 . _:genid6203 . _:genid6205 _:genid6204 . _:genid6203 _:genid6205 . _:genid6204 . _:genid6204 . _:genid6204 . _:genid6205 . _:genid6202 _:genid6203 . _:genid6202 . . . "IMP"^^ . "A type of frameshift mutation phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "frameshift mutation evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007165"^^ . "frameshift mutation phenotypic evidence used in manual assertion"^^ . _:genid6206 . _:genid6206 . _:genid6206 . _:genid6206 . _:genid6206 "true"^^ . _:genid6207 . _:genid6207 . _:genid6207 . _:genid6207 . _:genid6207 "true"^^ . _:genid6208 . _:genid6208 . _:genid6208 . _:genid6208 "A type of frameshift mutation phenotypic evidence that is used in a manual assertion."^^ . _:genid6208 "ECO:RCT"^^ . . _:genid6209 . _:genid6210 . _:genid6212 _:genid6211 . _:genid6210 _:genid6212 . _:genid6211 . _:genid6211 . _:genid6211 . _:genid6212 . _:genid6209 _:genid6210 . _:genid6209 . . . "IMP"^^ . "A type of repeat expansion mutation phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "repeat expansion mutation evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007166"^^ . "repeat expansion mutation phenotypic evidence used in manual assertion"^^ . _:genid6213 . _:genid6213 . _:genid6213 . _:genid6213 . _:genid6213 "true"^^ . _:genid6214 . _:genid6214 . _:genid6214 . _:genid6214 . _:genid6214 "true"^^ . _:genid6215 . _:genid6215 . _:genid6215 . _:genid6215 "A type of repeat expansion mutation phenotypic evidence that is used in a manual assertion."^^ . _:genid6215 "ECO:RCT"^^ . . _:genid6216 . _:genid6217 . _:genid6219 _:genid6218 . _:genid6217 _:genid6219 . _:genid6218 . _:genid6218 . _:genid6218 . _:genid6219 . _:genid6216 _:genid6217 . _:genid6216 . . . "IMP"^^ . "A type of splice site mutation phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "splice site mutation evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007167"^^ . "splice site mutation phenotypic evidence used in manual assertion"^^ . _:genid6220 . _:genid6220 . _:genid6220 . _:genid6220 . _:genid6220 "true"^^ . _:genid6221 . _:genid6221 . _:genid6221 . _:genid6221 . _:genid6221 "true"^^ . _:genid6222 . _:genid6222 . _:genid6222 . _:genid6222 "A type of splice site mutation phenotypic evidence that is used in a manual assertion."^^ . _:genid6222 "ECO:RCT"^^ . . _:genid6223 . _:genid6224 . _:genid6226 _:genid6225 . _:genid6224 _:genid6226 . _:genid6225 . _:genid6225 . _:genid6225 . _:genid6226 . _:genid6223 _:genid6224 . _:genid6223 . . . "IMP"^^ . "A type of translocation mutation phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "translocation mutation evidence used in manual assertion"^^ . "eco"^^ . "ECO:0007168"^^ . "translocation mutation phenotypic evidence used in manual assertion"^^ . _:genid6227 . _:genid6227 . _:genid6227 . _:genid6227 . _:genid6227 "true"^^ . _:genid6228 . _:genid6228 . _:genid6228 . _:genid6228 . _:genid6228 "true"^^ . _:genid6229 . _:genid6229 . _:genid6229 . _:genid6229 "A type of translocation mutation phenotypic evidence that is used in a manual assertion."^^ . _:genid6229 "ECO:RCT"^^ . . _:genid6230 . _:genid6231 . _:genid6233 _:genid6232 . _:genid6231 _:genid6233 . _:genid6232 . _:genid6232 . _:genid6232 . _:genid6233 . _:genid6230 _:genid6231 . _:genid6230 . . . "IDA"^^ . "A type of in-gel protein kinase assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007169"^^ . "in-gel protein kinase assay evidence used in manual assertion"^^ . _:genid6234 . _:genid6234 . _:genid6234 . _:genid6234 . _:genid6234 "true"^^ . _:genid6235 . _:genid6235 . _:genid6235 . _:genid6235 . _:genid6235 "true"^^ . _:genid6236 . _:genid6236 . _:genid6236 . _:genid6236 "A type of in-gel protein kinase assay evidence that is used in a manual assertion."^^ . _:genid6236 "ECO:RCT"^^ . . _:genid6237 . _:genid6238 . _:genid6240 _:genid6239 . _:genid6238 _:genid6240 . _:genid6239 . _:genid6239 . _:genid6239 . _:genid6240 . _:genid6237 _:genid6238 . _:genid6237 . . . "IDA"^^ . "A type of macroscopic current trace evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007170"^^ . "macroscopic current trace evidence used in manual assertion"^^ . _:genid6241 . _:genid6241 . _:genid6241 . _:genid6241 . _:genid6241 "true"^^ . _:genid6242 . _:genid6242 . _:genid6242 . _:genid6242 . _:genid6242 "true"^^ . _:genid6243 . _:genid6243 . _:genid6243 . _:genid6243 "A type of macroscopic current trace evidence that is used in a manual assertion."^^ . _:genid6243 "ECO:RCT"^^ . . _:genid6244 . _:genid6245 . _:genid6247 _:genid6246 . _:genid6245 _:genid6247 . _:genid6246 . _:genid6246 . _:genid6246 . _:genid6247 . _:genid6244 _:genid6245 . _:genid6244 . . . "IDA"^^ . "A type of current density evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007171"^^ . "current density evidence used in manual assertion"^^ . _:genid6248 . _:genid6248 . _:genid6248 . _:genid6248 . _:genid6248 "true"^^ . _:genid6249 . _:genid6249 . _:genid6249 . _:genid6249 . _:genid6249 "true"^^ . _:genid6250 . _:genid6250 . _:genid6250 . _:genid6250 "A type of current density evidence that is used in a manual assertion."^^ . _:genid6250 "ECO:RCT"^^ . . _:genid6251 . _:genid6252 . _:genid6254 _:genid6253 . _:genid6252 _:genid6254 . _:genid6253 . _:genid6253 . _:genid6253 . _:genid6254 . _:genid6251 _:genid6252 . _:genid6251 . . . "IDA"^^ . "A type of sustained current evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007172"^^ . "sustained current evidence used in manual assertion"^^ . _:genid6255 . _:genid6255 . _:genid6255 . _:genid6255 . _:genid6255 "true"^^ . _:genid6256 . _:genid6256 . _:genid6256 . _:genid6256 . _:genid6256 "true"^^ . _:genid6257 . _:genid6257 . _:genid6257 . _:genid6257 "A type of sustained current evidence that is used in a manual assertion."^^ . _:genid6257 "ECO:RCT"^^ . . _:genid6258 . _:genid6259 . _:genid6261 _:genid6260 . _:genid6259 _:genid6261 . _:genid6260 . _:genid6260 . _:genid6260 . _:genid6261 . _:genid6258 _:genid6259 . _:genid6258 . . . "IDA"^^ . "A type of use dependence of inactivation evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007173"^^ . "use dependence of inactivation evidence used in manual assertion"^^ . _:genid6262 . _:genid6262 . _:genid6262 . _:genid6262 . _:genid6262 "true"^^ . _:genid6263 . _:genid6263 . _:genid6263 . _:genid6263 . _:genid6263 "true"^^ . _:genid6264 . _:genid6264 . _:genid6264 . _:genid6264 "A type of use dependence of inactivation evidence that is used in a manual assertion."^^ . _:genid6264 "ECO:RCT"^^ . . _:genid6265 . _:genid6266 . _:genid6268 _:genid6267 . _:genid6266 _:genid6268 . _:genid6267 . _:genid6267 . _:genid6267 . _:genid6268 . _:genid6265 _:genid6266 . _:genid6265 . . . "IDA"^^ . "A type of current clamp recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007174"^^ . "current clamp recording evidence used in manual assertion"^^ . _:genid6269 . _:genid6269 . _:genid6269 . _:genid6269 . _:genid6269 "true"^^ . _:genid6270 . _:genid6270 . _:genid6270 . _:genid6270 . _:genid6270 "true"^^ . _:genid6271 . _:genid6271 . _:genid6271 . _:genid6271 "A type of current clamp recording evidence that is used in a manual assertion."^^ . _:genid6271 "ECO:RCT"^^ . . _:genid6272 . _:genid6273 . _:genid6275 _:genid6274 . _:genid6273 _:genid6275 . _:genid6274 . _:genid6274 . _:genid6274 . _:genid6275 . _:genid6272 _:genid6273 . _:genid6272 . . . "IDA"^^ . "A type of whole-cell voltage clamp recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007175"^^ . "whole-cell voltage clamp recording evidence used in manual assertion"^^ . _:genid6276 . _:genid6276 . _:genid6276 . _:genid6276 . _:genid6276 "true"^^ . _:genid6277 . _:genid6277 . _:genid6277 . _:genid6277 . _:genid6277 "true"^^ . _:genid6278 . _:genid6278 . _:genid6278 . _:genid6278 "A type of whole-cell voltage clamp recording evidence that is used in a manual assertion."^^ . _:genid6278 "ECO:RCT"^^ . . _:genid6279 . _:genid6280 . _:genid6282 _:genid6281 . _:genid6280 _:genid6282 . _:genid6281 . _:genid6281 . _:genid6281 . _:genid6282 . _:genid6279 _:genid6280 . _:genid6279 . . . "IDA"^^ . "A type of cell-attached single-channel recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007176"^^ . "cell-attached single-channel recording evidence used in manual assertion"^^ . _:genid6283 . _:genid6283 . _:genid6283 . _:genid6283 . _:genid6283 "true"^^ . _:genid6284 . _:genid6284 . _:genid6284 . _:genid6284 . _:genid6284 "true"^^ . _:genid6285 . _:genid6285 . _:genid6285 . _:genid6285 "A type of cell-attached single-channel recording evidence that is used in a manual assertion."^^ . _:genid6285 "ECO:RCT"^^ . . _:genid6286 . _:genid6287 . _:genid6289 _:genid6288 . _:genid6287 _:genid6289 . _:genid6288 . _:genid6288 . _:genid6288 . _:genid6289 . _:genid6286 _:genid6287 . _:genid6286 . . . "IDA"^^ . "A type of cell-detached inside-out single-channel recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007177"^^ . "cell-detached inside-out single-channel recording evidence used in manual assertion"^^ . _:genid6290 . _:genid6290 . _:genid6290 . _:genid6290 . _:genid6290 "true"^^ . _:genid6291 . _:genid6291 . _:genid6291 . _:genid6291 . _:genid6291 "true"^^ . _:genid6292 . _:genid6292 . _:genid6292 . _:genid6292 "A type of cell-detached inside-out single-channel recording evidence that is used in a manual assertion."^^ . _:genid6292 "ECO:RCT"^^ . . _:genid6293 . _:genid6294 . _:genid6296 _:genid6295 . _:genid6294 _:genid6296 . _:genid6295 . _:genid6295 . _:genid6295 . _:genid6296 . _:genid6293 _:genid6294 . _:genid6293 . . . "IDA"^^ . "A type of reconstituted bilayer single-channel patch recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007178"^^ . "reconstituted bilayer single-channel patch recording evidence used in manual assertion"^^ . _:genid6297 . _:genid6297 . _:genid6297 . _:genid6297 . _:genid6297 "true"^^ . _:genid6298 . _:genid6298 . _:genid6298 . _:genid6298 . _:genid6298 "true"^^ . _:genid6299 . _:genid6299 . _:genid6299 . _:genid6299 "A type of reconstituted bilayer single-channel patch recording evidence that is used in a manual assertion."^^ . _:genid6299 "ECO:RCT"^^ . . _:genid6300 . _:genid6301 . _:genid6303 _:genid6302 . _:genid6301 _:genid6303 . _:genid6302 . _:genid6302 . _:genid6302 . _:genid6303 . _:genid6300 _:genid6301 . _:genid6300 . . . "IDA"^^ . "A type of electroencephalography recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007179"^^ . "electroencephalography recording evidence used in manual assertion"^^ . _:genid6304 . _:genid6304 . _:genid6304 . _:genid6304 . _:genid6304 "true"^^ . _:genid6305 . _:genid6305 . _:genid6305 . _:genid6305 . _:genid6305 "true"^^ . _:genid6306 . _:genid6306 . _:genid6306 . _:genid6306 "A type of electroencephalography recording evidence that is used in a manual assertion."^^ . _:genid6306 "ECO:RCT"^^ . . _:genid6307 . _:genid6308 . _:genid6310 _:genid6309 . _:genid6308 _:genid6310 . _:genid6309 . _:genid6309 . _:genid6309 . _:genid6310 . _:genid6307 _:genid6308 . _:genid6307 . . . "IDA"^^ . "A type of cell-detached outside-out single-channel recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007180"^^ . "cell-detached outside-out single-channel recording evidence used in manual assertion"^^ . _:genid6311 . _:genid6311 . _:genid6311 . _:genid6311 . _:genid6311 "true"^^ . _:genid6312 . _:genid6312 . _:genid6312 . _:genid6312 . _:genid6312 "true"^^ . _:genid6313 . _:genid6313 . _:genid6313 . _:genid6313 "A type of cell-detached outside-out single-channel recording evidence that is used in a manual assertion."^^ . _:genid6313 "ECO:RCT"^^ . . _:genid6314 . _:genid6315 . _:genid6317 _:genid6316 . _:genid6315 _:genid6317 . _:genid6316 . _:genid6316 . _:genid6316 . _:genid6317 . _:genid6314 _:genid6315 . _:genid6314 . . . "IDA"^^ . "A type of cut-open oocyte voltage clamp recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007181"^^ . "cut-open oocyte voltage clamp recording evidence used in manual assertion"^^ . _:genid6318 . _:genid6318 . _:genid6318 . _:genid6318 . _:genid6318 "true"^^ . _:genid6319 . _:genid6319 . _:genid6319 . _:genid6319 . _:genid6319 "true"^^ . _:genid6320 . _:genid6320 . _:genid6320 . _:genid6320 "A type of cut-open oocyte voltage clamp recording evidence that is used in a manual assertion."^^ . _:genid6320 "ECO:RCT"^^ . . _:genid6321 . _:genid6322 . _:genid6324 _:genid6323 . _:genid6322 _:genid6324 . _:genid6323 . _:genid6323 . _:genid6323 . _:genid6324 . _:genid6321 _:genid6322 . _:genid6321 . . . "IDA"^^ . "A type of macropatch voltage clamp recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007182"^^ . "macropatch voltage clamp recording evidence used in manual assertion"^^ . _:genid6325 . _:genid6325 . _:genid6325 . _:genid6325 . _:genid6325 "true"^^ . _:genid6326 . _:genid6326 . _:genid6326 . _:genid6326 . _:genid6326 "true"^^ . _:genid6327 . _:genid6327 . _:genid6327 . _:genid6327 "A type of macropatch voltage clamp recording evidence that is used in a manual assertion."^^ . _:genid6327 "ECO:RCT"^^ . . _:genid6328 . _:genid6329 . _:genid6331 _:genid6330 . _:genid6329 _:genid6331 . _:genid6330 . _:genid6330 . _:genid6330 . _:genid6331 . _:genid6328 _:genid6329 . _:genid6328 . . . "EXP"^^ . "A type of protein mass spectrometry evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007184"^^ . "protein mass spectrometry evidence used in manual assertion"^^ . _:genid6332 . _:genid6332 . _:genid6332 . _:genid6332 . _:genid6332 "true"^^ . _:genid6333 . _:genid6333 . _:genid6333 . _:genid6333 . _:genid6333 "true"^^ . _:genid6334 . _:genid6334 . _:genid6334 . _:genid6334 "A type of protein mass spectrometry evidence that is used in a manual assertion."^^ . _:genid6334 "ECO:RCT"^^ . . _:genid6335 . _:genid6336 . _:genid6338 _:genid6337 . _:genid6336 _:genid6338 . _:genid6337 . _:genid6337 . _:genid6337 . _:genid6338 . _:genid6335 _:genid6336 . _:genid6335 . . . "IDA"^^ . "A type of cross-streak test evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007185"^^ . "cross-streak test evidence used in manual assertion"^^ . _:genid6339 . _:genid6339 . _:genid6339 . _:genid6339 . _:genid6339 "true"^^ . _:genid6340 . _:genid6340 . _:genid6340 . _:genid6340 . _:genid6340 "true"^^ . _:genid6341 . _:genid6341 . _:genid6341 . _:genid6341 "A type of cross-streak test evidence that is used in a manual assertion."^^ . _:genid6341 "ECO:RCT"^^ . . _:genid6342 . _:genid6343 . _:genid6345 _:genid6344 . _:genid6343 _:genid6345 . _:genid6344 . _:genid6344 . _:genid6344 . _:genid6345 . _:genid6342 _:genid6343 . _:genid6342 . . . "IDA"^^ . "A type of tethered cell assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007186"^^ . "tethered cell assay evidence used in manual assertion"^^ . _:genid6346 . _:genid6346 . _:genid6346 . _:genid6346 . _:genid6346 "true"^^ . _:genid6347 . _:genid6347 . _:genid6347 . _:genid6347 . _:genid6347 "true"^^ . _:genid6348 . _:genid6348 . _:genid6348 . _:genid6348 "A type of tethered cell assay evidence that is used in a manual assertion."^^ . _:genid6348 "ECO:RCT"^^ . . _:genid6349 . _:genid6350 . _:genid6352 _:genid6351 . _:genid6350 _:genid6352 . _:genid6351 . _:genid6351 . _:genid6351 . _:genid6352 . _:genid6349 _:genid6350 . _:genid6349 . . . "IDA"^^ . "A type of tumble frequency assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007187"^^ . "tumble frequency assay evidence used in manual assertion"^^ . _:genid6353 . _:genid6353 . _:genid6353 . _:genid6353 . _:genid6353 "true"^^ . _:genid6354 . _:genid6354 . _:genid6354 . _:genid6354 . _:genid6354 "true"^^ . _:genid6355 . _:genid6355 . _:genid6355 . _:genid6355 "A type of tumble frequency assay evidence that is used in a manual assertion."^^ . _:genid6355 "ECO:RCT"^^ . . _:genid6356 . _:genid6357 . _:genid6359 _:genid6358 . _:genid6357 _:genid6359 . _:genid6358 . _:genid6358 . _:genid6358 . _:genid6359 . _:genid6356 _:genid6357 . _:genid6356 . . . "IDA"^^ . "A type of capillary assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007188"^^ . "capillary assay evidence used in manual assertion"^^ . _:genid6360 . _:genid6360 . _:genid6360 . _:genid6360 . _:genid6360 "true"^^ . _:genid6361 . _:genid6361 . _:genid6361 . _:genid6361 . _:genid6361 "true"^^ . _:genid6362 . _:genid6362 . _:genid6362 . _:genid6362 "A type of capillary assay evidence that is used in a manual assertion."^^ . _:genid6362 "ECO:RCT"^^ . . "A type of inference from experimental data evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007189"^^ . "inference from experimental data evidence used in manual assertion"^^ . "true"^^ . _:genid6363 . _:genid6363 . _:genid6363 . _:genid6363 "A type of inference from experimental data evidence that is used in a manual assertion."^^ . _:genid6363 "ECO:RCT"^^ . . "A type of inference from phenotype manipulation evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007190"^^ . "inference from phenotype manipulation evidence used in manual assertion"^^ . "true"^^ . _:genid6364 . _:genid6364 . _:genid6364 . _:genid6364 "A type of inference from phenotype manipulation evidence that is used in a manual assertion."^^ . _:genid6364 "ECO:RCT"^^ . . _:genid6365 . _:genid6366 . _:genid6368 _:genid6367 . _:genid6366 _:genid6368 . _:genid6367 . _:genid6367 . _:genid6367 . _:genid6368 . _:genid6365 _:genid6366 . _:genid6365 . . "EXP"^^ . "A type of inference by association of genotype from phenotype that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007191"^^ . "inference by association of genotype from phenotype used in manual assertion"^^ . _:genid6369 . _:genid6369 . _:genid6369 . _:genid6369 . _:genid6369 "true"^^ . _:genid6370 . _:genid6370 . _:genid6370 . _:genid6370 "A type of inference by association of genotype from phenotype that is used in a manual assertion."^^ . _:genid6370 "ECO:RCT"^^ . . _:genid6371 . _:genid6372 . _:genid6374 _:genid6373 . _:genid6372 _:genid6374 . _:genid6373 . _:genid6373 . _:genid6373 . _:genid6374 . _:genid6371 _:genid6372 . _:genid6371 . . . "IDA"^^ . "A type of motility assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007192"^^ . "motility assay evidence used in manual assertion"^^ . _:genid6375 . _:genid6375 . _:genid6375 . _:genid6375 . _:genid6375 "true"^^ . _:genid6376 . _:genid6376 . _:genid6376 . _:genid6376 . _:genid6376 "true"^^ . _:genid6377 . _:genid6377 . _:genid6377 . _:genid6377 "A type of motility assay evidence that is used in a manual assertion."^^ . _:genid6377 "ECO:RCT"^^ . . _:genid6378 . _:genid6379 . _:genid6381 _:genid6380 . _:genid6379 _:genid6381 . _:genid6380 . _:genid6380 . _:genid6380 . _:genid6381 . _:genid6378 _:genid6379 . _:genid6378 . . . "IEA"^^ . "A type of loss-of-function mutant phenotype evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007193"^^ . "loss-of-function mutant phenotype evidence used in automatic assertion"^^ . _:genid6382 . _:genid6382 . _:genid6382 . _:genid6382 . _:genid6382 "true"^^ . _:genid6383 . _:genid6383 . _:genid6383 . _:genid6383 . _:genid6383 "true"^^ . _:genid6384 . _:genid6384 . _:genid6384 . _:genid6384 "A type of loss-of-function mutant phenotype evidence that is used in an automatic assertion."^^ . _:genid6384 "ECO:RCT"^^ . . _:genid6385 . _:genid6386 . _:genid6388 _:genid6387 . _:genid6386 _:genid6388 . _:genid6387 . _:genid6387 . _:genid6387 . _:genid6388 . _:genid6385 _:genid6386 . _:genid6385 . . . "IEA"^^ . "A type of structural similarity evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007194"^^ . "structural similarity evidence used in automatic assertion"^^ . _:genid6389 . _:genid6389 . _:genid6389 . _:genid6389 . _:genid6389 "true"^^ . _:genid6390 . _:genid6390 . _:genid6390 . _:genid6390 . _:genid6390 "true"^^ . _:genid6391 . _:genid6391 . _:genid6391 . _:genid6391 "A type of structural similarity evidence that is used in an automatic assertion."^^ . _:genid6391 "ECO:RCT"^^ . . _:genid6392 . _:genid6393 . _:genid6395 _:genid6394 . _:genid6393 _:genid6395 . _:genid6394 . _:genid6394 . _:genid6394 . _:genid6395 . _:genid6392 _:genid6393 . _:genid6392 . . . "IEA"^^ . "A type of gain-of-function mutant phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "gain-of-function mutant phenotype evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007196"^^ . "gain-of-function mutant phenotypic evidence used in automatic assertion"^^ . _:genid6396 . _:genid6396 . _:genid6396 . _:genid6396 . _:genid6396 "true"^^ . _:genid6397 . _:genid6397 . _:genid6397 . _:genid6397 . _:genid6397 "true"^^ . _:genid6398 . _:genid6398 . _:genid6398 . _:genid6398 "A type of gain-of-function mutant phenotypic evidence that is used in an automatic assertion."^^ . _:genid6398 "ECO:RCT"^^ . . _:genid6399 . _:genid6400 . _:genid6402 _:genid6401 . _:genid6400 _:genid6402 . _:genid6401 . _:genid6401 . _:genid6401 . _:genid6402 . _:genid6399 _:genid6400 . _:genid6399 . . . "IEA"^^ . "A type of voucher specimen phenotypic analysis evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "voucher specimen analysis evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007197"^^ . "voucher specimen phenotypic analysis evidence used in automatic assertion"^^ . _:genid6403 . _:genid6403 . _:genid6403 . _:genid6403 . _:genid6403 "true"^^ . _:genid6404 . _:genid6404 . _:genid6404 . _:genid6404 . _:genid6404 "true"^^ . _:genid6405 . _:genid6405 . _:genid6405 . _:genid6405 "A type of voucher specimen phenotypic analysis evidence that is used in an automatic assertion."^^ . _:genid6405 "ECO:RCT"^^ . . _:genid6406 . _:genid6407 . _:genid6409 _:genid6408 . _:genid6407 _:genid6409 . _:genid6408 . _:genid6408 . _:genid6408 . _:genid6409 . _:genid6406 _:genid6407 . _:genid6406 . . . "IEA"^^ . "A type of positional similarity evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007198"^^ . "positional similarity evidence used in automatic assertion"^^ . _:genid6410 . _:genid6410 . _:genid6410 . _:genid6410 . _:genid6410 "true"^^ . _:genid6411 . _:genid6411 . _:genid6411 . _:genid6411 . _:genid6411 "true"^^ . _:genid6412 . _:genid6412 . _:genid6412 . _:genid6412 "A type of positional similarity evidence that is used in an automatic assertion."^^ . _:genid6412 "ECO:RCT"^^ . . _:genid6413 . _:genid6414 . _:genid6416 _:genid6415 . _:genid6414 _:genid6416 . _:genid6415 . _:genid6415 . _:genid6415 . _:genid6416 . _:genid6413 _:genid6414 . _:genid6413 . . . "IEA"^^ . "A type of quantitative trait analysis evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007199"^^ . "quantitative trait analysis evidence used in automatic assertion"^^ . _:genid6417 . _:genid6417 . _:genid6417 . _:genid6417 . _:genid6417 "true"^^ . _:genid6418 . _:genid6418 . _:genid6418 . _:genid6418 . _:genid6418 "true"^^ . _:genid6419 . _:genid6419 . _:genid6419 . _:genid6419 "A type of quantitative trait analysis evidence that is used in an automatic assertion."^^ . _:genid6419 "ECO:RCT"^^ . . _:genid6420 . _:genid6421 . _:genid6423 _:genid6422 . _:genid6421 _:genid6423 . _:genid6422 . _:genid6422 . _:genid6422 . _:genid6423 . _:genid6420 _:genid6421 . _:genid6420 . . . "IEA"^^ . "A type of compositional similarity evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007200"^^ . "compositional similarity evidence used in automatic assertion"^^ . _:genid6424 . _:genid6424 . _:genid6424 . _:genid6424 . _:genid6424 "true"^^ . _:genid6425 . _:genid6425 . _:genid6425 . _:genid6425 . _:genid6425 "true"^^ . _:genid6426 . _:genid6426 . _:genid6426 . _:genid6426 "A type of compositional similarity evidence that is used in an automatic assertion."^^ . _:genid6426 "ECO:RCT"^^ . . _:genid6427 . _:genid6428 . _:genid6430 _:genid6429 . _:genid6428 _:genid6430 . _:genid6429 . _:genid6429 . _:genid6429 . _:genid6430 . _:genid6427 _:genid6428 . _:genid6427 . . . "IEA"^^ . "A type of developmental similarity evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007201"^^ . "developmental similarity evidence used in automatic assertion"^^ . _:genid6431 . _:genid6431 . _:genid6431 . _:genid6431 . _:genid6431 "true"^^ . _:genid6432 . _:genid6432 . _:genid6432 . _:genid6432 . _:genid6432 "true"^^ . _:genid6433 . _:genid6433 . _:genid6433 . _:genid6433 "A type of developmental similarity evidence that is used in an automatic assertion."^^ . _:genid6433 "ECO:RCT"^^ . . _:genid6434 . _:genid6435 . _:genid6437 _:genid6436 . _:genid6435 _:genid6437 . _:genid6436 . _:genid6436 . _:genid6436 . _:genid6437 . _:genid6434 _:genid6435 . _:genid6434 . . . "IEA"^^ . "A type of morphological similarity evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007202"^^ . "morphological similarity evidence used in automatic assertion"^^ . _:genid6438 . _:genid6438 . _:genid6438 . _:genid6438 . _:genid6438 "true"^^ . _:genid6439 . _:genid6439 . _:genid6439 . _:genid6439 . _:genid6439 "true"^^ . _:genid6440 . _:genid6440 . _:genid6440 . _:genid6440 "A type of morphological similarity evidence that is used in an automatic assertion."^^ . _:genid6440 "ECO:RCT"^^ . . _:genid6441 . _:genid6442 . _:genid6444 _:genid6443 . _:genid6442 _:genid6444 . _:genid6443 . _:genid6443 . _:genid6443 . _:genid6444 . _:genid6441 _:genid6442 . _:genid6441 . . . "IEA"^^ . "A type of gene expression similarity evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007203"^^ . "gene expression similarity evidence used in automatic assertion"^^ . _:genid6445 . _:genid6445 . _:genid6445 . _:genid6445 . _:genid6445 "true"^^ . _:genid6446 . _:genid6446 . _:genid6446 . _:genid6446 . _:genid6446 "true"^^ . _:genid6447 . _:genid6447 . _:genid6447 . _:genid6447 "A type of gene expression similarity evidence that is used in an automatic assertion."^^ . _:genid6447 "ECO:RCT"^^ . . _:genid6448 . _:genid6449 . _:genid6451 _:genid6450 . _:genid6449 _:genid6451 . _:genid6450 . _:genid6450 . _:genid6450 . _:genid6451 . _:genid6448 _:genid6449 . _:genid6448 . . . "IEA"^^ . "A type of methylation-specific polymerase chain reaction evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007204"^^ . "methylation-specific polymerase chain reaction evidence used in automatic assertion"^^ . _:genid6452 . _:genid6452 . _:genid6452 . _:genid6452 . _:genid6452 "true"^^ . _:genid6453 . _:genid6453 . _:genid6453 . _:genid6453 . _:genid6453 "true"^^ . _:genid6454 . _:genid6454 . _:genid6454 . _:genid6454 "A type of methylation-specific polymerase chain reaction evidence that is used in an automatic assertion."^^ . _:genid6454 "ECO:RCT"^^ . . _:genid6455 . _:genid6456 . _:genid6458 _:genid6457 . _:genid6456 _:genid6458 . _:genid6457 . _:genid6457 . _:genid6457 . _:genid6458 . _:genid6455 _:genid6456 . _:genid6455 . . . "IEA"^^ . "A type of southern hybridization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007205"^^ . "southern hybridization evidence used in automatic assertion"^^ . _:genid6459 . _:genid6459 . _:genid6459 . _:genid6459 . _:genid6459 "true"^^ . _:genid6460 . _:genid6460 . _:genid6460 . _:genid6460 . _:genid6460 "true"^^ . _:genid6461 . _:genid6461 . _:genid6461 . _:genid6461 "A type of southern hybridization evidence that is used in an automatic assertion."^^ . _:genid6461 "ECO:RCT"^^ . . _:genid6462 . _:genid6463 . _:genid6465 _:genid6464 . _:genid6463 _:genid6465 . _:genid6464 . _:genid6464 . _:genid6464 . _:genid6465 . _:genid6462 _:genid6463 . _:genid6462 . . . "IEA"^^ . "A type of intermethylated site amplification evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007206"^^ . "intermethylated site amplification evidence used in automatic assertion"^^ . _:genid6466 . _:genid6466 . _:genid6466 . _:genid6466 . _:genid6466 "true"^^ . _:genid6467 . _:genid6467 . _:genid6467 . _:genid6467 . _:genid6467 "true"^^ . _:genid6468 . _:genid6468 . _:genid6468 . _:genid6468 "A type of intermethylated site amplification evidence that is used in an automatic assertion."^^ . _:genid6468 "ECO:RCT"^^ . . _:genid6469 . _:genid6470 . _:genid6472 _:genid6471 . _:genid6470 _:genid6472 . _:genid6471 . _:genid6471 . _:genid6471 . _:genid6472 . _:genid6469 _:genid6470 . _:genid6469 . . . "IEA"^^ . "A type of epitope-tagged protein immunolocalization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007207"^^ . "epitope-tagged protein immunolocalization evidence used in automatic assertion"^^ . _:genid6473 . _:genid6473 . _:genid6473 . _:genid6473 . _:genid6473 "true"^^ . _:genid6474 . _:genid6474 . _:genid6474 . _:genid6474 . _:genid6474 "true"^^ . _:genid6475 . _:genid6475 . _:genid6475 . _:genid6475 "A type of epitope-tagged protein immunolocalization evidence that is used in an automatic assertion."^^ . _:genid6475 "ECO:RCT"^^ . . _:genid6476 . _:genid6477 . _:genid6479 _:genid6478 . _:genid6477 _:genid6479 . _:genid6478 . _:genid6478 . _:genid6478 . _:genid6479 . _:genid6476 _:genid6477 . _:genid6476 . . . "IEA"^^ . "A type of co-fractionation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007208"^^ . "co-fractionation evidence used in automatic assertion"^^ . _:genid6480 . _:genid6480 . _:genid6480 . _:genid6480 . _:genid6480 "true"^^ . _:genid6481 . _:genid6481 . _:genid6481 . _:genid6481 . _:genid6481 "true"^^ . _:genid6482 . _:genid6482 . _:genid6482 . _:genid6482 "A type of co-fractionation evidence that is used in an automatic assertion."^^ . _:genid6482 "ECO:RCT"^^ . . _:genid6483 . _:genid6484 . _:genid6486 _:genid6485 . _:genid6484 _:genid6486 . _:genid6485 . _:genid6485 . _:genid6485 . _:genid6486 . _:genid6483 _:genid6484 . _:genid6483 . . . "IEA"^^ . "A type of green fluorescent protein fusion protein localization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007210"^^ . "green fluorescent protein fusion protein localization evidence used in automatic assertion"^^ . _:genid6487 . _:genid6487 . _:genid6487 . _:genid6487 . _:genid6487 "true"^^ . _:genid6488 . _:genid6488 . _:genid6488 . _:genid6488 . _:genid6488 "true"^^ . _:genid6489 . _:genid6489 . _:genid6489 . _:genid6489 "A type of green fluorescent protein fusion protein localization evidence that is used in an automatic assertion."^^ . _:genid6489 "ECO:RCT"^^ . . _:genid6490 . _:genid6491 . _:genid6493 _:genid6492 . _:genid6491 _:genid6493 . _:genid6492 . _:genid6492 . _:genid6492 . _:genid6493 . _:genid6490 _:genid6491 . _:genid6490 . . . "IEA"^^ . "A type of yellow fluorescent protein fusion protein localization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007211"^^ . "yellow fluorescent protein fusion protein localization evidence used in automatic assertion"^^ . _:genid6494 . _:genid6494 . _:genid6494 . _:genid6494 . _:genid6494 "true"^^ . _:genid6495 . _:genid6495 . _:genid6495 . _:genid6495 . _:genid6495 "true"^^ . _:genid6496 . _:genid6496 . _:genid6496 . _:genid6496 "A type of yellow fluorescent protein fusion protein localization evidence that is used in an automatic assertion."^^ . _:genid6496 "ECO:RCT"^^ . . _:genid6497 . _:genid6498 . _:genid6500 _:genid6499 . _:genid6498 _:genid6500 . _:genid6499 . _:genid6499 . _:genid6499 . _:genid6500 . _:genid6497 _:genid6498 . _:genid6497 . . . "IEA"^^ . "A type of beta-glucuronidase fusion protein localization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007212"^^ . "beta-glucuronidase fusion protein localization evidence used in automatic assertion"^^ . _:genid6501 . _:genid6501 . _:genid6501 . _:genid6501 . _:genid6501 "true"^^ . _:genid6502 . _:genid6502 . _:genid6502 . _:genid6502 . _:genid6502 "true"^^ . _:genid6503 . _:genid6503 . _:genid6503 . _:genid6503 "A type of beta-glucuronidase fusion protein localization evidence that is used in an automatic assertion."^^ . _:genid6503 "ECO:RCT"^^ . . _:genid6504 . _:genid6505 . _:genid6507 _:genid6506 . _:genid6505 _:genid6507 . _:genid6506 . _:genid6506 . _:genid6506 . _:genid6507 . _:genid6504 _:genid6505 . _:genid6504 . . . "IEA"^^ . "A type of beta-galactosidase fusion protein localization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007213"^^ . "beta-galactosidase fusion protein localization evidence used in automatic assertion"^^ . _:genid6508 . _:genid6508 . _:genid6508 . _:genid6508 . _:genid6508 "true"^^ . _:genid6509 . _:genid6509 . _:genid6509 . _:genid6509 . _:genid6509 "true"^^ . _:genid6510 . _:genid6510 . _:genid6510 . _:genid6510 "A type of beta-galactosidase fusion protein localization evidence that is used in an automatic assertion."^^ . _:genid6510 "ECO:RCT"^^ . . _:genid6511 . _:genid6512 . _:genid6514 _:genid6513 . _:genid6512 _:genid6514 . _:genid6513 . _:genid6513 . _:genid6513 . _:genid6514 . _:genid6511 _:genid6512 . _:genid6511 . . . "IEA"^^ . "A type of thin layer chromatography evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007214"^^ . "thin layer chromatography evidence used in automatic assertion"^^ . _:genid6515 . _:genid6515 . _:genid6515 . _:genid6515 . _:genid6515 "true"^^ . _:genid6516 . _:genid6516 . _:genid6516 . _:genid6516 . _:genid6516 "true"^^ . _:genid6517 . _:genid6517 . _:genid6517 . _:genid6517 "A type of thin layer chromatography evidence that is used in an automatic assertion."^^ . _:genid6517 "ECO:RCT"^^ . . _:genid6518 . _:genid6519 . _:genid6521 _:genid6520 . _:genid6519 _:genid6521 . _:genid6520 . _:genid6520 . _:genid6520 . _:genid6521 . _:genid6518 _:genid6519 . _:genid6518 . . . "IEA"^^ . "A type of in vitro recombinant protein transcription reconstitution assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007215"^^ . "in vitro recombinant protein transcription reconstitution assay evidence used in automatic assertion"^^ . _:genid6522 . _:genid6522 . _:genid6522 . _:genid6522 . _:genid6522 "true"^^ . _:genid6523 . _:genid6523 . _:genid6523 . _:genid6523 . _:genid6523 "true"^^ . _:genid6524 . _:genid6524 . _:genid6524 . _:genid6524 "A type of in vitro recombinant protein transcription reconstitution assay evidence that is used in an automatic assertion."^^ . _:genid6524 "ECO:RCT"^^ . . _:genid6525 . _:genid6526 . _:genid6528 _:genid6527 . _:genid6526 _:genid6528 . _:genid6527 . _:genid6527 . _:genid6527 . _:genid6528 . _:genid6525 _:genid6526 . _:genid6525 . . . "IEA"^^ . "A type of protein separation followed by direct sequencing evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007216"^^ . "protein separation followed by direct sequencing evidence used in automatic assertion"^^ . _:genid6529 . _:genid6529 . _:genid6529 . _:genid6529 . _:genid6529 "true"^^ . _:genid6530 . _:genid6530 . _:genid6530 . _:genid6530 . _:genid6530 "true"^^ . _:genid6531 . _:genid6531 . _:genid6531 . _:genid6531 "A type of protein separation followed by direct sequencing evidence that is used in an automatic assertion."^^ . _:genid6531 "ECO:RCT"^^ . . _:genid6532 . _:genid6533 . _:genid6535 _:genid6534 . _:genid6533 _:genid6535 . _:genid6534 . _:genid6534 . _:genid6534 . _:genid6535 . _:genid6532 _:genid6533 . _:genid6532 . . . "IEA"^^ . "A type of protein separation followed by fragment identification evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007217"^^ . "protein separation followed by fragment identification evidence used in automatic assertion"^^ . _:genid6536 . _:genid6536 . _:genid6536 . _:genid6536 . _:genid6536 "true"^^ . _:genid6537 . _:genid6537 . _:genid6537 . _:genid6537 . _:genid6537 "true"^^ . _:genid6538 . _:genid6538 . _:genid6538 . _:genid6538 "A type of protein separation followed by fragment identification evidence that is used in an automatic assertion."^^ . _:genid6538 "ECO:RCT"^^ . . _:genid6539 . _:genid6540 . _:genid6542 _:genid6541 . _:genid6540 _:genid6542 . _:genid6541 . _:genid6541 . _:genid6541 . _:genid6542 . _:genid6539 _:genid6540 . _:genid6539 . . . "IEA"^^ . "A type of heterologous system uptake evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007218"^^ . "heterologous system uptake evidence used in automatic assertion"^^ . _:genid6543 . _:genid6543 . _:genid6543 . _:genid6543 . _:genid6543 "true"^^ . _:genid6544 . _:genid6544 . _:genid6544 . _:genid6544 . _:genid6544 "true"^^ . _:genid6545 . _:genid6545 . _:genid6545 . _:genid6545 "A type of heterologous system uptake evidence that is used in an automatic assertion."^^ . _:genid6545 "ECO:RCT"^^ . . _:genid6546 . _:genid6547 . _:genid6549 _:genid6548 . _:genid6547 _:genid6549 . _:genid6548 . _:genid6548 . _:genid6548 . _:genid6549 . _:genid6546 _:genid6547 . _:genid6546 . . . "IEA"^^ . "A type of two-electrode voltage clamp recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007219"^^ . "two-electrode voltage clamp recording evidence used in automatic assertion"^^ . _:genid6550 . _:genid6550 . _:genid6550 . _:genid6550 . _:genid6550 "true"^^ . _:genid6551 . _:genid6551 . _:genid6551 . _:genid6551 . _:genid6551 "true"^^ . _:genid6552 . _:genid6552 . _:genid6552 . _:genid6552 "A type of two-electrode voltage clamp recording evidence that is used in an automatic assertion."^^ . _:genid6552 "ECO:RCT"^^ . . _:genid6553 . _:genid6554 . _:genid6556 _:genid6555 . _:genid6554 _:genid6556 . _:genid6555 . _:genid6555 . _:genid6555 . _:genid6556 . _:genid6553 _:genid6554 . _:genid6553 . . . "IEA"^^ . "A type of biochemical trait analysis evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007220"^^ . "biochemical trait analysis evidence used in automatic assertion"^^ . _:genid6557 . _:genid6557 . _:genid6557 . _:genid6557 . _:genid6557 "true"^^ . _:genid6558 . _:genid6558 . _:genid6558 . _:genid6558 . _:genid6558 "true"^^ . _:genid6559 . _:genid6559 . _:genid6559 . _:genid6559 "A type of biochemical trait analysis evidence that is used in an automatic assertion."^^ . _:genid6559 "ECO:RCT"^^ . . _:genid6560 . _:genid6561 . _:genid6563 _:genid6562 . _:genid6561 _:genid6563 . _:genid6562 . _:genid6562 . _:genid6562 . _:genid6563 . _:genid6560 _:genid6561 . _:genid6560 . . . "IEA"^^ . "A type of mutant physiological response evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007221"^^ . "mutant physiological response evidence used in automatic assertion"^^ . _:genid6564 . _:genid6564 . _:genid6564 . _:genid6564 . _:genid6564 "true"^^ . _:genid6565 . _:genid6565 . _:genid6565 . _:genid6565 . _:genid6565 "true"^^ . _:genid6566 . _:genid6566 . _:genid6566 . _:genid6566 "A type of mutant physiological response evidence that is used in an automatic assertion."^^ . _:genid6566 "ECO:RCT"^^ . . _:genid6567 . _:genid6568 . _:genid6570 _:genid6569 . _:genid6568 _:genid6570 . _:genid6569 . _:genid6569 . _:genid6569 . _:genid6570 . _:genid6567 _:genid6568 . _:genid6567 . . . "IEA"^^ . "A type of mutant visible phenotype evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007222"^^ . "mutant visible phenotype evidence used in automatic assertion"^^ . _:genid6571 . _:genid6571 . _:genid6571 . _:genid6571 . _:genid6571 "true"^^ . _:genid6572 . _:genid6572 . _:genid6572 . _:genid6572 . _:genid6572 "true"^^ . _:genid6573 . _:genid6573 . _:genid6573 . _:genid6573 "A type of mutant visible phenotype evidence that is used in an automatic assertion."^^ . _:genid6573 "ECO:RCT"^^ . . _:genid6574 . _:genid6575 . _:genid6577 _:genid6576 . _:genid6575 _:genid6577 . _:genid6576 . _:genid6576 . _:genid6576 . _:genid6577 . _:genid6574 _:genid6575 . _:genid6574 . . . "IEA"^^ . "A type of in vivo assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007223"^^ . "in vivo assay evidence used in automatic assertion"^^ . _:genid6578 . _:genid6578 . _:genid6578 . _:genid6578 . _:genid6578 "true"^^ . _:genid6579 . _:genid6579 . _:genid6579 . _:genid6579 . _:genid6579 "true"^^ . _:genid6580 . _:genid6580 . _:genid6580 . _:genid6580 "A type of in vivo assay evidence that is used in an automatic assertion."^^ . _:genid6580 "ECO:RCT"^^ . . _:genid6581 . _:genid6582 . _:genid6584 _:genid6583 . _:genid6582 _:genid6584 . _:genid6583 . _:genid6583 . _:genid6583 . _:genid6584 . _:genid6581 _:genid6582 . _:genid6581 . . . "IEA"^^ . "A type of animal model system study evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007224"^^ . "animal model system study evidence used in automatic assertion"^^ . _:genid6585 . _:genid6585 . _:genid6585 . _:genid6585 . _:genid6585 "true"^^ . _:genid6586 . _:genid6586 . _:genid6586 . _:genid6586 . _:genid6586 "true"^^ . _:genid6587 . _:genid6587 . _:genid6587 . _:genid6587 "A type of animal model system study evidence that is used in an automatic assertion."^^ . _:genid6587 "ECO:RCT"^^ . . _:genid6588 . _:genid6589 . _:genid6591 _:genid6590 . _:genid6589 _:genid6591 . _:genid6590 . _:genid6590 . _:genid6590 . _:genid6591 . _:genid6588 _:genid6589 . _:genid6588 . . . "IEA"^^ . "A type of clinical study evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007225"^^ . "clinical study evidence used in automatic assertion"^^ . _:genid6592 . _:genid6592 . _:genid6592 . _:genid6592 . _:genid6592 "true"^^ . _:genid6593 . _:genid6593 . _:genid6593 . _:genid6593 . _:genid6593 "true"^^ . _:genid6594 . _:genid6594 . _:genid6594 . _:genid6594 "A type of clinical study evidence that is used in an automatic assertion."^^ . _:genid6594 "ECO:RCT"^^ . . _:genid6595 . _:genid6596 . _:genid6598 _:genid6597 . _:genid6596 _:genid6598 . _:genid6597 . _:genid6597 . _:genid6597 . _:genid6598 . _:genid6595 _:genid6596 . _:genid6595 . . . "IEA"^^ . "A type of in vitro assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007226"^^ . "in vitro assay evidence used in automatic assertion"^^ . _:genid6599 . _:genid6599 . _:genid6599 . _:genid6599 . _:genid6599 "true"^^ . _:genid6600 . _:genid6600 . _:genid6600 . _:genid6600 . _:genid6600 "true"^^ . _:genid6601 . _:genid6601 . _:genid6601 . _:genid6601 "A type of in vitro assay evidence that is used in an automatic assertion."^^ . _:genid6601 "ECO:RCT"^^ . . _:genid6602 . _:genid6603 . _:genid6605 _:genid6604 . _:genid6603 _:genid6605 . _:genid6604 . _:genid6604 . _:genid6604 . _:genid6605 . _:genid6602 _:genid6603 . _:genid6602 . . . . "IEA"^^ . "A type of enzyme inhibition evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007227"^^ . "enzyme inhibition evidence used in automatic assertion"^^ . _:genid6606 . _:genid6606 . _:genid6606 . _:genid6606 . _:genid6606 "true"^^ . _:genid6607 . _:genid6607 . _:genid6607 . _:genid6607 . _:genid6607 "true"^^ . _:genid6608 . _:genid6608 . _:genid6608 . _:genid6608 . _:genid6608 "true"^^ . _:genid6609 . _:genid6609 . _:genid6609 . _:genid6609 "A type of enzyme inhibition evidence that is used in an automatic assertion."^^ . _:genid6609 "ECO:RCT"^^ . . _:genid6610 . _:genid6611 . _:genid6613 _:genid6612 . _:genid6611 _:genid6613 . _:genid6612 . _:genid6612 . _:genid6612 . _:genid6613 . _:genid6610 _:genid6611 . _:genid6610 . . . "IEA"^^ . "A type of Illumina sequencing evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007229"^^ . "Illumina sequencing evidence used in automatic assertion"^^ . _:genid6614 . _:genid6614 . _:genid6614 . _:genid6614 . _:genid6614 "true"^^ . _:genid6615 . _:genid6615 . _:genid6615 . _:genid6615 . _:genid6615 "true"^^ . _:genid6616 . _:genid6616 . _:genid6616 . _:genid6616 "A type of Illumina sequencing evidence that is used in an automatic assertion."^^ . _:genid6616 "ECO:RCT"^^ . . _:genid6617 . _:genid6618 . _:genid6620 _:genid6619 . _:genid6618 _:genid6620 . _:genid6619 . _:genid6619 . _:genid6619 . _:genid6620 . _:genid6617 _:genid6618 . _:genid6617 . . . "IEA"^^ . "A type of 454 pyrosequencing evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007230"^^ . "454 pyrosequencing evidence used in automatic assertion"^^ . _:genid6621 . _:genid6621 . _:genid6621 . _:genid6621 . _:genid6621 "true"^^ . _:genid6622 . _:genid6622 . _:genid6622 . _:genid6622 . _:genid6622 "true"^^ . _:genid6623 . _:genid6623 . _:genid6623 . _:genid6623 "A type of 454 pyrosequencing evidence that is used in an automatic assertion."^^ . _:genid6623 "ECO:RCT"^^ . . _:genid6624 . _:genid6625 . _:genid6627 _:genid6626 . _:genid6625 _:genid6627 . _:genid6626 . _:genid6626 . _:genid6626 . _:genid6627 . _:genid6624 _:genid6625 . _:genid6624 . . . "IEA"^^ . "A type of SOLiD sequencing evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007231"^^ . "SOLiD sequencing evidence used in automatic assertion"^^ . _:genid6628 . _:genid6628 . _:genid6628 . _:genid6628 . _:genid6628 "true"^^ . _:genid6629 . _:genid6629 . _:genid6629 . _:genid6629 . _:genid6629 "true"^^ . _:genid6630 . _:genid6630 . _:genid6630 . _:genid6630 "A type of SOLiD sequencing evidence that is used in an automatic assertion."^^ . _:genid6630 "ECO:RCT"^^ . . _:genid6631 . _:genid6632 . _:genid6634 _:genid6633 . _:genid6632 _:genid6634 . _:genid6633 . _:genid6633 . _:genid6633 . _:genid6634 . _:genid6631 _:genid6632 . _:genid6631 . . . "IEA"^^ . "A type of chain termination sequencing evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007232"^^ . "chain termination sequencing evidence used in automatic assertion"^^ . _:genid6635 . _:genid6635 . _:genid6635 . _:genid6635 . _:genid6635 "true"^^ . _:genid6636 . _:genid6636 . _:genid6636 . _:genid6636 . _:genid6636 "true"^^ . _:genid6637 . _:genid6637 . _:genid6637 . _:genid6637 "A type of chain termination sequencing evidence that is used in an automatic assertion."^^ . _:genid6637 "ECO:RCT"^^ . . _:genid6638 . _:genid6639 . _:genid6641 _:genid6640 . _:genid6639 _:genid6641 . _:genid6640 . _:genid6640 . _:genid6640 . _:genid6641 . _:genid6638 _:genid6639 . _:genid6638 . . . "IEA"^^ . "A type of chromatin immunoprecipitation-qPCR evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007233"^^ . "chromatin immunoprecipitation-qPCR evidence used in automatic assertion"^^ . _:genid6642 . _:genid6642 . _:genid6642 . _:genid6642 . _:genid6642 "true"^^ . _:genid6643 . _:genid6643 . _:genid6643 . _:genid6643 . _:genid6643 "true"^^ . _:genid6644 . _:genid6644 . _:genid6644 . _:genid6644 "A type of chromatin immunoprecipitation-qPCR evidence that is used in an automatic assertion."^^ . _:genid6644 "ECO:RCT"^^ . . _:genid6645 . _:genid6646 . _:genid6648 _:genid6647 . _:genid6646 _:genid6648 . _:genid6647 . _:genid6647 . _:genid6647 . _:genid6648 . _:genid6645 _:genid6646 . _:genid6645 . . . "IEA"^^ . "A type of 4C evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "circularized chromosome conformation capture evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007234"^^ . "4C evidence used in automatic assertion"^^ . _:genid6649 . _:genid6649 . _:genid6649 . _:genid6649 . _:genid6649 "true"^^ . _:genid6650 . _:genid6650 . _:genid6650 . _:genid6650 . _:genid6650 "true"^^ . _:genid6651 . _:genid6651 . _:genid6651 . _:genid6651 "A type of 4C evidence that is used in an automatic assertion."^^ . _:genid6651 "ECO:RCT"^^ . . _:genid6652 . _:genid6653 . _:genid6655 _:genid6654 . _:genid6653 _:genid6655 . _:genid6654 . _:genid6654 . _:genid6654 . _:genid6655 . _:genid6652 _:genid6653 . _:genid6652 . . . "IEA"^^ . "A type of 5C evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "carbon-copy chromosome conformation capture evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007235"^^ . "5C evidence used in automatic assertion"^^ . _:genid6656 . _:genid6656 . _:genid6656 . _:genid6656 . _:genid6656 "true"^^ . _:genid6657 . _:genid6657 . _:genid6657 . _:genid6657 . _:genid6657 "true"^^ . _:genid6658 . _:genid6658 . _:genid6658 . _:genid6658 "A type of 5C evidence that is used in an automatic assertion."^^ . _:genid6658 "ECO:RCT"^^ . . _:genid6659 . _:genid6660 . _:genid6662 _:genid6661 . _:genid6660 _:genid6662 . _:genid6661 . _:genid6661 . _:genid6661 . _:genid6662 . _:genid6659 _:genid6660 . _:genid6659 . . . "IEA"^^ . "A type of 3C-qPCR evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "chromosome conformation capture-qPCR evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007237"^^ . "3C-qPCR evidence used in automatic assertion"^^ . _:genid6663 . _:genid6663 . _:genid6663 . _:genid6663 . _:genid6663 "true"^^ . _:genid6664 . _:genid6664 . _:genid6664 . _:genid6664 . _:genid6664 "true"^^ . _:genid6665 . _:genid6665 . _:genid6665 . _:genid6665 "A type of 3C-qPCR evidence that is used in an automatic assertion."^^ . _:genid6665 "ECO:RCT"^^ . . _:genid6666 . _:genid6667 . _:genid6669 _:genid6668 . _:genid6667 _:genid6669 . _:genid6668 . _:genid6668 . _:genid6668 . _:genid6669 . _:genid6666 _:genid6667 . _:genid6666 . . . "IEA"^^ . "A type of Hi-C evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007238"^^ . "Hi-C evidence used in automatic assertion"^^ . _:genid6670 . _:genid6670 . _:genid6670 . _:genid6670 . _:genid6670 "true"^^ . _:genid6671 . _:genid6671 . _:genid6671 . _:genid6671 . _:genid6671 "true"^^ . _:genid6672 . _:genid6672 . _:genid6672 . _:genid6672 "A type of Hi-C evidence that is used in an automatic assertion."^^ . _:genid6672 "ECO:RCT"^^ . . _:genid6673 . _:genid6674 . _:genid6676 _:genid6675 . _:genid6674 _:genid6676 . _:genid6675 . _:genid6675 . _:genid6675 . _:genid6676 . _:genid6673 _:genid6674 . _:genid6673 . . . "IEA"^^ . "A type of 3C-seq evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "chromosome conformation capture sequencing evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007239"^^ . "3C-seq evidence used in automatic assertion"^^ . _:genid6677 . _:genid6677 . _:genid6677 . _:genid6677 . _:genid6677 "true"^^ . _:genid6678 . _:genid6678 . _:genid6678 . _:genid6678 . _:genid6678 "true"^^ . _:genid6679 . _:genid6679 . _:genid6679 . _:genid6679 "A type of 3C-seq evidence that is used in an automatic assertion."^^ . _:genid6679 "ECO:RCT"^^ . . _:genid6680 . _:genid6681 . _:genid6683 _:genid6682 . _:genid6681 _:genid6683 . _:genid6682 . _:genid6682 . _:genid6682 . _:genid6683 . _:genid6680 _:genid6681 . _:genid6680 . . . "IEA"^^ . "A type of environmental perturbation phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "environmental perturbation evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007240"^^ . "environmental perturbation phenotypic evidence used in automatic assertion"^^ . _:genid6684 . _:genid6684 . _:genid6684 . _:genid6684 . _:genid6684 "true"^^ . _:genid6685 . _:genid6685 . _:genid6685 . _:genid6685 . _:genid6685 "true"^^ . _:genid6686 . _:genid6686 . _:genid6686 . _:genid6686 "A type of environmental perturbation phenotypic evidence that is used in an automatic assertion."^^ . _:genid6686 "ECO:RCT"^^ . . _:genid6687 . _:genid6688 . _:genid6690 _:genid6689 . _:genid6688 _:genid6690 . _:genid6689 . _:genid6689 . _:genid6689 . _:genid6690 . _:genid6687 _:genid6688 . _:genid6687 . . . "IEA"^^ . "A type of tissue ablation phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "tissue ablation evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007241"^^ . "tissue ablation phenotypic evidence used in automatic assertion"^^ . _:genid6691 . _:genid6691 . _:genid6691 . _:genid6691 . _:genid6691 "true"^^ . _:genid6692 . _:genid6692 . _:genid6692 . _:genid6692 . _:genid6692 "true"^^ . _:genid6693 . _:genid6693 . _:genid6693 . _:genid6693 "A type of tissue ablation phenotypic evidence that is used in an automatic assertion."^^ . _:genid6693 "ECO:RCT"^^ . . _:genid6694 . _:genid6695 . _:genid6697 _:genid6696 . _:genid6695 _:genid6697 . _:genid6696 . _:genid6696 . _:genid6696 . _:genid6697 . _:genid6694 _:genid6695 . _:genid6694 . . . "IEA"^^ . "A type of tissue grafting phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "tissue grafting evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007242"^^ . "tissue grafting phenotypic evidence used in automatic assertion"^^ . _:genid6698 . _:genid6698 . _:genid6698 . _:genid6698 . _:genid6698 "true"^^ . _:genid6699 . _:genid6699 . _:genid6699 . _:genid6699 . _:genid6699 "true"^^ . _:genid6700 . _:genid6700 . _:genid6700 . _:genid6700 "A type of tissue grafting phenotypic evidence that is used in an automatic assertion."^^ . _:genid6700 "ECO:RCT"^^ . . _:genid6701 . _:genid6702 . _:genid6704 _:genid6703 . _:genid6702 _:genid6704 . _:genid6703 . _:genid6703 . _:genid6703 . _:genid6704 . _:genid6701 _:genid6702 . _:genid6701 . . . "IEA"^^ . "A type of cytochalasin experiment evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007245"^^ . "cytochalasin experiment evidence used in automatic assertion"^^ . _:genid6705 . _:genid6705 . _:genid6705 . _:genid6705 . _:genid6705 "true"^^ . _:genid6706 . _:genid6706 . _:genid6706 . _:genid6706 . _:genid6706 "true"^^ . _:genid6707 . _:genid6707 . _:genid6707 . _:genid6707 "A type of cytochalasin experiment evidence that is used in an automatic assertion."^^ . _:genid6707 "ECO:RCT"^^ . . _:genid6708 . _:genid6709 . _:genid6711 _:genid6710 . _:genid6709 _:genid6711 . _:genid6710 . _:genid6710 . _:genid6710 . _:genid6711 . _:genid6708 _:genid6709 . _:genid6708 . . . "IEA"^^ . "A type of green fluorescent protein immunolocalization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007246"^^ . "green fluorescent protein immunolocalization evidence used in automatic assertion"^^ . _:genid6712 . _:genid6712 . _:genid6712 . _:genid6712 . _:genid6712 "true"^^ . _:genid6713 . _:genid6713 . _:genid6713 . _:genid6713 . _:genid6713 "true"^^ . _:genid6714 . _:genid6714 . _:genid6714 . _:genid6714 "A type of green fluorescent protein immunolocalization evidence that is used in an automatic assertion."^^ . _:genid6714 "ECO:RCT"^^ . . _:genid6715 . _:genid6716 . _:genid6718 _:genid6717 . _:genid6716 _:genid6718 . _:genid6717 . _:genid6717 . _:genid6717 . _:genid6718 . _:genid6715 _:genid6716 . _:genid6715 . . . "IEA"^^ . "A type of beta-galactosidase protein immunolocalization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007247"^^ . "beta-galactosidase protein immunolocalization evidence used in automatic assertion"^^ . _:genid6719 . _:genid6719 . _:genid6719 . _:genid6719 . _:genid6719 "true"^^ . _:genid6720 . _:genid6720 . _:genid6720 . _:genid6720 . _:genid6720 "true"^^ . _:genid6721 . _:genid6721 . _:genid6721 . _:genid6721 "A type of beta-galactosidase protein immunolocalization evidence that is used in an automatic assertion."^^ . _:genid6721 "ECO:RCT"^^ . . _:genid6722 . _:genid6723 . _:genid6725 _:genid6724 . _:genid6723 _:genid6725 . _:genid6724 . _:genid6724 . _:genid6724 . _:genid6725 . _:genid6722 _:genid6723 . _:genid6722 . . . "IEA"^^ . "A type of cap analysis of gene expression evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007248"^^ . "cap analysis of gene expression evidence used in automatic assertion"^^ . _:genid6726 . _:genid6726 . _:genid6726 . _:genid6726 . _:genid6726 "true"^^ . _:genid6727 . _:genid6727 . _:genid6727 . _:genid6727 . _:genid6727 "true"^^ . _:genid6728 . _:genid6728 . _:genid6728 . _:genid6728 "A type of cap analysis of gene expression evidence that is used in an automatic assertion."^^ . _:genid6728 "ECO:RCT"^^ . . _:genid6729 . _:genid6730 . _:genid6732 _:genid6731 . _:genid6730 _:genid6732 . _:genid6731 . _:genid6731 . _:genid6731 . _:genid6732 . _:genid6729 _:genid6730 . _:genid6729 . . . "IEA"^^ . "A type of nano-cap analysis of gene expression evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007249"^^ . "nano-cap analysis of gene expression evidence used in automatic assertion"^^ . _:genid6733 . _:genid6733 . _:genid6733 . _:genid6733 . _:genid6733 "true"^^ . _:genid6734 . _:genid6734 . _:genid6734 . _:genid6734 . _:genid6734 "true"^^ . _:genid6735 . _:genid6735 . _:genid6735 . _:genid6735 "A type of nano-cap analysis of gene expression evidence that is used in an automatic assertion."^^ . _:genid6735 "ECO:RCT"^^ . . _:genid6736 . _:genid6737 . _:genid6739 _:genid6738 . _:genid6737 _:genid6739 . _:genid6738 . _:genid6738 . _:genid6738 . _:genid6739 . _:genid6736 _:genid6737 . _:genid6736 . . . "IEA"^^ . "A type of particle size and count assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007250"^^ . "particle size and count assay evidence used in automatic assertion"^^ . _:genid6740 . _:genid6740 . _:genid6740 . _:genid6740 . _:genid6740 "true"^^ . _:genid6741 . _:genid6741 . _:genid6741 . _:genid6741 . _:genid6741 "true"^^ . _:genid6742 . _:genid6742 . _:genid6742 . _:genid6742 "A type of particle size and count assay evidence that is used in an automatic assertion."^^ . _:genid6742 "ECO:RCT"^^ . . _:genid6743 . _:genid6744 . _:genid6746 _:genid6745 . _:genid6744 _:genid6746 . _:genid6745 . _:genid6745 . _:genid6745 . _:genid6746 . _:genid6743 _:genid6744 . _:genid6743 . . . "IEA"^^ . "A type of competitive growth assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007251"^^ . "competitive growth assay evidence used in automatic assertion"^^ . _:genid6747 . _:genid6747 . _:genid6747 . _:genid6747 . _:genid6747 "true"^^ . _:genid6748 . _:genid6748 . _:genid6748 . _:genid6748 . _:genid6748 "true"^^ . _:genid6749 . _:genid6749 . _:genid6749 . _:genid6749 "A type of competitive growth assay evidence that is used in an automatic assertion."^^ . _:genid6749 "ECO:RCT"^^ . . _:genid6750 . _:genid6751 . _:genid6753 _:genid6752 . _:genid6751 _:genid6753 . _:genid6752 . _:genid6752 . _:genid6752 . _:genid6753 . _:genid6750 _:genid6751 . _:genid6750 . . . "IEA"^^ . "A type of pulsed-field gel electrophoresis evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007252"^^ . "pulsed-field gel electrophoresis evidence used in automatic assertion"^^ . _:genid6754 . _:genid6754 . _:genid6754 . _:genid6754 . _:genid6754 "true"^^ . _:genid6755 . _:genid6755 . _:genid6755 . _:genid6755 . _:genid6755 "true"^^ . _:genid6756 . _:genid6756 . _:genid6756 . _:genid6756 "A type of pulsed-field gel electrophoresis evidence that is used in an automatic assertion."^^ . _:genid6756 "ECO:RCT"^^ . . _:genid6757 . _:genid6758 . _:genid6760 _:genid6759 . _:genid6758 _:genid6760 . _:genid6759 . _:genid6759 . _:genid6759 . _:genid6760 . _:genid6757 _:genid6758 . _:genid6757 . . . "IEA"^^ . "A type of two-dimensional agarose gel electrophoresis evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007253"^^ . "two-dimensional agarose gel electrophoresis evidence used in automatic assertion"^^ . _:genid6761 . _:genid6761 . _:genid6761 . _:genid6761 . _:genid6761 "true"^^ . _:genid6762 . _:genid6762 . _:genid6762 . _:genid6762 . _:genid6762 "true"^^ . _:genid6763 . _:genid6763 . _:genid6763 . _:genid6763 "A type of two-dimensional agarose gel electrophoresis evidence that is used in an automatic assertion."^^ . _:genid6763 "ECO:RCT"^^ . . _:genid6764 . _:genid6765 . _:genid6767 _:genid6766 . _:genid6765 _:genid6767 . _:genid6766 . _:genid6766 . _:genid6766 . _:genid6767 . _:genid6764 _:genid6765 . _:genid6764 . . . "IEA"^^ . "A type of plasmid maintenance assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007254"^^ . "plasmid maintenance assay evidence used in automatic assertion"^^ . _:genid6768 . _:genid6768 . _:genid6768 . _:genid6768 . _:genid6768 "true"^^ . _:genid6769 . _:genid6769 . _:genid6769 . _:genid6769 . _:genid6769 "true"^^ . _:genid6770 . _:genid6770 . _:genid6770 . _:genid6770 "A type of plasmid maintenance assay evidence that is used in an automatic assertion."^^ . _:genid6770 "ECO:RCT"^^ . . _:genid6771 . _:genid6772 . _:genid6774 _:genid6773 . _:genid6772 _:genid6774 . _:genid6773 . _:genid6773 . _:genid6773 . _:genid6774 . _:genid6771 _:genid6772 . _:genid6771 . . . "IEA"^^ . "A type of specific protein inhibition by antibody evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007255"^^ . "specific protein inhibition by antibody evidence used in automatic assertion"^^ . _:genid6775 . _:genid6775 . _:genid6775 . _:genid6775 . _:genid6775 "true"^^ . _:genid6776 . _:genid6776 . _:genid6776 . _:genid6776 . _:genid6776 "true"^^ . _:genid6777 . _:genid6777 . _:genid6777 . _:genid6777 "A type of specific protein inhibition by antibody evidence that is used in an automatic assertion."^^ . _:genid6777 "ECO:RCT"^^ . . _:genid6778 . _:genid6779 . _:genid6781 _:genid6780 . _:genid6779 _:genid6781 . _:genid6780 . _:genid6780 . _:genid6780 . _:genid6781 . _:genid6778 _:genid6779 . _:genid6778 . . . "IEA"^^ . "A type of single exon transcript confirmation via alignment evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007256"^^ . "single exon transcript confirmation via alignment evidence used in automatic assertion"^^ . _:genid6782 . _:genid6782 . _:genid6782 . _:genid6782 . _:genid6782 "true"^^ . _:genid6783 . _:genid6783 . _:genid6783 . _:genid6783 . _:genid6783 "true"^^ . _:genid6784 . _:genid6784 . _:genid6784 . _:genid6784 "A type of single exon transcript confirmation via alignment evidence that is used in an automatic assertion."^^ . _:genid6784 "ECO:RCT"^^ . . _:genid6785 . _:genid6786 . _:genid6788 _:genid6787 . _:genid6786 _:genid6788 . _:genid6787 . _:genid6787 . _:genid6787 . _:genid6788 . _:genid6785 _:genid6786 . _:genid6785 . . . "IEA"^^ . "A type of phylogenetic distribution evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007257"^^ . "phylogenetic distribution evidence used in automatic assertion"^^ . _:genid6789 . _:genid6789 . _:genid6789 . _:genid6789 . _:genid6789 "true"^^ . _:genid6790 . _:genid6790 . _:genid6790 . _:genid6790 . _:genid6790 "true"^^ . _:genid6791 . _:genid6791 . _:genid6791 . _:genid6791 "A type of phylogenetic distribution evidence that is used in an automatic assertion."^^ . _:genid6791 "ECO:RCT"^^ . . _:genid6792 . _:genid6793 . _:genid6795 _:genid6794 . _:genid6793 _:genid6795 . _:genid6794 . _:genid6794 . _:genid6794 . _:genid6795 . _:genid6792 _:genid6793 . _:genid6792 . . . "IEA"^^ . "A type of differential geneset expression evidence from microarray experiment (GSEA, Fisher-exact) that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007258"^^ . "differential geneset expression evidence from microarray experiment (GSEA, Fisher-exact) used in automatic assertion"^^ . _:genid6796 . _:genid6796 . _:genid6796 . _:genid6796 . _:genid6796 "true"^^ . _:genid6797 . _:genid6797 . _:genid6797 . _:genid6797 . _:genid6797 "true"^^ . _:genid6798 . _:genid6798 . _:genid6798 . _:genid6798 "A type of differential geneset expression evidence from microarray experiment (GSEA, Fisher-exact) that is used in an automatic assertion."^^ . _:genid6798 "ECO:RCT"^^ . . _:genid6799 . _:genid6800 . _:genid6802 _:genid6801 . _:genid6800 _:genid6802 . _:genid6801 . _:genid6801 . _:genid6801 . _:genid6802 . _:genid6799 _:genid6800 . _:genid6799 . . . "IEA"^^ . "A type of differential geneset expression evidence from RNA-seq experiment (GSEA, Fisher-exact) that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007259"^^ . "differential geneset expression evidence from RNA-seq experiment (GSEA, Fisher-exact) used in automatic assertion"^^ . _:genid6803 . _:genid6803 . _:genid6803 . _:genid6803 . _:genid6803 "true"^^ . _:genid6804 . _:genid6804 . _:genid6804 . _:genid6804 . _:genid6804 "true"^^ . _:genid6805 . _:genid6805 . _:genid6805 . _:genid6805 "A type of differential geneset expression evidence from RNA-seq experiment (GSEA, Fisher-exact) that is used in an automatic assertion."^^ . _:genid6805 "ECO:RCT"^^ . . _:genid6806 . _:genid6807 . _:genid6809 _:genid6808 . _:genid6807 _:genid6809 . _:genid6808 . _:genid6808 . _:genid6808 . _:genid6809 . _:genid6806 _:genid6807 . _:genid6806 . . . "IEA"^^ . "A type of biological target-disease association via drug that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007260"^^ . "biological target-disease association via drug evidence used in automatic assertion"^^ . _:genid6810 . _:genid6810 . _:genid6810 . _:genid6810 . _:genid6810 "true"^^ . _:genid6811 . _:genid6811 . _:genid6811 . _:genid6811 . _:genid6811 "true"^^ . _:genid6812 . _:genid6812 . _:genid6812 . _:genid6812 "A type of biological target-disease association via drug that is used in an automatic assertion."^^ . _:genid6812 "ECO:RCT"^^ . . _:genid6813 . _:genid6814 . _:genid6816 _:genid6815 . _:genid6814 _:genid6816 . _:genid6815 . _:genid6815 . _:genid6815 . _:genid6816 . _:genid6813 _:genid6814 . _:genid6813 . . . "IEA"^^ . "A type of cell staining evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007261"^^ . "cell staining evidence used in automatic assertion"^^ . _:genid6817 . _:genid6817 . _:genid6817 . _:genid6817 . _:genid6817 "true"^^ . _:genid6818 . _:genid6818 . _:genid6818 . _:genid6818 . _:genid6818 "true"^^ . _:genid6819 . _:genid6819 . _:genid6819 . _:genid6819 "A type of cell staining evidence that is used in an automatic assertion."^^ . _:genid6819 "ECO:RCT"^^ . . "A type of visual sequence inspection evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007262"^^ . "visual sequence inspection evidence used in automatic assertion"^^ . "true"^^ . _:genid6820 . _:genid6820 . _:genid6820 . _:genid6820 "A type of visual sequence inspection evidence that is used in an automatic assertion."^^ . _:genid6820 "ECO:RCT"^^ . . _:genid6821 . _:genid6822 . _:genid6824 _:genid6823 . _:genid6822 _:genid6824 . _:genid6823 . _:genid6823 . _:genid6823 . _:genid6824 . _:genid6821 _:genid6822 . _:genid6821 . . . "IEA"^^ . "A type of ATP bioluminescence assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007263"^^ . "ATP bioluminescence assay evidence used in automatic assertion"^^ . _:genid6825 . _:genid6825 . _:genid6825 . _:genid6825 . _:genid6825 "true"^^ . _:genid6826 . _:genid6826 . _:genid6826 . _:genid6826 . _:genid6826 "true"^^ . _:genid6827 . _:genid6827 . _:genid6827 . _:genid6827 "A type of ATP bioluminescence assay evidence that is used in an automatic assertion."^^ . _:genid6827 "ECO:RCT"^^ . . _:genid6828 . _:genid6829 . _:genid6831 _:genid6830 . _:genid6829 _:genid6831 . _:genid6830 . _:genid6830 . _:genid6830 . _:genid6831 . _:genid6828 _:genid6829 . _:genid6828 . . . "IEA"^^ . "A type of missense mutation phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "missense mutation evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007264"^^ . "missense mutation phenotypic evidence used in automatic assertion"^^ . _:genid6832 . _:genid6832 . _:genid6832 . _:genid6832 . _:genid6832 "true"^^ . _:genid6833 . _:genid6833 . _:genid6833 . _:genid6833 . _:genid6833 "true"^^ . _:genid6834 . _:genid6834 . _:genid6834 . _:genid6834 "A type of missense mutation phenotypic evidence that is used in an automatic assertion."^^ . _:genid6834 "ECO:RCT"^^ . . _:genid6835 . _:genid6836 . _:genid6838 _:genid6837 . _:genid6836 _:genid6838 . _:genid6837 . _:genid6837 . _:genid6837 . _:genid6838 . _:genid6835 _:genid6836 . _:genid6835 . . . "IEA"^^ . "A type of nonsense mutation phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "nonsense mutation evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007265"^^ . "nonsense mutation phenotypic evidence used in automatic assertion"^^ . _:genid6839 . _:genid6839 . _:genid6839 . _:genid6839 . _:genid6839 "true"^^ . _:genid6840 . _:genid6840 . _:genid6840 . _:genid6840 . _:genid6840 "true"^^ . _:genid6841 . _:genid6841 . _:genid6841 . _:genid6841 "A type of nonsense mutation phenotypic evidence that is used in an automatic assertion."^^ . _:genid6841 "ECO:RCT"^^ . . _:genid6842 . _:genid6843 . _:genid6845 _:genid6844 . _:genid6843 _:genid6845 . _:genid6844 . _:genid6844 . _:genid6844 . _:genid6845 . _:genid6842 _:genid6843 . _:genid6842 . . . "IEA"^^ . "A type of silent mutation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007266"^^ . "silent mutation evidence used in automatic assertion"^^ . _:genid6846 . _:genid6846 . _:genid6846 . _:genid6846 . _:genid6846 "true"^^ . _:genid6847 . _:genid6847 . _:genid6847 . _:genid6847 . _:genid6847 "true"^^ . _:genid6848 . _:genid6848 . _:genid6848 . _:genid6848 "A type of silent mutation evidence that is used in an automatic assertion."^^ . _:genid6848 "ECO:RCT"^^ . . _:genid6849 . _:genid6850 . _:genid6852 _:genid6851 . _:genid6850 _:genid6852 . _:genid6851 . _:genid6851 . _:genid6851 . _:genid6852 . _:genid6849 _:genid6850 . _:genid6849 . . . "IEA"^^ . "A type of insertion mutation phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "insertion mutation evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007267"^^ . "insertion mutation phenotypic evidence used in automatic assertion"^^ . _:genid6853 . _:genid6853 . _:genid6853 . _:genid6853 . _:genid6853 "true"^^ . _:genid6854 . _:genid6854 . _:genid6854 . _:genid6854 . _:genid6854 "true"^^ . _:genid6855 . _:genid6855 . _:genid6855 . _:genid6855 "A type of insertion mutation phenotypic evidence that is used in an automatic assertion."^^ . _:genid6855 "ECO:RCT"^^ . . _:genid6856 . _:genid6857 . _:genid6859 _:genid6858 . _:genid6857 _:genid6859 . _:genid6858 . _:genid6858 . _:genid6858 . _:genid6859 . _:genid6856 _:genid6857 . _:genid6856 . . . "IEA"^^ . "A type of duplication mutation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007268"^^ . "duplication mutation evidence used in automatic assertion"^^ . _:genid6860 . _:genid6860 . _:genid6860 . _:genid6860 . _:genid6860 "true"^^ . _:genid6861 . _:genid6861 . _:genid6861 . _:genid6861 . _:genid6861 "true"^^ . _:genid6862 . _:genid6862 . _:genid6862 . _:genid6862 "A type of duplication mutation evidence that is used in an automatic assertion."^^ . _:genid6862 "ECO:RCT"^^ . . _:genid6863 . _:genid6864 . _:genid6866 _:genid6865 . _:genid6864 _:genid6866 . _:genid6865 . _:genid6865 . _:genid6865 . _:genid6866 . _:genid6863 _:genid6864 . _:genid6863 . . . "IEA"^^ . "A type of frameshift mutation phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "frameshift mutation evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007269"^^ . "frameshift mutation phenotypic evidence used in automatic assertion"^^ . _:genid6867 . _:genid6867 . _:genid6867 . _:genid6867 . _:genid6867 "true"^^ . _:genid6868 . _:genid6868 . _:genid6868 . _:genid6868 . _:genid6868 "true"^^ . _:genid6869 . _:genid6869 . _:genid6869 . _:genid6869 "A type of frameshift mutation phenotypic evidence that is used in an automatic assertion."^^ . _:genid6869 "ECO:RCT"^^ . . _:genid6870 . _:genid6871 . _:genid6873 _:genid6872 . _:genid6871 _:genid6873 . _:genid6872 . _:genid6872 . _:genid6872 . _:genid6873 . _:genid6870 _:genid6871 . _:genid6870 . . . "IEA"^^ . "A type of repeat expansion mutation phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "repeat expansion mutation evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007270"^^ . "repeat expansion mutation phenotypic evidence used in automatic assertion"^^ . _:genid6874 . _:genid6874 . _:genid6874 . _:genid6874 . _:genid6874 "true"^^ . _:genid6875 . _:genid6875 . _:genid6875 . _:genid6875 . _:genid6875 "true"^^ . _:genid6876 . _:genid6876 . _:genid6876 . _:genid6876 "A type of repeat expansion mutation phenotypic evidence that is used in an automatic assertion."^^ . _:genid6876 "ECO:RCT"^^ . . _:genid6877 . _:genid6878 . _:genid6880 _:genid6879 . _:genid6878 _:genid6880 . _:genid6879 . _:genid6879 . _:genid6879 . _:genid6880 . _:genid6877 _:genid6878 . _:genid6877 . . . "IEA"^^ . "A type of splice site mutation phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "splice site mutation evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007271"^^ . "splice site mutation phenotypic evidence used in automatic assertion"^^ . _:genid6881 . _:genid6881 . _:genid6881 . _:genid6881 . _:genid6881 "true"^^ . _:genid6882 . _:genid6882 . _:genid6882 . _:genid6882 . _:genid6882 "true"^^ . _:genid6883 . _:genid6883 . _:genid6883 . _:genid6883 "A type of splice site mutation phenotypic evidence that is used in an automatic assertion."^^ . _:genid6883 "ECO:RCT"^^ . . _:genid6884 . _:genid6885 . _:genid6887 _:genid6886 . _:genid6885 _:genid6887 . _:genid6886 . _:genid6886 . _:genid6886 . _:genid6887 . _:genid6884 _:genid6885 . _:genid6884 . . . "IEA"^^ . "A type of translocation mutation phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "translocation mutation evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007272"^^ . "translocation mutation phenotypic evidence used in automatic assertion"^^ . _:genid6888 . _:genid6888 . _:genid6888 . _:genid6888 . _:genid6888 "true"^^ . _:genid6889 . _:genid6889 . _:genid6889 . _:genid6889 . _:genid6889 "true"^^ . _:genid6890 . _:genid6890 . _:genid6890 . _:genid6890 "A type of translocation mutation phenotypic evidence that is used in an automatic assertion."^^ . _:genid6890 "ECO:RCT"^^ . . _:genid6891 . _:genid6892 . _:genid6894 _:genid6893 . _:genid6892 _:genid6894 . _:genid6893 . _:genid6893 . _:genid6893 . _:genid6894 . _:genid6891 _:genid6892 . _:genid6891 . . . "IEA"^^ . "A type of in-gel protein kinase assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007273"^^ . "in-gel protein kinase assay evidence used in automatic assertion"^^ . _:genid6895 . _:genid6895 . _:genid6895 . _:genid6895 . _:genid6895 "true"^^ . _:genid6896 . _:genid6896 . _:genid6896 . _:genid6896 . _:genid6896 "true"^^ . _:genid6897 . _:genid6897 . _:genid6897 . _:genid6897 "A type of in-gel protein kinase assay evidence that is used in an automatic assertion."^^ . _:genid6897 "ECO:RCT"^^ . . _:genid6898 . _:genid6899 . _:genid6901 _:genid6900 . _:genid6899 _:genid6901 . _:genid6900 . _:genid6900 . _:genid6900 . _:genid6901 . _:genid6898 _:genid6899 . _:genid6898 . . . "IEA"^^ . "A type of macroscopic current trace evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007274"^^ . "macroscopic current trace evidence used in automatic assertion"^^ . _:genid6902 . _:genid6902 . _:genid6902 . _:genid6902 . _:genid6902 "true"^^ . _:genid6903 . _:genid6903 . _:genid6903 . _:genid6903 . _:genid6903 "true"^^ . _:genid6904 . _:genid6904 . _:genid6904 . _:genid6904 "A type of macroscopic current trace evidence that is used in an automatic assertion."^^ . _:genid6904 "ECO:RCT"^^ . . _:genid6905 . _:genid6906 . _:genid6908 _:genid6907 . _:genid6906 _:genid6908 . _:genid6907 . _:genid6907 . _:genid6907 . _:genid6908 . _:genid6905 _:genid6906 . _:genid6905 . . . "IEA"^^ . "A type of current density evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007275"^^ . "current density evidence used in automatic assertion"^^ . _:genid6909 . _:genid6909 . _:genid6909 . _:genid6909 . _:genid6909 "true"^^ . _:genid6910 . _:genid6910 . _:genid6910 . _:genid6910 . _:genid6910 "true"^^ . _:genid6911 . _:genid6911 . _:genid6911 . _:genid6911 "A type of current density evidence that is used in an automatic assertion."^^ . _:genid6911 "ECO:RCT"^^ . . _:genid6912 . _:genid6913 . _:genid6915 _:genid6914 . _:genid6913 _:genid6915 . _:genid6914 . _:genid6914 . _:genid6914 . _:genid6915 . _:genid6912 _:genid6913 . _:genid6912 . . . "IEA"^^ . "A type of sustained current evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007276"^^ . "sustained current evidence used in automatic assertion"^^ . _:genid6916 . _:genid6916 . _:genid6916 . _:genid6916 . _:genid6916 "true"^^ . _:genid6917 . _:genid6917 . _:genid6917 . _:genid6917 . _:genid6917 "true"^^ . _:genid6918 . _:genid6918 . _:genid6918 . _:genid6918 "A type of sustained current evidence that is used in an automatic assertion."^^ . _:genid6918 "ECO:RCT"^^ . . _:genid6919 . _:genid6920 . _:genid6922 _:genid6921 . _:genid6920 _:genid6922 . _:genid6921 . _:genid6921 . _:genid6921 . _:genid6922 . _:genid6919 _:genid6920 . _:genid6919 . . . "IEA"^^ . "A type of use dependence of inactivation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007277"^^ . "use dependence of inactivation evidence used in automatic assertion"^^ . _:genid6923 . _:genid6923 . _:genid6923 . _:genid6923 . _:genid6923 "true"^^ . _:genid6924 . _:genid6924 . _:genid6924 . _:genid6924 . _:genid6924 "true"^^ . _:genid6925 . _:genid6925 . _:genid6925 . _:genid6925 "A type of use dependence of inactivation evidence that is used in an automatic assertion."^^ . _:genid6925 "ECO:RCT"^^ . . _:genid6926 . _:genid6927 . _:genid6929 _:genid6928 . _:genid6927 _:genid6929 . _:genid6928 . _:genid6928 . _:genid6928 . _:genid6929 . _:genid6926 _:genid6927 . _:genid6926 . . . "IEA"^^ . "A type of current clamp recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007278"^^ . "current clamp recording evidence used in automatic assertion"^^ . _:genid6930 . _:genid6930 . _:genid6930 . _:genid6930 . _:genid6930 "true"^^ . _:genid6931 . _:genid6931 . _:genid6931 . _:genid6931 . _:genid6931 "true"^^ . _:genid6932 . _:genid6932 . _:genid6932 . _:genid6932 "A type of current clamp recording evidence that is used in an automatic assertion."^^ . _:genid6932 "ECO:RCT"^^ . . _:genid6933 . _:genid6934 . _:genid6936 _:genid6935 . _:genid6934 _:genid6936 . _:genid6935 . _:genid6935 . _:genid6935 . _:genid6936 . _:genid6933 _:genid6934 . _:genid6933 . . . "IEA"^^ . "A type of whole-cell voltage clamp recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007279"^^ . "whole-cell voltage clamp recording evidence used in automatic assertion"^^ . _:genid6937 . _:genid6937 . _:genid6937 . _:genid6937 . _:genid6937 "true"^^ . _:genid6938 . _:genid6938 . _:genid6938 . _:genid6938 . _:genid6938 "true"^^ . _:genid6939 . _:genid6939 . _:genid6939 . _:genid6939 "A type of whole-cell voltage clamp recording evidence that is used in an automatic assertion."^^ . _:genid6939 "ECO:RCT"^^ . . _:genid6940 . _:genid6941 . _:genid6943 _:genid6942 . _:genid6941 _:genid6943 . _:genid6942 . _:genid6942 . _:genid6942 . _:genid6943 . _:genid6940 _:genid6941 . _:genid6940 . . . "IEA"^^ . "A type of cell-attached single-channel recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007280"^^ . "cell-attached single-channel recording evidence used in automatic assertion"^^ . _:genid6944 . _:genid6944 . _:genid6944 . _:genid6944 . _:genid6944 "true"^^ . _:genid6945 . _:genid6945 . _:genid6945 . _:genid6945 . _:genid6945 "true"^^ . _:genid6946 . _:genid6946 . _:genid6946 . _:genid6946 "A type of cell-attached single-channel recording evidence that is used in an automatic assertion."^^ . _:genid6946 "ECO:RCT"^^ . . _:genid6947 . _:genid6948 . _:genid6950 _:genid6949 . _:genid6948 _:genid6950 . _:genid6949 . _:genid6949 . _:genid6949 . _:genid6950 . _:genid6947 _:genid6948 . _:genid6947 . . . "IEA"^^ . "A type of cell-detached inside-out single-channel recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007281"^^ . "cell-detached inside-out single-channel recording evidence used in automatic assertion"^^ . _:genid6951 . _:genid6951 . _:genid6951 . _:genid6951 . _:genid6951 "true"^^ . _:genid6952 . _:genid6952 . _:genid6952 . _:genid6952 . _:genid6952 "true"^^ . _:genid6953 . _:genid6953 . _:genid6953 . _:genid6953 "A type of cell-detached inside-out single-channel recording evidence that is used in an automatic assertion."^^ . _:genid6953 "ECO:RCT"^^ . . _:genid6954 . _:genid6955 . _:genid6957 _:genid6956 . _:genid6955 _:genid6957 . _:genid6956 . _:genid6956 . _:genid6956 . _:genid6957 . _:genid6954 _:genid6955 . _:genid6954 . . . "IEA"^^ . "A type of reconstituted bilayer single-channel patch recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007282"^^ . "reconstituted bilayer single-channel patch recording evidence used in automatic assertion"^^ . _:genid6958 . _:genid6958 . _:genid6958 . _:genid6958 . _:genid6958 "true"^^ . _:genid6959 . _:genid6959 . _:genid6959 . _:genid6959 . _:genid6959 "true"^^ . _:genid6960 . _:genid6960 . _:genid6960 . _:genid6960 "A type of reconstituted bilayer single-channel patch recording evidence that is used in an automatic assertion."^^ . _:genid6960 "ECO:RCT"^^ . . _:genid6961 . _:genid6962 . _:genid6964 _:genid6963 . _:genid6962 _:genid6964 . _:genid6963 . _:genid6963 . _:genid6963 . _:genid6964 . _:genid6961 _:genid6962 . _:genid6961 . . . "IEA"^^ . "A type of electroencephalography recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007283"^^ . "electroencephalography recording evidence used in automatic assertion"^^ . _:genid6965 . _:genid6965 . _:genid6965 . _:genid6965 . _:genid6965 "true"^^ . _:genid6966 . _:genid6966 . _:genid6966 . _:genid6966 . _:genid6966 "true"^^ . _:genid6967 . _:genid6967 . _:genid6967 . _:genid6967 "A type of electroencephalography recording evidence that is used in an automatic assertion."^^ . _:genid6967 "ECO:RCT"^^ . . _:genid6968 . _:genid6969 . _:genid6971 _:genid6970 . _:genid6969 _:genid6971 . _:genid6970 . _:genid6970 . _:genid6970 . _:genid6971 . _:genid6968 _:genid6969 . _:genid6968 . . . "IEA"^^ . "A type of cell-detached outside-out single-channel recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007284"^^ . "cell-detached outside-out single-channel recording evidence used in automatic assertion"^^ . _:genid6972 . _:genid6972 . _:genid6972 . _:genid6972 . _:genid6972 "true"^^ . _:genid6973 . _:genid6973 . _:genid6973 . _:genid6973 . _:genid6973 "true"^^ . _:genid6974 . _:genid6974 . _:genid6974 . _:genid6974 "A type of cell-detached outside-out single-channel recording evidence that is used in an automatic assertion."^^ . _:genid6974 "ECO:RCT"^^ . . _:genid6975 . _:genid6976 . _:genid6978 _:genid6977 . _:genid6976 _:genid6978 . _:genid6977 . _:genid6977 . _:genid6977 . _:genid6978 . _:genid6975 _:genid6976 . _:genid6975 . . . "IEA"^^ . "A type of cut-open oocyte voltage clamp recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007285"^^ . "cut-open oocyte voltage clamp recording evidence used in automatic assertion"^^ . _:genid6979 . _:genid6979 . _:genid6979 . _:genid6979 . _:genid6979 "true"^^ . _:genid6980 . _:genid6980 . _:genid6980 . _:genid6980 . _:genid6980 "true"^^ . _:genid6981 . _:genid6981 . _:genid6981 . _:genid6981 "A type of cut-open oocyte voltage clamp recording evidence that is used in an automatic assertion."^^ . _:genid6981 "ECO:RCT"^^ . . _:genid6982 . _:genid6983 . _:genid6985 _:genid6984 . _:genid6983 _:genid6985 . _:genid6984 . _:genid6984 . _:genid6984 . _:genid6985 . _:genid6982 _:genid6983 . _:genid6982 . . . "IEA"^^ . "A type of macropatch voltage clamp recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007286"^^ . "macropatch voltage clamp recording evidence used in automatic assertion"^^ . _:genid6986 . _:genid6986 . _:genid6986 . _:genid6986 . _:genid6986 "true"^^ . _:genid6987 . _:genid6987 . _:genid6987 . _:genid6987 . _:genid6987 "true"^^ . _:genid6988 . _:genid6988 . _:genid6988 . _:genid6988 "A type of macropatch voltage clamp recording evidence that is used in an automatic assertion."^^ . _:genid6988 "ECO:RCT"^^ . . _:genid6989 . _:genid6990 . _:genid6992 _:genid6991 . _:genid6990 _:genid6992 . _:genid6991 . _:genid6991 . _:genid6991 . _:genid6992 . _:genid6989 _:genid6990 . _:genid6989 . . . "IEA"^^ . "A type of protein mass spectrometry evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007288"^^ . "protein mass spectrometry evidence used in automatic assertion"^^ . _:genid6993 . _:genid6993 . _:genid6993 . _:genid6993 . _:genid6993 "true"^^ . _:genid6994 . _:genid6994 . _:genid6994 . _:genid6994 . _:genid6994 "true"^^ . _:genid6995 . _:genid6995 . _:genid6995 . _:genid6995 "A type of protein mass spectrometry evidence that is used in an automatic assertion."^^ . _:genid6995 "ECO:RCT"^^ . . _:genid6996 . _:genid6997 . _:genid6999 _:genid6998 . _:genid6997 _:genid6999 . _:genid6998 . _:genid6998 . _:genid6998 . _:genid6999 . _:genid6996 _:genid6997 . _:genid6996 . . . "IEA"^^ . "A type of cross-streak test evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007289"^^ . "cross-streak test evidence used in automatic assertion"^^ . _:genid7000 . _:genid7000 . _:genid7000 . _:genid7000 . _:genid7000 "true"^^ . _:genid7001 . _:genid7001 . _:genid7001 . _:genid7001 . _:genid7001 "true"^^ . _:genid7002 . _:genid7002 . _:genid7002 . _:genid7002 "A type of cross-streak test evidence that is used in an automatic assertion."^^ . _:genid7002 "ECO:RCT"^^ . . _:genid7003 . _:genid7004 . _:genid7006 _:genid7005 . _:genid7004 _:genid7006 . _:genid7005 . _:genid7005 . _:genid7005 . _:genid7006 . _:genid7003 _:genid7004 . _:genid7003 . . . "IEA"^^ . "A type of tethered cell assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007290"^^ . "tethered cell assay evidence used in automatic assertion"^^ . _:genid7007 . _:genid7007 . _:genid7007 . _:genid7007 . _:genid7007 "true"^^ . _:genid7008 . _:genid7008 . _:genid7008 . _:genid7008 . _:genid7008 "true"^^ . _:genid7009 . _:genid7009 . _:genid7009 . _:genid7009 "A type of tethered cell assay evidence that is used in an automatic assertion."^^ . _:genid7009 "ECO:RCT"^^ . . _:genid7010 . _:genid7011 . _:genid7013 _:genid7012 . _:genid7011 _:genid7013 . _:genid7012 . _:genid7012 . _:genid7012 . _:genid7013 . _:genid7010 _:genid7011 . _:genid7010 . . . "IEA"^^ . "A type of tumble frequency assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007291"^^ . "tumble frequency assay evidence used in automatic assertion"^^ . _:genid7014 . _:genid7014 . _:genid7014 . _:genid7014 . _:genid7014 "true"^^ . _:genid7015 . _:genid7015 . _:genid7015 . _:genid7015 . _:genid7015 "true"^^ . _:genid7016 . _:genid7016 . _:genid7016 . _:genid7016 "A type of tumble frequency assay evidence that is used in an automatic assertion."^^ . _:genid7016 "ECO:RCT"^^ . . _:genid7017 . _:genid7018 . _:genid7020 _:genid7019 . _:genid7018 _:genid7020 . _:genid7019 . _:genid7019 . _:genid7019 . _:genid7020 . _:genid7017 _:genid7018 . _:genid7017 . . . "IEA"^^ . "A type of capillary assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007292"^^ . "capillary assay evidence used in automatic assertion"^^ . _:genid7021 . _:genid7021 . _:genid7021 . _:genid7021 . _:genid7021 "true"^^ . _:genid7022 . _:genid7022 . _:genid7022 . _:genid7022 . _:genid7022 "true"^^ . _:genid7023 . _:genid7023 . _:genid7023 . _:genid7023 "A type of capillary assay evidence that is used in an automatic assertion."^^ . _:genid7023 "ECO:RCT"^^ . . "A type of inference from experimental data evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007293"^^ . "inference from experimental data evidence used in automatic assertion"^^ . "true"^^ . _:genid7024 . _:genid7024 . _:genid7024 . _:genid7024 "A type of inference from experimental data evidence that is used in an automatic assertion."^^ . _:genid7024 "ECO:RCT"^^ . . "A type of inference from phenotype manipulation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007294"^^ . "inference from phenotype manipulation evidence used in automatic assertion"^^ . "true"^^ . _:genid7025 . _:genid7025 . _:genid7025 . _:genid7025 "A type of inference from phenotype manipulation evidence that is used in an automatic assertion."^^ . _:genid7025 "ECO:RCT"^^ . . _:genid7026 . _:genid7027 . _:genid7029 _:genid7028 . _:genid7027 _:genid7029 . _:genid7028 . _:genid7028 . _:genid7028 . _:genid7029 . _:genid7026 _:genid7027 . _:genid7026 . . . . "EXP"^^ . "IEA"^^ . "A type of inference by association of genotype from phenotype that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007295"^^ . "inference by association of genotype from phenotype used in automatic assertion"^^ . _:genid7030 . _:genid7030 . _:genid7030 . _:genid7030 . _:genid7030 "true"^^ . _:genid7031 . _:genid7031 . _:genid7031 . _:genid7031 . _:genid7031 "true"^^ . _:genid7032 . _:genid7032 . _:genid7032 . _:genid7032 . _:genid7032 "true"^^ . _:genid7033 . _:genid7033 . _:genid7033 . _:genid7033 "A type of inference by association of genotype from phenotype that is used in an automatic assertion."^^ . _:genid7033 "ECO:RCT"^^ . . _:genid7034 . _:genid7035 . _:genid7037 _:genid7036 . _:genid7035 _:genid7037 . _:genid7036 . _:genid7036 . _:genid7036 . _:genid7037 . _:genid7034 _:genid7035 . _:genid7034 . . . "IEA"^^ . "A type of motility assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007296"^^ . "motility assay evidence used in automatic assertion"^^ . _:genid7038 . _:genid7038 . _:genid7038 . _:genid7038 . _:genid7038 "true"^^ . _:genid7039 . _:genid7039 . _:genid7039 . _:genid7039 . _:genid7039 "true"^^ . _:genid7040 . _:genid7040 . _:genid7040 . _:genid7040 "A type of motility assay evidence that is used in an automatic assertion."^^ . _:genid7040 "ECO:RCT"^^ . . _:genid7041 . _:genid7042 . _:genid7044 _:genid7043 . _:genid7042 _:genid7044 . _:genid7043 . _:genid7043 . _:genid7043 . _:genid7044 . _:genid7041 _:genid7042 . _:genid7041 . . . "IEA"^^ . "A type of experimental evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007297"^^ . "experimental evidence used in automatic assertion"^^ . _:genid7045 . _:genid7045 . _:genid7045 . _:genid7045 . _:genid7045 "true"^^ . _:genid7046 . _:genid7046 . _:genid7046 . _:genid7046 . _:genid7046 "true"^^ . _:genid7047 . _:genid7047 . _:genid7047 . _:genid7047 "A type of experimental evidence that is used in an automatic assertion."^^ . _:genid7047 "ECO:RCT"^^ . . _:genid7048 . _:genid7049 . _:genid7051 _:genid7050 . _:genid7049 _:genid7051 . _:genid7050 . _:genid7050 . _:genid7050 . _:genid7051 . _:genid7048 _:genid7049 . _:genid7048 . . . "IEA"^^ . "A type of expression pattern evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007298"^^ . "expression pattern evidence used in automatic assertion"^^ . _:genid7052 . _:genid7052 . _:genid7052 . _:genid7052 . _:genid7052 "true"^^ . _:genid7053 . _:genid7053 . _:genid7053 . _:genid7053 . _:genid7053 "true"^^ . _:genid7054 . _:genid7054 . _:genid7054 . _:genid7054 "A type of expression pattern evidence that is used in an automatic assertion."^^ . _:genid7054 "ECO:RCT"^^ . . _:genid7055 . _:genid7056 . _:genid7058 _:genid7057 . _:genid7056 _:genid7058 . _:genid7057 . _:genid7057 . _:genid7057 . _:genid7058 . _:genid7055 _:genid7056 . _:genid7055 . . . "IEA"^^ . "A type of Affymetrix GeneChip evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007299"^^ . "Affymetrix GeneChip evidence used in automatic assertion"^^ . _:genid7059 . _:genid7059 . _:genid7059 . _:genid7059 . _:genid7059 "true"^^ . _:genid7060 . _:genid7060 . _:genid7060 . _:genid7060 . _:genid7060 "true"^^ . _:genid7061 . _:genid7061 . _:genid7061 . _:genid7061 "A type of Affymetrix GeneChip evidence that is used in an automatic assertion."^^ . _:genid7061 "ECO:RCT"^^ . . _:genid7062 . _:genid7063 . _:genid7065 _:genid7064 . _:genid7063 _:genid7065 . _:genid7064 . _:genid7064 . _:genid7064 . _:genid7065 . _:genid7062 _:genid7063 . _:genid7062 . . . "IEA"^^ . "A type of cRNA to DNA expression microarray evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007300"^^ . "cRNA to DNA expression microarray evidence used in automatic assertion"^^ . _:genid7066 . _:genid7066 . _:genid7066 . _:genid7066 . _:genid7066 "true"^^ . _:genid7067 . _:genid7067 . _:genid7067 . _:genid7067 . _:genid7067 "true"^^ . _:genid7068 . _:genid7068 . _:genid7068 . _:genid7068 "A type of cRNA to DNA expression microarray evidence that is used in an automatic assertion."^^ . _:genid7068 "ECO:RCT"^^ . . _:genid7069 . _:genid7070 . _:genid7072 _:genid7071 . _:genid7070 _:genid7072 . _:genid7071 . _:genid7071 . _:genid7071 . _:genid7072 . _:genid7069 _:genid7070 . _:genid7069 . . . "IEA"^^ . "A type of expression microarray evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007301"^^ . "expression microarray evidence used in automatic assertion"^^ . _:genid7073 . _:genid7073 . _:genid7073 . _:genid7073 . _:genid7073 "true"^^ . _:genid7074 . _:genid7074 . _:genid7074 . _:genid7074 . _:genid7074 "true"^^ . _:genid7075 . _:genid7075 . _:genid7075 . _:genid7075 "A type of expression microarray evidence that is used in an automatic assertion."^^ . _:genid7075 "ECO:RCT"^^ . . _:genid7076 . _:genid7077 . _:genid7079 _:genid7078 . _:genid7077 _:genid7079 . _:genid7078 . _:genid7078 . _:genid7078 . _:genid7079 . _:genid7076 _:genid7077 . _:genid7076 . . . "IEA"^^ . "A type of differential methylation hybridization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007302"^^ . "differential methylation hybridization evidence used in automatic assertion"^^ . _:genid7080 . _:genid7080 . _:genid7080 . _:genid7080 . _:genid7080 "true"^^ . _:genid7081 . _:genid7081 . _:genid7081 . _:genid7081 . _:genid7081 "true"^^ . _:genid7082 . _:genid7082 . _:genid7082 . _:genid7082 "A type of differential methylation hybridization evidence that is used in an automatic assertion."^^ . _:genid7082 "ECO:RCT"^^ . . _:genid7083 . _:genid7084 . _:genid7086 _:genid7085 . _:genid7084 _:genid7086 . _:genid7085 . _:genid7085 . _:genid7085 . _:genid7086 . _:genid7083 _:genid7084 . _:genid7083 . . . "IEA"^^ . "A type of transcript expression evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "transcriptomics evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007303"^^ . "transcript expression evidence used in automatic assertion"^^ . _:genid7087 . _:genid7087 . _:genid7087 . _:genid7087 . _:genid7087 "true"^^ . _:genid7088 . _:genid7088 . _:genid7088 . _:genid7088 . _:genid7088 "true"^^ . _:genid7089 . _:genid7089 . _:genid7089 . _:genid7089 "A type of transcript expression evidence that is used in an automatic assertion."^^ . _:genid7089 "ECO:RCT"^^ . . _:genid7090 . _:genid7091 . _:genid7093 _:genid7092 . _:genid7091 _:genid7093 . _:genid7092 . _:genid7092 . _:genid7092 . _:genid7093 . _:genid7090 _:genid7091 . _:genid7090 . . . "IEA"^^ . "A type of Nimblegen array evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007304"^^ . "Nimblegen array evidence used in automatic assertion"^^ . _:genid7094 . _:genid7094 . _:genid7094 . _:genid7094 . _:genid7094 "true"^^ . _:genid7095 . _:genid7095 . _:genid7095 . _:genid7095 . _:genid7095 "true"^^ . _:genid7096 . _:genid7096 . _:genid7096 . _:genid7096 "A type of Nimblegen array evidence that is used in an automatic assertion."^^ . _:genid7096 "ECO:RCT"^^ . . _:genid7097 . _:genid7098 . _:genid7100 _:genid7099 . _:genid7098 _:genid7100 . _:genid7099 . _:genid7099 . _:genid7099 . _:genid7100 . _:genid7097 _:genid7098 . _:genid7097 . . . "IEA"^^ . "A type of array-based sequence capture evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007305"^^ . "array-based sequence capture evidence used in automatic assertion"^^ . _:genid7101 . _:genid7101 . _:genid7101 . _:genid7101 . _:genid7101 "true"^^ . _:genid7102 . _:genid7102 . _:genid7102 . _:genid7102 . _:genid7102 "true"^^ . _:genid7103 . _:genid7103 . _:genid7103 . _:genid7103 "A type of array-based sequence capture evidence that is used in an automatic assertion."^^ . _:genid7103 "ECO:RCT"^^ . . _:genid7104 . _:genid7105 . _:genid7107 _:genid7106 . _:genid7105 _:genid7107 . _:genid7106 . _:genid7106 . _:genid7106 . _:genid7107 . _:genid7104 _:genid7105 . _:genid7104 . . . . . "IEA"^^ . "A type of qualitative western immunoblotting evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "ECO:0007287"^^ . "protein expression level evidence based on western blot used in automatic assertion"^^ . "eco"^^ . "ECO:0007306"^^ . "qualitative western immunoblotting evidence used in automatic assertion"^^ . _:genid7108 . _:genid7108 . _:genid7108 . _:genid7108 . _:genid7108 "true"^^ . _:genid7109 . _:genid7109 . _:genid7109 . _:genid7109 . _:genid7109 "true"^^ . _:genid7110 . _:genid7110 . _:genid7110 . _:genid7110 . _:genid7110 "true"^^ . _:genid7111 . _:genid7111 . _:genid7111 . _:genid7111 . _:genid7111 "true"^^ . _:genid7112 . _:genid7112 . _:genid7112 . _:genid7112 "A type of qualitative western immunoblotting evidence that is used in an automatic assertion."^^ . _:genid7112 "ECO:RCT"^^ . . _:genid7113 . _:genid7114 . _:genid7116 _:genid7115 . _:genid7114 _:genid7116 . _:genid7115 . _:genid7115 . _:genid7115 . _:genid7116 . _:genid7113 _:genid7114 . _:genid7113 . . . "IEA"^^ . "A type of direct assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007307"^^ . "direct assay evidence used in automatic assertion"^^ . _:genid7117 . _:genid7117 . _:genid7117 . _:genid7117 . _:genid7117 "true"^^ . _:genid7118 . _:genid7118 . _:genid7118 . _:genid7118 . _:genid7118 "true"^^ . _:genid7119 . _:genid7119 . _:genid7119 . _:genid7119 "A type of direct assay evidence that is used in an automatic assertion."^^ . _:genid7119 "ECO:RCT"^^ . . _:genid7120 . _:genid7121 . _:genid7123 _:genid7122 . _:genid7121 _:genid7123 . _:genid7122 . _:genid7122 . _:genid7122 . _:genid7123 . _:genid7120 _:genid7121 . _:genid7120 . . . "IEA"^^ . "A type of protein expression evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "ECO:0007308"^^ . "protein expression level evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007309"^^ . "protein expression evidence used in automatic assertion"^^ . _:genid7124 . _:genid7124 . _:genid7124 . _:genid7124 . _:genid7124 "true"^^ . _:genid7125 . _:genid7125 . _:genid7125 . _:genid7125 . _:genid7125 "true"^^ . _:genid7126 . _:genid7126 . _:genid7126 . _:genid7126 "A type of protein expression evidence that is used in an automatic assertion."^^ . _:genid7126 "ECO:RCT"^^ . . _:genid7127 . _:genid7128 . _:genid7130 _:genid7129 . _:genid7128 _:genid7130 . _:genid7129 . _:genid7129 . _:genid7129 . _:genid7130 . _:genid7127 _:genid7128 . _:genid7127 . . . "IEA"^^ . "A type of expression library screen evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007310"^^ . "expression library screen evidence used in automatic assertion"^^ . _:genid7131 . _:genid7131 . _:genid7131 . _:genid7131 . _:genid7131 "true"^^ . _:genid7132 . _:genid7132 . _:genid7132 . _:genid7132 . _:genid7132 "true"^^ . _:genid7133 . _:genid7133 . _:genid7133 . _:genid7133 "A type of expression library screen evidence that is used in an automatic assertion."^^ . _:genid7133 "ECO:RCT"^^ . . _:genid7134 . _:genid7135 . _:genid7137 _:genid7136 . _:genid7135 _:genid7137 . _:genid7136 . _:genid7136 . _:genid7136 . _:genid7137 . _:genid7134 _:genid7135 . _:genid7134 . . . "IEA"^^ . "A type of heterologous protein expression evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007311"^^ . "heterologous protein expression evidence used in automatic assertion"^^ . _:genid7138 . _:genid7138 . _:genid7138 . _:genid7138 . _:genid7138 "true"^^ . _:genid7139 . _:genid7139 . _:genid7139 . _:genid7139 . _:genid7139 "true"^^ . _:genid7140 . _:genid7140 . _:genid7140 . _:genid7140 "A type of heterologous protein expression evidence that is used in an automatic assertion."^^ . _:genid7140 "ECO:RCT"^^ . . _:genid7141 . _:genid7142 . _:genid7144 _:genid7143 . _:genid7142 _:genid7144 . _:genid7143 . _:genid7143 . _:genid7143 . _:genid7144 . _:genid7141 _:genid7142 . _:genid7141 . . . "IEA"^^ . "A type of spatial pattern of protein expression evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007312"^^ . "spatial pattern of protein expression evidence used in automatic assertion"^^ . _:genid7145 . _:genid7145 . _:genid7145 . _:genid7145 . _:genid7145 "true"^^ . _:genid7146 . _:genid7146 . _:genid7146 . _:genid7146 . _:genid7146 "true"^^ . _:genid7147 . _:genid7147 . _:genid7147 . _:genid7147 "A type of spatial pattern of protein expression evidence that is used in an automatic assertion."^^ . _:genid7147 "ECO:RCT"^^ . . _:genid7148 . _:genid7149 . _:genid7151 _:genid7150 . _:genid7149 _:genid7151 . _:genid7150 . _:genid7150 . _:genid7150 . _:genid7151 . _:genid7148 _:genid7149 . _:genid7148 . . . "IEA"^^ . "A type of DNA to cDNA expression microarray evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007313"^^ . "DNA to cDNA expression microarray evidence used in automatic assertion"^^ . _:genid7152 . _:genid7152 . _:genid7152 . _:genid7152 . _:genid7152 "true"^^ . _:genid7153 . _:genid7153 . _:genid7153 . _:genid7153 . _:genid7153 "true"^^ . _:genid7154 . _:genid7154 . _:genid7154 . _:genid7154 "A type of DNA to cDNA expression microarray evidence that is used in an automatic assertion."^^ . _:genid7154 "ECO:RCT"^^ . . _:genid7155 . _:genid7156 . _:genid7158 _:genid7157 . _:genid7156 _:genid7158 . _:genid7157 . _:genid7157 . _:genid7157 . _:genid7158 . _:genid7155 _:genid7156 . _:genid7155 . . . "IEA"^^ . "A type of differential hybridization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007314"^^ . "differential hybridization evidence used in automatic assertion"^^ . _:genid7159 . _:genid7159 . _:genid7159 . _:genid7159 . _:genid7159 "true"^^ . _:genid7160 . _:genid7160 . _:genid7160 . _:genid7160 . _:genid7160 "true"^^ . _:genid7161 . _:genid7161 . _:genid7161 . _:genid7161 "A type of differential hybridization evidence that is used in an automatic assertion."^^ . _:genid7161 "ECO:RCT"^^ . . _:genid7162 . _:genid7163 . _:genid7165 _:genid7164 . _:genid7163 _:genid7165 . _:genid7164 . _:genid7164 . _:genid7164 . _:genid7165 . _:genid7162 _:genid7163 . _:genid7162 . . . "IEA"^^ . "A type of RNA protection assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007315"^^ . "RNA protection assay evidence used in automatic assertion"^^ . _:genid7166 . _:genid7166 . _:genid7166 . _:genid7166 . _:genid7166 "true"^^ . _:genid7167 . _:genid7167 . _:genid7167 . _:genid7167 . _:genid7167 "true"^^ . _:genid7168 . _:genid7168 . _:genid7168 . _:genid7168 "A type of RNA protection assay evidence that is used in an automatic assertion."^^ . _:genid7168 "ECO:RCT"^^ . . _:genid7169 . _:genid7170 . _:genid7172 _:genid7171 . _:genid7170 _:genid7172 . _:genid7171 . _:genid7171 . _:genid7171 . _:genid7172 . _:genid7169 _:genid7170 . _:genid7169 . . . "IEA"^^ . "A type of nuclease protection assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007316"^^ . "nuclease protection assay evidence used in automatic assertion"^^ . _:genid7173 . _:genid7173 . _:genid7173 . _:genid7173 . _:genid7173 "true"^^ . _:genid7174 . _:genid7174 . _:genid7174 . _:genid7174 . _:genid7174 "true"^^ . _:genid7175 . _:genid7175 . _:genid7175 . _:genid7175 "A type of nuclease protection assay evidence that is used in an automatic assertion."^^ . _:genid7175 "ECO:RCT"^^ . . _:genid7176 . _:genid7177 . _:genid7179 _:genid7178 . _:genid7177 _:genid7179 . _:genid7178 . _:genid7178 . _:genid7178 . _:genid7179 . _:genid7176 _:genid7177 . _:genid7176 . . . "IEA"^^ . "A type of spatial pattern of transcript expression evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007317"^^ . "spatial pattern of transcript expression evidence used in automatic assertion"^^ . _:genid7180 . _:genid7180 . _:genid7180 . _:genid7180 . _:genid7180 "true"^^ . _:genid7181 . _:genid7181 . _:genid7181 . _:genid7181 . _:genid7181 "true"^^ . _:genid7182 . _:genid7182 . _:genid7182 . _:genid7182 "A type of spatial pattern of transcript expression evidence that is used in an automatic assertion."^^ . _:genid7182 "ECO:RCT"^^ . . _:genid7183 . _:genid7184 . _:genid7186 _:genid7185 . _:genid7184 _:genid7186 . _:genid7185 . _:genid7185 . _:genid7185 . _:genid7186 . _:genid7183 _:genid7184 . _:genid7183 . . . "IEA"^^ . "A type of subtractive hybridization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007318"^^ . "subtractive hybridization evidence used in automatic assertion"^^ . _:genid7187 . _:genid7187 . _:genid7187 . _:genid7187 . _:genid7187 "true"^^ . _:genid7188 . _:genid7188 . _:genid7188 . _:genid7188 . _:genid7188 "true"^^ . _:genid7189 . _:genid7189 . _:genid7189 . _:genid7189 "A type of subtractive hybridization evidence that is used in an automatic assertion."^^ . _:genid7189 "ECO:RCT"^^ . . _:genid7190 . _:genid7191 . _:genid7193 _:genid7192 . _:genid7191 _:genid7193 . _:genid7192 . _:genid7192 . _:genid7192 . _:genid7193 . _:genid7190 _:genid7191 . _:genid7190 . . . "IEA"^^ . "A type of author statement that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007319"^^ . "author statement used in automatic assertion"^^ . _:genid7194 . _:genid7194 . _:genid7194 . _:genid7194 . _:genid7194 "true"^^ . _:genid7195 . _:genid7195 . _:genid7195 . _:genid7195 . _:genid7195 "true"^^ . _:genid7196 . _:genid7196 . _:genid7196 . _:genid7196 "A type of author statement that is used in an automatic assertion."^^ . _:genid7196 "ECO:RCT"^^ . . _:genid7197 . _:genid7198 . _:genid7200 _:genid7199 . _:genid7198 _:genid7200 . _:genid7199 . _:genid7199 . _:genid7199 . _:genid7200 . _:genid7197 _:genid7198 . _:genid7197 . . . "IEA"^^ . "A type of author statement without traceable support that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "non-traceable author statement used in automatic assertion"^^ . "ECO:0007320"^^ . "author statement without traceable support used in automatic assertion"^^ . _:genid7201 . _:genid7201 . _:genid7201 . _:genid7201 . _:genid7201 "true"^^ . _:genid7202 . _:genid7202 . _:genid7202 . _:genid7202 . _:genid7202 "true"^^ . _:genid7203 . _:genid7203 . _:genid7203 . _:genid7203 "A type of author statement without traceable support that is used in an automatic assertion."^^ . _:genid7203 "ECO:RCT"^^ . . _:genid7204 . _:genid7205 . _:genid7207 _:genid7206 . _:genid7205 _:genid7207 . _:genid7206 . _:genid7206 . _:genid7206 . _:genid7207 . _:genid7204 _:genid7205 . _:genid7204 . . . "IEA"^^ . "A type of author statement supported by traceable reference that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "traceable author statement used in automatic assertion"^^ . "ECO:0007321"^^ . "author statement supported by traceable reference used in automatic assertion"^^ . _:genid7208 . _:genid7208 . _:genid7208 . _:genid7208 . _:genid7208 "true"^^ . _:genid7209 . _:genid7209 . _:genid7209 . _:genid7209 . _:genid7209 "true"^^ . _:genid7210 . _:genid7210 . _:genid7210 . _:genid7210 "A type of author statement supported by traceable reference that is used in an automatic assertion."^^ . _:genid7210 "ECO:RCT"^^ . . _:genid7211 . _:genid7212 . _:genid7214 _:genid7213 . _:genid7212 _:genid7214 . _:genid7213 . _:genid7213 . _:genid7213 . _:genid7214 . _:genid7211 _:genid7212 . _:genid7211 . . . "IEA"^^ . "A type of curator inference that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007322"^^ . "curator inference used in automatic assertion"^^ . _:genid7215 . _:genid7215 . _:genid7215 . _:genid7215 . _:genid7215 "true"^^ . _:genid7216 . _:genid7216 . _:genid7216 . _:genid7216 . _:genid7216 "true"^^ . _:genid7217 . _:genid7217 . _:genid7217 . _:genid7217 "A type of curator inference that is used in an automatic assertion."^^ . _:genid7217 "ECO:RCT"^^ . . _:genid7218 . _:genid7219 . _:genid7221 _:genid7220 . _:genid7219 _:genid7221 . _:genid7220 . _:genid7220 . _:genid7220 . _:genid7221 . _:genid7218 _:genid7219 . _:genid7218 . . . "IEA"^^ . "A type of inference from background scientific knowledge that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007323"^^ . "inference from background scientific knowledge used in automatic assertion"^^ . _:genid7222 . _:genid7222 . _:genid7222 . _:genid7222 . _:genid7222 "true"^^ . _:genid7223 . _:genid7223 . _:genid7223 . _:genid7223 . _:genid7223 "true"^^ . _:genid7224 . _:genid7224 . _:genid7224 . _:genid7224 "A type of inference from background scientific knowledge that is used in an automatic assertion."^^ . _:genid7224 "ECO:RCT"^^ . . _:genid7225 . _:genid7226 . _:genid7228 _:genid7227 . _:genid7226 _:genid7228 . _:genid7227 . _:genid7227 . _:genid7227 . _:genid7228 . _:genid7225 _:genid7226 . _:genid7225 . . . "IEA"^^ . "An inference that results when research finds no evidence information in the scientific literature, at reference databases, or from other resources that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007324"^^ . "no evidence data found used in automatic assertion"^^ . _:genid7229 . _:genid7229 . _:genid7229 . _:genid7229 . _:genid7229 "true"^^ . _:genid7230 . _:genid7230 . _:genid7230 . _:genid7230 . _:genid7230 "true"^^ . _:genid7231 . _:genid7231 . _:genid7231 . _:genid7231 "An inference that results when research finds no evidence information in the scientific literature, at reference databases, or from other resources that is used in an automatic assertion."^^ . _:genid7231 "ECO:RCT"^^ . . _:genid7232 . _:genid7233 . _:genid7235 _:genid7234 . _:genid7233 _:genid7235 . _:genid7234 . _:genid7234 . _:genid7234 . _:genid7235 . _:genid7232 _:genid7233 . _:genid7232 . . . "IEA"^^ . "A type of mutant phenotype evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007325"^^ . "mutant phenotype evidence used in automatic assertion"^^ . _:genid7236 . _:genid7236 . _:genid7236 . _:genid7236 . _:genid7236 "true"^^ . _:genid7237 . _:genid7237 . _:genid7237 . _:genid7237 . _:genid7237 "true"^^ . _:genid7238 . _:genid7238 . _:genid7238 . _:genid7238 "A type of mutant phenotype evidence that is used in an automatic assertion."^^ . _:genid7238 "ECO:RCT"^^ . . _:genid7239 . _:genid7240 . _:genid7242 _:genid7241 . _:genid7240 _:genid7242 . _:genid7241 . _:genid7241 . _:genid7241 . _:genid7242 . _:genid7239 _:genid7240 . _:genid7239 . . . "IEA"^^ . "A type of genetic interaction evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007326"^^ . "genetic interaction evidence used in automatic assertion"^^ . _:genid7243 . _:genid7243 . _:genid7243 . _:genid7243 . _:genid7243 "true"^^ . _:genid7244 . _:genid7244 . _:genid7244 . _:genid7244 . _:genid7244 "true"^^ . _:genid7245 . _:genid7245 . _:genid7245 . _:genid7245 "A type of genetic interaction evidence that is used in an automatic assertion."^^ . _:genid7245 "ECO:RCT"^^ . . _:genid7246 . _:genid7247 . _:genid7249 _:genid7248 . _:genid7247 _:genid7249 . _:genid7248 . _:genid7248 . _:genid7248 . _:genid7249 . _:genid7246 _:genid7247 . _:genid7246 . . . "IEA"^^ . "A type of genomic context evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007327"^^ . "genomic context evidence used in automatic assertion"^^ . _:genid7250 . _:genid7250 . _:genid7250 . _:genid7250 . _:genid7250 "true"^^ . _:genid7251 . _:genid7251 . _:genid7251 . _:genid7251 . _:genid7251 "true"^^ . _:genid7252 . _:genid7252 . _:genid7252 . _:genid7252 "A type of genomic context evidence that is used in an automatic assertion."^^ . _:genid7252 "ECO:RCT"^^ . . _:genid7253 . _:genid7254 . _:genid7256 _:genid7255 . _:genid7254 _:genid7256 . _:genid7255 . _:genid7255 . _:genid7255 . _:genid7256 . _:genid7253 _:genid7254 . _:genid7253 . . . "IEA"^^ . "A type of biological aspect of ancestor evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007328"^^ . "biological aspect of ancestor evidence used in automatic assertion"^^ . _:genid7257 . _:genid7257 . _:genid7257 . _:genid7257 . _:genid7257 "true"^^ . _:genid7258 . _:genid7258 . _:genid7258 . _:genid7258 . _:genid7258 "true"^^ . _:genid7259 . _:genid7259 . _:genid7259 . _:genid7259 "A type of biological aspect of ancestor evidence that is used in an automatic assertion."^^ . _:genid7259 "ECO:RCT"^^ . . _:genid7260 . _:genid7261 . _:genid7263 _:genid7262 . _:genid7261 _:genid7263 . _:genid7262 . _:genid7262 . _:genid7262 . _:genid7263 . _:genid7260 _:genid7261 . _:genid7260 . . . "IEA"^^ . "A type of biological aspect of descendant evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007329"^^ . "biological aspect of descendant evidence used in automatic assertion"^^ . _:genid7264 . _:genid7264 . _:genid7264 . _:genid7264 . _:genid7264 "true"^^ . _:genid7265 . _:genid7265 . _:genid7265 . _:genid7265 . _:genid7265 "true"^^ . _:genid7266 . _:genid7266 . _:genid7266 . _:genid7266 "A type of biological aspect of descendant evidence that is used in an automatic assertion."^^ . _:genid7266 "ECO:RCT"^^ . . _:genid7267 . _:genid7268 . _:genid7270 _:genid7269 . _:genid7268 _:genid7270 . _:genid7269 . _:genid7269 . _:genid7269 . _:genid7270 . _:genid7267 _:genid7268 . _:genid7267 . . . "IEA"^^ . "A type of phylogenetic determination of loss of key residues evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007330"^^ . "phylogenetic determination of loss of key residues evidence used in automatic assertion"^^ . _:genid7271 . _:genid7271 . _:genid7271 . _:genid7271 . _:genid7271 "true"^^ . _:genid7272 . _:genid7272 . _:genid7272 . _:genid7272 . _:genid7272 "true"^^ . _:genid7273 . _:genid7273 . _:genid7273 . _:genid7273 "A type of phylogenetic determination of loss of key residues evidence that is used in an automatic assertion."^^ . _:genid7273 "ECO:RCT"^^ . . _:genid7274 . _:genid7275 . _:genid7277 _:genid7276 . _:genid7275 _:genid7277 . _:genid7276 . _:genid7276 . _:genid7276 . _:genid7277 . _:genid7274 _:genid7275 . _:genid7274 . . . "IEA"^^ . "A type of rapid divergence from ancestral sequence evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007331"^^ . "rapid divergence from ancestral sequence evidence used in automatic assertion"^^ . _:genid7278 . _:genid7278 . _:genid7278 . _:genid7278 . _:genid7278 "true"^^ . _:genid7279 . _:genid7279 . _:genid7279 . _:genid7279 . _:genid7279 "true"^^ . _:genid7280 . _:genid7280 . _:genid7280 . _:genid7280 "A type of rapid divergence from ancestral sequence evidence that is used in an automatic assertion."^^ . _:genid7280 "ECO:RCT"^^ . . _:genid7281 . _:genid7282 . _:genid7284 _:genid7283 . _:genid7282 _:genid7284 . _:genid7283 . _:genid7283 . _:genid7283 . _:genid7284 . _:genid7281 _:genid7282 . _:genid7281 . . . "IEA"^^ . "A type of physical interaction evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007332"^^ . "physical interaction evidence used in automatic assertion"^^ . _:genid7285 . _:genid7285 . _:genid7285 . _:genid7285 . _:genid7285 "true"^^ . _:genid7286 . _:genid7286 . _:genid7286 . _:genid7286 . _:genid7286 "true"^^ . _:genid7287 . _:genid7287 . _:genid7287 . _:genid7287 "A type of physical interaction evidence that is used in an automatic assertion."^^ . _:genid7287 "ECO:RCT"^^ . . _:genid7288 . _:genid7289 . _:genid7291 _:genid7290 . _:genid7289 _:genid7291 . _:genid7290 . _:genid7290 . _:genid7290 . _:genid7291 . _:genid7288 _:genid7289 . _:genid7288 . . . "IEA"^^ . "A type of gene neighbors evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007333"^^ . "gene neighbors evidence used in automatic assertion"^^ . _:genid7292 . _:genid7292 . _:genid7292 . _:genid7292 . _:genid7292 "true"^^ . _:genid7293 . _:genid7293 . _:genid7293 . _:genid7293 . _:genid7293 "true"^^ . _:genid7294 . _:genid7294 . _:genid7294 . _:genid7294 "A type of gene neighbors evidence that is used in an automatic assertion."^^ . _:genid7294 "ECO:RCT"^^ . . _:genid7295 . _:genid7296 . _:genid7298 _:genid7297 . _:genid7296 _:genid7298 . _:genid7297 . _:genid7297 . _:genid7297 . _:genid7298 . _:genid7295 _:genid7296 . _:genid7295 . . . "IEA"^^ . "A type of Edman degradation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007334"^^ . "Edman degradation evidence used in automatic assertion"^^ . _:genid7299 . _:genid7299 . _:genid7299 . _:genid7299 . _:genid7299 "true"^^ . _:genid7300 . _:genid7300 . _:genid7300 . _:genid7300 . _:genid7300 "true"^^ . _:genid7301 . _:genid7301 . _:genid7301 . _:genid7301 "A type of Edman degradation evidence that is used in an automatic assertion."^^ . _:genid7301 "ECO:RCT"^^ . . _:genid7302 . _:genid7303 . _:genid7305 _:genid7304 . _:genid7303 _:genid7305 . _:genid7304 . _:genid7304 . _:genid7304 . _:genid7305 . _:genid7302 _:genid7303 . _:genid7302 . . . "IEA"^^ . "A type of 3D cell culture evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007335"^^ . "3D cell culture evidence used in automatic assertion"^^ . _:genid7306 . _:genid7306 . _:genid7306 . _:genid7306 . _:genid7306 "true"^^ . _:genid7307 . _:genid7307 . _:genid7307 . _:genid7307 . _:genid7307 "true"^^ . _:genid7308 . _:genid7308 . _:genid7308 . _:genid7308 "A type of 3D cell culture evidence that is used in an automatic assertion."^^ . _:genid7308 "ECO:RCT"^^ . . _:genid7309 . _:genid7310 . _:genid7312 _:genid7311 . _:genid7310 _:genid7312 . _:genid7311 . _:genid7311 . _:genid7311 . _:genid7312 . _:genid7309 _:genid7310 . _:genid7309 . . . "IEA"^^ . "A type of 51Cr release assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007336"^^ . "51Cr release assay evidence used in automatic assertion"^^ . _:genid7313 . _:genid7313 . _:genid7313 . _:genid7313 . _:genid7313 "true"^^ . _:genid7314 . _:genid7314 . _:genid7314 . _:genid7314 . _:genid7314 "true"^^ . _:genid7315 . _:genid7315 . _:genid7315 . _:genid7315 "A type of 51Cr release assay evidence that is used in an automatic assertion."^^ . _:genid7315 "ECO:RCT"^^ . . _:genid7316 . _:genid7317 . _:genid7319 _:genid7318 . _:genid7317 _:genid7319 . _:genid7318 . _:genid7318 . _:genid7318 . _:genid7319 . _:genid7316 _:genid7317 . _:genid7316 . . . "IEA"^^ . "A type of 7-aminoactinomycin staining evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007337"^^ . "7-aminoactinomycin staining evidence used in automatic assertion"^^ . _:genid7320 . _:genid7320 . _:genid7320 . _:genid7320 . _:genid7320 "true"^^ . _:genid7321 . _:genid7321 . _:genid7321 . _:genid7321 . _:genid7321 "true"^^ . _:genid7322 . _:genid7322 . _:genid7322 . _:genid7322 "A type of 7-aminoactinomycin staining evidence that is used in an automatic assertion."^^ . _:genid7322 "ECO:RCT"^^ . . _:genid7323 . _:genid7324 . _:genid7326 _:genid7325 . _:genid7324 _:genid7326 . _:genid7325 . _:genid7325 . _:genid7325 . _:genid7326 . _:genid7323 _:genid7324 . _:genid7323 . . . "IEA"^^ . "A type of [3H]-thymidine incorporation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007338"^^ . "[3H]-thymidine incorporation assay evidence used in automatic assertion"^^ . _:genid7327 . _:genid7327 . _:genid7327 . _:genid7327 . _:genid7327 "true"^^ . _:genid7328 . _:genid7328 . _:genid7328 . _:genid7328 . _:genid7328 "true"^^ . _:genid7329 . _:genid7329 . _:genid7329 . _:genid7329 "A type of [3H]-thymidine incorporation assay evidence that is used in an automatic assertion."^^ . _:genid7329 "ECO:RCT"^^ . . _:genid7330 . _:genid7331 . _:genid7333 _:genid7332 . _:genid7331 _:genid7333 . _:genid7332 . _:genid7332 . _:genid7332 . _:genid7333 . _:genid7330 _:genid7331 . _:genid7330 . . . "IEA"^^ . "A type of [3H]arachidonic acid release assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007339"^^ . "[3H]arachidonic acid release assay evidence used in automatic assertion"^^ . _:genid7334 . _:genid7334 . _:genid7334 . _:genid7334 . _:genid7334 "true"^^ . _:genid7335 . _:genid7335 . _:genid7335 . _:genid7335 . _:genid7335 "true"^^ . _:genid7336 . _:genid7336 . _:genid7336 . _:genid7336 "A type of [3H]arachidonic acid release assay evidence that is used in an automatic assertion."^^ . _:genid7336 "ECO:RCT"^^ . . _:genid7337 . _:genid7338 . _:genid7340 _:genid7339 . _:genid7338 _:genid7340 . _:genid7339 . _:genid7339 . _:genid7339 . _:genid7340 . _:genid7337 _:genid7338 . _:genid7337 . . . "IEA"^^ . "A type of adhesion assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007340"^^ . "adhesion assay evidence used in automatic assertion"^^ . _:genid7341 . _:genid7341 . _:genid7341 . _:genid7341 . _:genid7341 "true"^^ . _:genid7342 . _:genid7342 . _:genid7342 . _:genid7342 . _:genid7342 "true"^^ . _:genid7343 . _:genid7343 . _:genid7343 . _:genid7343 "A type of adhesion assay evidence that is used in an automatic assertion."^^ . _:genid7343 "ECO:RCT"^^ . . _:genid7344 . _:genid7345 . _:genid7347 _:genid7346 . _:genid7345 _:genid7347 . _:genid7346 . _:genid7346 . _:genid7346 . _:genid7347 . _:genid7344 _:genid7345 . _:genid7344 . . . "IEA"^^ . "A type of adoptive cell transfer evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007341"^^ . "adoptive cell transfer evidence used in automatic assertion"^^ . _:genid7348 . _:genid7348 . _:genid7348 . _:genid7348 . _:genid7348 "true"^^ . _:genid7349 . _:genid7349 . _:genid7349 . _:genid7349 . _:genid7349 "true"^^ . _:genid7350 . _:genid7350 . _:genid7350 . _:genid7350 "A type of adoptive cell transfer evidence that is used in an automatic assertion."^^ . _:genid7350 "ECO:RCT"^^ . . _:genid7351 . _:genid7352 . _:genid7354 _:genid7353 . _:genid7352 _:genid7354 . _:genid7353 . _:genid7353 . _:genid7353 . _:genid7354 . _:genid7351 _:genid7352 . _:genid7351 . . . "IEA"^^ . "A type of alamarBlue assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007342"^^ . "alamarBlue assay evidence used in automatic assertion"^^ . _:genid7355 . _:genid7355 . _:genid7355 . _:genid7355 . _:genid7355 "true"^^ . _:genid7356 . _:genid7356 . _:genid7356 . _:genid7356 . _:genid7356 "true"^^ . _:genid7357 . _:genid7357 . _:genid7357 . _:genid7357 "A type of alamarBlue assay evidence that is used in an automatic assertion."^^ . _:genid7357 "ECO:RCT"^^ . . _:genid7358 . _:genid7359 . _:genid7361 _:genid7360 . _:genid7359 _:genid7361 . _:genid7360 . _:genid7360 . _:genid7360 . _:genid7361 . _:genid7358 _:genid7359 . _:genid7358 . . . "IEA"^^ . "A type of allograft transplantation phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "allograft transplantation evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007343"^^ . "allograft transplantation phenotypic evidence used in automatic assertion"^^ . _:genid7362 . _:genid7362 . _:genid7362 . _:genid7362 . _:genid7362 "true"^^ . _:genid7363 . _:genid7363 . _:genid7363 . _:genid7363 . _:genid7363 "true"^^ . _:genid7364 . _:genid7364 . _:genid7364 . _:genid7364 "A type of allograft transplantation phenotypic evidence that is used in an automatic assertion."^^ . _:genid7364 "ECO:RCT"^^ . . _:genid7365 . _:genid7366 . _:genid7368 _:genid7367 . _:genid7366 _:genid7368 . _:genid7367 . _:genid7367 . _:genid7367 . _:genid7368 . _:genid7365 _:genid7366 . _:genid7365 . . . "IEA"^^ . "A type of anion-exchange chromatography evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007344"^^ . "anion-exchange chromatography evidence used in automatic assertion"^^ . _:genid7369 . _:genid7369 . _:genid7369 . _:genid7369 . _:genid7369 "true"^^ . _:genid7370 . _:genid7370 . _:genid7370 . _:genid7370 . _:genid7370 "true"^^ . _:genid7371 . _:genid7371 . _:genid7371 . _:genid7371 "A type of anion-exchange chromatography evidence that is used in an automatic assertion."^^ . _:genid7371 "ECO:RCT"^^ . . _:genid7372 . _:genid7373 . _:genid7375 _:genid7374 . _:genid7373 _:genid7375 . _:genid7374 . _:genid7374 . _:genid7374 . _:genid7375 . _:genid7372 _:genid7373 . _:genid7372 . . . "IEA"^^ . "A type of annexin-V staining evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007345"^^ . "annexin-V staining evidence used in automatic assertion"^^ . _:genid7376 . _:genid7376 . _:genid7376 . _:genid7376 . _:genid7376 "true"^^ . _:genid7377 . _:genid7377 . _:genid7377 . _:genid7377 . _:genid7377 "true"^^ . _:genid7378 . _:genid7378 . _:genid7378 . _:genid7378 "A type of annexin-V staining evidence that is used in an automatic assertion."^^ . _:genid7378 "ECO:RCT"^^ . . _:genid7379 . _:genid7380 . _:genid7382 _:genid7381 . _:genid7380 _:genid7382 . _:genid7381 . _:genid7381 . _:genid7381 . _:genid7382 . _:genid7379 _:genid7380 . _:genid7379 . . . "IEA"^^ . "A type of cognitive assay phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "behavioral assay evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007346"^^ . "cognitive assay phenotypic evidence used in automatic assertion"^^ . _:genid7383 . _:genid7383 . _:genid7383 . _:genid7383 . _:genid7383 "true"^^ . _:genid7384 . _:genid7384 . _:genid7384 . _:genid7384 . _:genid7384 "true"^^ . _:genid7385 . _:genid7385 . _:genid7385 . _:genid7385 "A type of cognitive assay phenotypic evidence that is used in an automatic assertion."^^ . _:genid7385 "ECO:RCT"^^ . . _:genid7386 . _:genid7387 . _:genid7389 _:genid7388 . _:genid7387 _:genid7389 . _:genid7388 . _:genid7388 . _:genid7388 . _:genid7389 . _:genid7386 _:genid7387 . _:genid7386 . . . "IEA"^^ . "A type of blocking monoclonal antibody evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007347"^^ . "blocking monoclonal antibody evidence used in automatic assertion"^^ . _:genid7390 . _:genid7390 . _:genid7390 . _:genid7390 . _:genid7390 "true"^^ . _:genid7391 . _:genid7391 . _:genid7391 . _:genid7391 . _:genid7391 "true"^^ . _:genid7392 . _:genid7392 . _:genid7392 . _:genid7392 "A type of blocking monoclonal antibody evidence that is used in an automatic assertion."^^ . _:genid7392 "ECO:RCT"^^ . . _:genid7393 . _:genid7394 . _:genid7396 _:genid7395 . _:genid7394 _:genid7396 . _:genid7395 . _:genid7395 . _:genid7395 . _:genid7396 . _:genid7393 _:genid7394 . _:genid7393 . . . "IEA"^^ . "A type of immunological assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007348"^^ . "immunological assay evidence used in automatic assertion"^^ . _:genid7397 . _:genid7397 . _:genid7397 . _:genid7397 . _:genid7397 "true"^^ . _:genid7398 . _:genid7398 . _:genid7398 . _:genid7398 . _:genid7398 "true"^^ . _:genid7399 . _:genid7399 . _:genid7399 . _:genid7399 "A type of immunological assay evidence that is used in an automatic assertion."^^ . _:genid7399 "ECO:RCT"^^ . . _:genid7400 . _:genid7401 . _:genid7403 _:genid7402 . _:genid7401 _:genid7403 . _:genid7402 . _:genid7402 . _:genid7402 . _:genid7403 . _:genid7400 _:genid7401 . _:genid7400 . . . "IEA"^^ . "A type of blocking peptide evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007349"^^ . "blocking peptide evidence used in automatic assertion"^^ . _:genid7404 . _:genid7404 . _:genid7404 . _:genid7404 . _:genid7404 "true"^^ . _:genid7405 . _:genid7405 . _:genid7405 . _:genid7405 . _:genid7405 "true"^^ . _:genid7406 . _:genid7406 . _:genid7406 . _:genid7406 "A type of blocking peptide evidence that is used in an automatic assertion."^^ . _:genid7406 "ECO:RCT"^^ . . _:genid7407 . _:genid7408 . _:genid7410 _:genid7409 . _:genid7408 _:genid7410 . _:genid7409 . _:genid7409 . _:genid7409 . _:genid7410 . _:genid7407 _:genid7408 . _:genid7407 . . . "IEA"^^ . "A type of blocking polyclonal antibody evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007350"^^ . "blocking polyclonal antibody evidence used in automatic assertion"^^ . _:genid7411 . _:genid7411 . _:genid7411 . _:genid7411 . _:genid7411 "true"^^ . _:genid7412 . _:genid7412 . _:genid7412 . _:genid7412 . _:genid7412 "true"^^ . _:genid7413 . _:genid7413 . _:genid7413 . _:genid7413 "A type of blocking polyclonal antibody evidence that is used in an automatic assertion."^^ . _:genid7413 "ECO:RCT"^^ . . _:genid7414 . _:genid7415 . _:genid7417 _:genid7416 . _:genid7415 _:genid7417 . _:genid7416 . _:genid7416 . _:genid7416 . _:genid7417 . _:genid7414 _:genid7415 . _:genid7414 . . . "IEA"^^ . "A type of blood test evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007351"^^ . "blood test evidence used in automatic assertion"^^ . _:genid7418 . _:genid7418 . _:genid7418 . _:genid7418 . _:genid7418 "true"^^ . _:genid7419 . _:genid7419 . _:genid7419 . _:genid7419 . _:genid7419 "true"^^ . _:genid7420 . _:genid7420 . _:genid7420 . _:genid7420 "A type of blood test evidence that is used in an automatic assertion."^^ . _:genid7420 "ECO:RCT"^^ . . _:genid7421 . _:genid7422 . _:genid7424 _:genid7423 . _:genid7422 _:genid7424 . _:genid7423 . _:genid7423 . _:genid7423 . _:genid7424 . _:genid7421 _:genid7422 . _:genid7421 . . . "IEA"^^ . "A type of Boyden chamber assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007352"^^ . "Boyden chamber assay evidence used in automatic assertion"^^ . _:genid7425 . _:genid7425 . _:genid7425 . _:genid7425 . _:genid7425 "true"^^ . _:genid7426 . _:genid7426 . _:genid7426 . _:genid7426 . _:genid7426 "true"^^ . _:genid7427 . _:genid7427 . _:genid7427 . _:genid7427 "A type of Boyden chamber assay evidence that is used in an automatic assertion."^^ . _:genid7427 "ECO:RCT"^^ . . _:genid7428 . _:genid7429 . _:genid7431 _:genid7430 . _:genid7429 _:genid7431 . _:genid7430 . _:genid7430 . _:genid7430 . _:genid7431 . _:genid7428 _:genid7429 . _:genid7428 . . . "IEA"^^ . "A type of bromodeoxyuridine incorporation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007353"^^ . "bromodeoxyuridine incorporation assay evidence used in automatic assertion"^^ . _:genid7432 . _:genid7432 . _:genid7432 . _:genid7432 . _:genid7432 "true"^^ . _:genid7433 . _:genid7433 . _:genid7433 . _:genid7433 . _:genid7433 "true"^^ . _:genid7434 . _:genid7434 . _:genid7434 . _:genid7434 "A type of bromodeoxyuridine incorporation assay evidence that is used in an automatic assertion."^^ . _:genid7434 "ECO:RCT"^^ . . _:genid7435 . _:genid7436 . _:genid7438 _:genid7437 . _:genid7436 _:genid7438 . _:genid7437 . _:genid7437 . _:genid7437 . _:genid7438 . _:genid7435 _:genid7436 . _:genid7435 . . . "IEA"^^ . "A type of nucleotide analog incorporation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007354"^^ . "nucleotide analog incorporation assay evidence used in automatic assertion"^^ . _:genid7439 . _:genid7439 . _:genid7439 . _:genid7439 . _:genid7439 "true"^^ . _:genid7440 . _:genid7440 . _:genid7440 . _:genid7440 . _:genid7440 "true"^^ . _:genid7441 . _:genid7441 . _:genid7441 . _:genid7441 "A type of nucleotide analog incorporation assay evidence that is used in an automatic assertion."^^ . _:genid7441 "ECO:RCT"^^ . . _:genid7442 . _:genid7443 . _:genid7445 _:genid7444 . _:genid7443 _:genid7445 . _:genid7444 . _:genid7444 . _:genid7444 . _:genid7445 . _:genid7442 _:genid7443 . _:genid7442 . . . "IEA"^^ . "A type of caspase assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007355"^^ . "caspase assay evidence used in automatic assertion"^^ . _:genid7446 . _:genid7446 . _:genid7446 . _:genid7446 . _:genid7446 "true"^^ . _:genid7447 . _:genid7447 . _:genid7447 . _:genid7447 . _:genid7447 "true"^^ . _:genid7448 . _:genid7448 . _:genid7448 . _:genid7448 "A type of caspase assay evidence that is used in an automatic assertion."^^ . _:genid7448 "ECO:RCT"^^ . . _:genid7449 . _:genid7450 . _:genid7452 _:genid7451 . _:genid7450 _:genid7452 . _:genid7451 . _:genid7451 . _:genid7451 . _:genid7452 . _:genid7449 _:genid7450 . _:genid7449 . . . "IEA"^^ . "A type of cell counting evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007356"^^ . "cell counting evidence used in automatic assertion"^^ . _:genid7453 . _:genid7453 . _:genid7453 . _:genid7453 . _:genid7453 "true"^^ . _:genid7454 . _:genid7454 . _:genid7454 . _:genid7454 . _:genid7454 "true"^^ . _:genid7455 . _:genid7455 . _:genid7455 . _:genid7455 "A type of cell counting evidence that is used in an automatic assertion."^^ . _:genid7455 "ECO:RCT"^^ . . _:genid7456 . _:genid7457 . _:genid7459 _:genid7458 . _:genid7457 _:genid7459 . _:genid7458 . _:genid7458 . _:genid7458 . _:genid7459 . _:genid7456 _:genid7457 . _:genid7456 . . . "IEA"^^ . "A type of cell permeability assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007357"^^ . "cell permeability assay evidence used in automatic assertion"^^ . _:genid7460 . _:genid7460 . _:genid7460 . _:genid7460 . _:genid7460 "true"^^ . _:genid7461 . _:genid7461 . _:genid7461 . _:genid7461 . _:genid7461 "true"^^ . _:genid7462 . _:genid7462 . _:genid7462 . _:genid7462 "A type of cell permeability assay evidence that is used in an automatic assertion."^^ . _:genid7462 "ECO:RCT"^^ . . _:genid7463 . _:genid7464 . _:genid7466 _:genid7465 . _:genid7464 _:genid7466 . _:genid7465 . _:genid7465 . _:genid7465 . _:genid7466 . _:genid7463 _:genid7464 . _:genid7463 . . . "IEA"^^ . "A type of carboxyfluorescein diacetate succinimidyl ester staining evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007358"^^ . "carboxyfluorescein diacetate succinimidyl ester staining evidence used in automatic assertion"^^ . _:genid7467 . _:genid7467 . _:genid7467 . _:genid7467 . _:genid7467 "true"^^ . _:genid7468 . _:genid7468 . _:genid7468 . _:genid7468 . _:genid7468 "true"^^ . _:genid7469 . _:genid7469 . _:genid7469 . _:genid7469 "A type of carboxyfluorescein diacetate succinimidyl ester staining evidence that is used in an automatic assertion."^^ . _:genid7469 "ECO:RCT"^^ . . _:genid7470 . _:genid7471 . _:genid7473 _:genid7472 . _:genid7471 _:genid7473 . _:genid7472 . _:genid7472 . _:genid7472 . _:genid7473 . _:genid7470 _:genid7471 . _:genid7470 . . . "IEA"^^ . "A type of chemiluminescence-linked immunoassay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007359"^^ . "chemiluminescence-linked immunoassay evidence used in automatic assertion"^^ . _:genid7474 . _:genid7474 . _:genid7474 . _:genid7474 . _:genid7474 "true"^^ . _:genid7475 . _:genid7475 . _:genid7475 . _:genid7475 . _:genid7475 "true"^^ . _:genid7476 . _:genid7476 . _:genid7476 . _:genid7476 "A type of chemiluminescence-linked immunoassay evidence that is used in an automatic assertion."^^ . _:genid7476 "ECO:RCT"^^ . . _:genid7477 . _:genid7478 . _:genid7480 _:genid7479 . _:genid7478 _:genid7480 . _:genid7479 . _:genid7479 . _:genid7479 . _:genid7480 . _:genid7477 _:genid7478 . _:genid7477 . . . "IEA"^^ . "A type of chimeric protein phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "chimeric protein evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007360"^^ . "chimeric protein phenotypic evidence used in automatic assertion"^^ . _:genid7481 . _:genid7481 . _:genid7481 . _:genid7481 . _:genid7481 "true"^^ . _:genid7482 . _:genid7482 . _:genid7482 . _:genid7482 . _:genid7482 "true"^^ . _:genid7483 . _:genid7483 . _:genid7483 . _:genid7483 "A type of chimeric protein phenotypic evidence that is used in an automatic assertion."^^ . _:genid7483 "ECO:RCT"^^ . . _:genid7484 . _:genid7485 . _:genid7487 _:genid7486 . _:genid7485 _:genid7487 . _:genid7486 . _:genid7486 . _:genid7486 . _:genid7487 . _:genid7484 _:genid7485 . _:genid7484 . . . "IEA"^^ . "A type of co-electrophoresis evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007361"^^ . "co-electrophoresis evidence used in automatic assertion"^^ . _:genid7488 . _:genid7488 . _:genid7488 . _:genid7488 . _:genid7488 "true"^^ . _:genid7489 . _:genid7489 . _:genid7489 . _:genid7489 . _:genid7489 "true"^^ . _:genid7490 . _:genid7490 . _:genid7490 . _:genid7490 "A type of co-electrophoresis evidence that is used in an automatic assertion."^^ . _:genid7490 "ECO:RCT"^^ . . _:genid7491 . _:genid7492 . _:genid7494 _:genid7493 . _:genid7492 _:genid7494 . _:genid7493 . _:genid7493 . _:genid7493 . _:genid7494 . _:genid7491 _:genid7492 . _:genid7491 . . . "IEA"^^ . "A type of co-localization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007362"^^ . "co-localization evidence used in automatic assertion"^^ . _:genid7495 . _:genid7495 . _:genid7495 . _:genid7495 . _:genid7495 "true"^^ . _:genid7496 . _:genid7496 . _:genid7496 . _:genid7496 . _:genid7496 "true"^^ . _:genid7497 . _:genid7497 . _:genid7497 . _:genid7497 "A type of co-localization evidence that is used in an automatic assertion."^^ . _:genid7497 "ECO:RCT"^^ . . _:genid7498 . _:genid7499 . _:genid7501 _:genid7500 . _:genid7499 _:genid7501 . _:genid7500 . _:genid7500 . _:genid7500 . _:genid7501 . _:genid7498 _:genid7499 . _:genid7498 . . . "IEA"^^ . "A type of imaging assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007363"^^ . "imaging assay evidence used in automatic assertion"^^ . _:genid7502 . _:genid7502 . _:genid7502 . _:genid7502 . _:genid7502 "true"^^ . _:genid7503 . _:genid7503 . _:genid7503 . _:genid7503 . _:genid7503 "true"^^ . _:genid7504 . _:genid7504 . _:genid7504 . _:genid7504 "A type of imaging assay evidence that is used in an automatic assertion."^^ . _:genid7504 "ECO:RCT"^^ . . _:genid7505 . _:genid7506 . _:genid7508 _:genid7507 . _:genid7506 _:genid7508 . _:genid7507 . _:genid7507 . _:genid7507 . _:genid7508 . _:genid7505 _:genid7506 . _:genid7505 . . . "IEA"^^ . "A type of co-sedimentation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007364"^^ . "co-sedimentation assay evidence used in automatic assertion"^^ . _:genid7509 . _:genid7509 . _:genid7509 . _:genid7509 . _:genid7509 "true"^^ . _:genid7510 . _:genid7510 . _:genid7510 . _:genid7510 . _:genid7510 "true"^^ . _:genid7511 . _:genid7511 . _:genid7511 . _:genid7511 "A type of co-sedimentation assay evidence that is used in an automatic assertion."^^ . _:genid7511 "ECO:RCT"^^ . . _:genid7512 . _:genid7513 . _:genid7515 _:genid7514 . _:genid7513 _:genid7515 . _:genid7514 . _:genid7514 . _:genid7514 . _:genid7515 . _:genid7512 _:genid7513 . _:genid7512 . . . "IEA"^^ . "A type of colony counting evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007365"^^ . "colony counting evidence used in automatic assertion"^^ . _:genid7516 . _:genid7516 . _:genid7516 . _:genid7516 . _:genid7516 "true"^^ . _:genid7517 . _:genid7517 . _:genid7517 . _:genid7517 . _:genid7517 "true"^^ . _:genid7518 . _:genid7518 . _:genid7518 . _:genid7518 "A type of colony counting evidence that is used in an automatic assertion."^^ . _:genid7518 "ECO:RCT"^^ . . _:genid7519 . _:genid7520 . _:genid7522 _:genid7521 . _:genid7520 _:genid7522 . _:genid7521 . _:genid7521 . _:genid7521 . _:genid7522 . _:genid7519 _:genid7520 . _:genid7519 . . . "IEA"^^ . "A type of comet assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007366"^^ . "comet assay evidence used in automatic assertion"^^ . _:genid7523 . _:genid7523 . _:genid7523 . _:genid7523 . _:genid7523 "true"^^ . _:genid7524 . _:genid7524 . _:genid7524 . _:genid7524 . _:genid7524 "true"^^ . _:genid7525 . _:genid7525 . _:genid7525 . _:genid7525 "A type of comet assay evidence that is used in an automatic assertion."^^ . _:genid7525 "ECO:RCT"^^ . . _:genid7526 . _:genid7527 . _:genid7529 _:genid7528 . _:genid7527 _:genid7529 . _:genid7528 . _:genid7528 . _:genid7528 . _:genid7529 . _:genid7526 _:genid7527 . _:genid7526 . . . "IEA"^^ . "A type of conditional knockin evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007367"^^ . "conditional knockin evidence used in automatic assertion"^^ . _:genid7530 . _:genid7530 . _:genid7530 . _:genid7530 . _:genid7530 "true"^^ . _:genid7531 . _:genid7531 . _:genid7531 . _:genid7531 . _:genid7531 "true"^^ . _:genid7532 . _:genid7532 . _:genid7532 . _:genid7532 "A type of conditional knockin evidence that is used in an automatic assertion."^^ . _:genid7532 "ECO:RCT"^^ . . _:genid7533 . _:genid7534 . _:genid7536 _:genid7535 . _:genid7534 _:genid7536 . _:genid7535 . _:genid7535 . _:genid7535 . _:genid7536 . _:genid7533 _:genid7534 . _:genid7533 . . . "IEA"^^ . "A type of knockin evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007368"^^ . "knockin evidence used in automatic assertion"^^ . _:genid7537 . _:genid7537 . _:genid7537 . _:genid7537 . _:genid7537 "true"^^ . _:genid7538 . _:genid7538 . _:genid7538 . _:genid7538 . _:genid7538 "true"^^ . _:genid7539 . _:genid7539 . _:genid7539 . _:genid7539 "A type of knockin evidence that is used in an automatic assertion."^^ . _:genid7539 "ECO:RCT"^^ . . _:genid7540 . _:genid7541 . _:genid7543 _:genid7542 . _:genid7541 _:genid7543 . _:genid7542 . _:genid7542 . _:genid7542 . _:genid7543 . _:genid7540 _:genid7541 . _:genid7540 . . . "IEA"^^ . "A type of conditional knockout evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007369"^^ . "conditional knockout evidence used in automatic assertion"^^ . _:genid7544 . _:genid7544 . _:genid7544 . _:genid7544 . _:genid7544 "true"^^ . _:genid7545 . _:genid7545 . _:genid7545 . _:genid7545 . _:genid7545 "true"^^ . _:genid7546 . _:genid7546 . _:genid7546 . _:genid7546 "A type of conditional knockout evidence that is used in an automatic assertion."^^ . _:genid7546 "ECO:RCT"^^ . . _:genid7547 . _:genid7548 . _:genid7550 _:genid7549 . _:genid7548 _:genid7550 . _:genid7549 . _:genid7549 . _:genid7549 . _:genid7550 . _:genid7547 _:genid7548 . _:genid7547 . . . "IEA"^^ . "A type of knockout evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007370"^^ . "knockout evidence used in automatic assertion"^^ . _:genid7551 . _:genid7551 . _:genid7551 . _:genid7551 . _:genid7551 "true"^^ . _:genid7552 . _:genid7552 . _:genid7552 . _:genid7552 . _:genid7552 "true"^^ . _:genid7553 . _:genid7553 . _:genid7553 . _:genid7553 "A type of knockout evidence that is used in an automatic assertion."^^ . _:genid7553 "ECO:RCT"^^ . . _:genid7554 . _:genid7555 . _:genid7557 _:genid7556 . _:genid7555 _:genid7557 . _:genid7556 . _:genid7556 . _:genid7556 . _:genid7557 . _:genid7554 _:genid7555 . _:genid7554 . . . "IEA"^^ . "A type of constitutively active mutant evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007371"^^ . "constitutively active mutant evidence used in automatic assertion"^^ . _:genid7558 . _:genid7558 . _:genid7558 . _:genid7558 . _:genid7558 "true"^^ . _:genid7559 . _:genid7559 . _:genid7559 . _:genid7559 . _:genid7559 "true"^^ . _:genid7560 . _:genid7560 . _:genid7560 . _:genid7560 "A type of constitutively active mutant evidence that is used in an automatic assertion."^^ . _:genid7560 "ECO:RCT"^^ . . _:genid7561 . _:genid7562 . _:genid7564 _:genid7563 . _:genid7562 _:genid7564 . _:genid7563 . _:genid7563 . _:genid7563 . _:genid7564 . _:genid7561 _:genid7562 . _:genid7561 . . . "IEA"^^ . "A type of cross-linking evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007372"^^ . "cross-linking evidence used in automatic assertion"^^ . _:genid7565 . _:genid7565 . _:genid7565 . _:genid7565 . _:genid7565 "true"^^ . _:genid7566 . _:genid7566 . _:genid7566 . _:genid7566 . _:genid7566 "true"^^ . _:genid7567 . _:genid7567 . _:genid7567 . _:genid7567 "A type of cross-linking evidence that is used in an automatic assertion."^^ . _:genid7567 "ECO:RCT"^^ . . _:genid7568 . _:genid7569 . _:genid7571 _:genid7570 . _:genid7569 _:genid7571 . _:genid7570 . _:genid7570 . _:genid7570 . _:genid7571 . _:genid7568 _:genid7569 . _:genid7568 . . . "IEA"^^ . "A type of protein binding evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007373"^^ . "protein binding evidence used in automatic assertion"^^ . _:genid7572 . _:genid7572 . _:genid7572 . _:genid7572 . _:genid7572 "true"^^ . _:genid7573 . _:genid7573 . _:genid7573 . _:genid7573 . _:genid7573 "true"^^ . _:genid7574 . _:genid7574 . _:genid7574 . _:genid7574 "A type of protein binding evidence that is used in an automatic assertion."^^ . _:genid7574 "ECO:RCT"^^ . . _:genid7575 . _:genid7576 . _:genid7578 _:genid7577 . _:genid7576 _:genid7578 . _:genid7577 . _:genid7577 . _:genid7577 . _:genid7578 . _:genid7575 _:genid7576 . _:genid7575 . . . "IEA"^^ . "A type of crystallography evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007374"^^ . "crystallography evidence used in automatic assertion"^^ . _:genid7579 . _:genid7579 . _:genid7579 . _:genid7579 . _:genid7579 "true"^^ . _:genid7580 . _:genid7580 . _:genid7580 . _:genid7580 . _:genid7580 "true"^^ . _:genid7581 . _:genid7581 . _:genid7581 . _:genid7581 "A type of crystallography evidence that is used in an automatic assertion."^^ . _:genid7581 "ECO:RCT"^^ . . _:genid7582 . _:genid7583 . _:genid7585 _:genid7584 . _:genid7583 _:genid7585 . _:genid7584 . _:genid7584 . _:genid7584 . _:genid7585 . _:genid7582 _:genid7583 . _:genid7582 . . . "IEA"^^ . "A type of cytochemistry evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007375"^^ . "cytochemistry evidence used in automatic assertion"^^ . _:genid7586 . _:genid7586 . _:genid7586 . _:genid7586 . _:genid7586 "true"^^ . _:genid7587 . _:genid7587 . _:genid7587 . _:genid7587 . _:genid7587 "true"^^ . _:genid7588 . _:genid7588 . _:genid7588 . _:genid7588 "A type of cytochemistry evidence that is used in an automatic assertion."^^ . _:genid7588 "ECO:RCT"^^ . . _:genid7589 . _:genid7590 . _:genid7592 _:genid7591 . _:genid7590 _:genid7592 . _:genid7591 . _:genid7591 . _:genid7591 . _:genid7592 . _:genid7589 _:genid7590 . _:genid7589 . . . "IEA"^^ . "A type of histochemistry evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007376"^^ . "histochemistry evidence used in automatic assertion"^^ . _:genid7593 . _:genid7593 . _:genid7593 . _:genid7593 . _:genid7593 "true"^^ . _:genid7594 . _:genid7594 . _:genid7594 . _:genid7594 . _:genid7594 "true"^^ . _:genid7595 . _:genid7595 . _:genid7595 . _:genid7595 "A type of histochemistry evidence that is used in an automatic assertion."^^ . _:genid7595 "ECO:RCT"^^ . . _:genid7596 . _:genid7597 . _:genid7599 _:genid7598 . _:genid7597 _:genid7599 . _:genid7598 . _:genid7598 . _:genid7598 . _:genid7599 . _:genid7596 _:genid7597 . _:genid7596 . . . "IEA"^^ . "A type of cytochrome C release assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007377"^^ . "cytochrome C release assay evidence used in automatic assertion"^^ . _:genid7600 . _:genid7600 . _:genid7600 . _:genid7600 . _:genid7600 "true"^^ . _:genid7601 . _:genid7601 . _:genid7601 . _:genid7601 . _:genid7601 "true"^^ . _:genid7602 . _:genid7602 . _:genid7602 . _:genid7602 "A type of cytochrome C release assay evidence that is used in an automatic assertion."^^ . _:genid7602 "ECO:RCT"^^ . . _:genid7603 . _:genid7604 . _:genid7606 _:genid7605 . _:genid7604 _:genid7606 . _:genid7605 . _:genid7605 . _:genid7605 . _:genid7606 . _:genid7603 _:genid7604 . _:genid7603 . . . "IEA"^^ . "A type of 4',6-diamidino-2-phenylindole staining evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007378"^^ . "4',6-diamidino-2-phenylindole staining evidence used in automatic assertion"^^ . _:genid7607 . _:genid7607 . _:genid7607 . _:genid7607 . _:genid7607 "true"^^ . _:genid7608 . _:genid7608 . _:genid7608 . _:genid7608 . _:genid7608 "true"^^ . _:genid7609 . _:genid7609 . _:genid7609 . _:genid7609 "A type of 4',6-diamidino-2-phenylindole staining evidence that is used in an automatic assertion."^^ . _:genid7609 "ECO:RCT"^^ . . _:genid7610 . _:genid7611 . _:genid7613 _:genid7612 . _:genid7611 _:genid7613 . _:genid7612 . _:genid7612 . _:genid7612 . _:genid7613 . _:genid7610 _:genid7611 . _:genid7610 . . . "IEA"^^ . "A type of deletion mutation phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "deletion mutation evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007379"^^ . "deletion mutation phenotypic evidence used in automatic assertion"^^ . _:genid7614 . _:genid7614 . _:genid7614 . _:genid7614 . _:genid7614 "true"^^ . _:genid7615 . _:genid7615 . _:genid7615 . _:genid7615 . _:genid7615 "true"^^ . _:genid7616 . _:genid7616 . _:genid7616 . _:genid7616 "A type of deletion mutation phenotypic evidence that is used in an automatic assertion."^^ . _:genid7616 "ECO:RCT"^^ . . _:genid7617 . _:genid7618 . _:genid7620 _:genid7619 . _:genid7618 _:genid7620 . _:genid7619 . _:genid7619 . _:genid7619 . _:genid7620 . _:genid7617 _:genid7618 . _:genid7617 . . . "IEA"^^ . "A type of DNA laddering assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007380"^^ . "DNA laddering assay evidence used in automatic assertion"^^ . _:genid7621 . _:genid7621 . _:genid7621 . _:genid7621 . _:genid7621 "true"^^ . _:genid7622 . _:genid7622 . _:genid7622 . _:genid7622 . _:genid7622 "true"^^ . _:genid7623 . _:genid7623 . _:genid7623 . _:genid7623 "A type of DNA laddering assay evidence that is used in an automatic assertion."^^ . _:genid7623 "ECO:RCT"^^ . . _:genid7624 . _:genid7625 . _:genid7627 _:genid7626 . _:genid7625 _:genid7627 . _:genid7626 . _:genid7626 . _:genid7626 . _:genid7627 . _:genid7624 _:genid7625 . _:genid7624 . . . "IEA"^^ . "A type of RNA dot blot assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007381"^^ . "RNA dot blot assay evidence used in automatic assertion"^^ . _:genid7628 . _:genid7628 . _:genid7628 . _:genid7628 . _:genid7628 "true"^^ . _:genid7629 . _:genid7629 . _:genid7629 . _:genid7629 . _:genid7629 "true"^^ . _:genid7630 . _:genid7630 . _:genid7630 . _:genid7630 "A type of RNA dot blot assay evidence that is used in an automatic assertion."^^ . _:genid7630 "ECO:RCT"^^ . . _:genid7631 . _:genid7632 . _:genid7634 _:genid7633 . _:genid7632 _:genid7634 . _:genid7633 . _:genid7633 . _:genid7633 . _:genid7634 . _:genid7631 _:genid7632 . _:genid7631 . . . "IEA"^^ . "A type of dominant-negative mutant phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "dominant-negative mutant evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007382"^^ . "dominant-negative mutant phenotypic evidence used in automatic assertion"^^ . _:genid7635 . _:genid7635 . _:genid7635 . _:genid7635 . _:genid7635 "true"^^ . _:genid7636 . _:genid7636 . _:genid7636 . _:genid7636 . _:genid7636 "true"^^ . _:genid7637 . _:genid7637 . _:genid7637 . _:genid7637 "A type of dominant-negative mutant phenotypic evidence that is used in an automatic assertion."^^ . _:genid7637 "ECO:RCT"^^ . . _:genid7638 . _:genid7639 . _:genid7641 _:genid7640 . _:genid7639 _:genid7641 . _:genid7640 . _:genid7640 . _:genid7640 . _:genid7641 . _:genid7638 _:genid7639 . _:genid7638 . . . "IEA"^^ . "A type of eTag assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007383"^^ . "eTag assay evidence used in automatic assertion"^^ . _:genid7642 . _:genid7642 . _:genid7642 . _:genid7642 . _:genid7642 "true"^^ . _:genid7643 . _:genid7643 . _:genid7643 . _:genid7643 . _:genid7643 "true"^^ . _:genid7644 . _:genid7644 . _:genid7644 . _:genid7644 "A type of eTag assay evidence that is used in an automatic assertion."^^ . _:genid7644 "ECO:RCT"^^ . . _:genid7645 . _:genid7646 . _:genid7648 _:genid7647 . _:genid7646 _:genid7648 . _:genid7647 . _:genid7647 . _:genid7647 . _:genid7648 . _:genid7645 _:genid7646 . _:genid7645 . . . "IEA"^^ . "A type of affinity evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007384"^^ . "affinity evidence used in automatic assertion"^^ . _:genid7649 . _:genid7649 . _:genid7649 . _:genid7649 . _:genid7649 "true"^^ . _:genid7650 . _:genid7650 . _:genid7650 . _:genid7650 . _:genid7650 "true"^^ . _:genid7651 . _:genid7651 . _:genid7651 . _:genid7651 "A type of affinity evidence that is used in an automatic assertion."^^ . _:genid7651 "ECO:RCT"^^ . . _:genid7652 . _:genid7653 . _:genid7655 _:genid7654 . _:genid7653 _:genid7655 . _:genid7654 . _:genid7654 . _:genid7654 . _:genid7655 . _:genid7652 _:genid7653 . _:genid7652 . . . "IEA"^^ . "A type of filter binding assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007385"^^ . "filter binding assay evidence used in automatic assertion"^^ . _:genid7656 . _:genid7656 . _:genid7656 . _:genid7656 . _:genid7656 "true"^^ . _:genid7657 . _:genid7657 . _:genid7657 . _:genid7657 . _:genid7657 "true"^^ . _:genid7658 . _:genid7658 . _:genid7658 . _:genid7658 "A type of filter binding assay evidence that is used in an automatic assertion."^^ . _:genid7658 "ECO:RCT"^^ . . _:genid7659 . _:genid7660 . _:genid7662 _:genid7661 . _:genid7660 _:genid7662 . _:genid7661 . _:genid7661 . _:genid7661 . _:genid7662 . _:genid7659 _:genid7660 . _:genid7659 . . . . "IEA"^^ . "A type of fluorescence in situ hybridization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007386"^^ . "fluorescence in situ hybridization evidence used in automatic assertion"^^ . _:genid7663 . _:genid7663 . _:genid7663 . _:genid7663 . _:genid7663 "true"^^ . _:genid7664 . _:genid7664 . _:genid7664 . _:genid7664 . _:genid7664 "true"^^ . _:genid7665 . _:genid7665 . _:genid7665 . _:genid7665 . _:genid7665 "true"^^ . _:genid7666 . _:genid7666 . _:genid7666 . _:genid7666 "A type of fluorescence in situ hybridization evidence that is used in an automatic assertion."^^ . _:genid7666 "ECO:RCT"^^ . . _:genid7667 . _:genid7668 . _:genid7670 _:genid7669 . _:genid7668 _:genid7670 . _:genid7669 . _:genid7669 . _:genid7669 . _:genid7670 . _:genid7667 _:genid7668 . _:genid7667 . . . "IEA"^^ . "A type of fluorescence resonance energy transfer evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007387"^^ . "fluorescence resonance energy transfer evidence used in automatic assertion"^^ . _:genid7671 . _:genid7671 . _:genid7671 . _:genid7671 . _:genid7671 "true"^^ . _:genid7672 . _:genid7672 . _:genid7672 . _:genid7672 . _:genid7672 "true"^^ . _:genid7673 . _:genid7673 . _:genid7673 . _:genid7673 "A type of fluorescence resonance energy transfer evidence that is used in an automatic assertion."^^ . _:genid7673 "ECO:RCT"^^ . . _:genid7674 . _:genid7675 . _:genid7677 _:genid7676 . _:genid7675 _:genid7677 . _:genid7676 . _:genid7676 . _:genid7676 . _:genid7677 . _:genid7674 _:genid7675 . _:genid7674 . . . "IEA"^^ . "A type of gel-filtration evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007388"^^ . "gel-filtration evidence used in automatic assertion"^^ . _:genid7678 . _:genid7678 . _:genid7678 . _:genid7678 . _:genid7678 "true"^^ . _:genid7679 . _:genid7679 . _:genid7679 . _:genid7679 . _:genid7679 "true"^^ . _:genid7680 . _:genid7680 . _:genid7680 . _:genid7680 "A type of gel-filtration evidence that is used in an automatic assertion."^^ . _:genid7680 "ECO:RCT"^^ . . _:genid7681 . _:genid7682 . _:genid7684 _:genid7683 . _:genid7682 _:genid7684 . _:genid7683 . _:genid7683 . _:genid7683 . _:genid7684 . _:genid7681 _:genid7682 . _:genid7681 . . . "IEA"^^ . "A type of histology evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007389"^^ . "histology evidence used in automatic assertion"^^ . _:genid7685 . _:genid7685 . _:genid7685 . _:genid7685 . _:genid7685 "true"^^ . _:genid7686 . _:genid7686 . _:genid7686 . _:genid7686 . _:genid7686 "true"^^ . _:genid7687 . _:genid7687 . _:genid7687 . _:genid7687 "A type of histology evidence that is used in an automatic assertion."^^ . _:genid7687 "ECO:RCT"^^ . . _:genid7688 . _:genid7689 . _:genid7691 _:genid7690 . _:genid7689 _:genid7691 . _:genid7690 . _:genid7690 . _:genid7690 . _:genid7691 . _:genid7688 _:genid7689 . _:genid7688 . . . "IEA"^^ . "A type of immunocytochemistry evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007390"^^ . "immunocytochemistry evidence used in automatic assertion"^^ . _:genid7692 . _:genid7692 . _:genid7692 . _:genid7692 . _:genid7692 "true"^^ . _:genid7693 . _:genid7693 . _:genid7693 . _:genid7693 . _:genid7693 "true"^^ . _:genid7694 . _:genid7694 . _:genid7694 . _:genid7694 "A type of immunocytochemistry evidence that is used in an automatic assertion."^^ . _:genid7694 "ECO:RCT"^^ . . _:genid7695 . _:genid7696 . _:genid7698 _:genid7697 . _:genid7696 _:genid7698 . _:genid7697 . _:genid7697 . _:genid7697 . _:genid7698 . _:genid7695 _:genid7696 . _:genid7695 . . . "IEA"^^ . "A type of immunodepletion evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007391"^^ . "immunodepletion evidence used in automatic assertion"^^ . _:genid7699 . _:genid7699 . _:genid7699 . _:genid7699 . _:genid7699 "true"^^ . _:genid7700 . _:genid7700 . _:genid7700 . _:genid7700 . _:genid7700 "true"^^ . _:genid7701 . _:genid7701 . _:genid7701 . _:genid7701 "A type of immunodepletion evidence that is used in an automatic assertion."^^ . _:genid7701 "ECO:RCT"^^ . . _:genid7702 . _:genid7703 . _:genid7705 _:genid7704 . _:genid7703 _:genid7705 . _:genid7704 . _:genid7704 . _:genid7704 . _:genid7705 . _:genid7702 _:genid7703 . _:genid7702 . . . "IEA"^^ . "A type of immunohistochemistry evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007392"^^ . "immunohistochemistry evidence used in automatic assertion"^^ . _:genid7706 . _:genid7706 . _:genid7706 . _:genid7706 . _:genid7706 "true"^^ . _:genid7707 . _:genid7707 . _:genid7707 . _:genid7707 . _:genid7707 "true"^^ . _:genid7708 . _:genid7708 . _:genid7708 . _:genid7708 "A type of immunohistochemistry evidence that is used in an automatic assertion."^^ . _:genid7708 "ECO:RCT"^^ . . _:genid7709 . _:genid7710 . _:genid7712 _:genid7711 . _:genid7710 _:genid7712 . _:genid7711 . _:genid7711 . _:genid7711 . _:genid7712 . _:genid7709 _:genid7710 . _:genid7709 . . . "IEA"^^ . "A type of in vitro acetylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007393"^^ . "in vitro acetylation assay evidence used in automatic assertion"^^ . _:genid7713 . _:genid7713 . _:genid7713 . _:genid7713 . _:genid7713 "true"^^ . _:genid7714 . _:genid7714 . _:genid7714 . _:genid7714 . _:genid7714 "true"^^ . _:genid7715 . _:genid7715 . _:genid7715 . _:genid7715 "A type of in vitro acetylation assay evidence that is used in an automatic assertion."^^ . _:genid7715 "ECO:RCT"^^ . . _:genid7716 . _:genid7717 . _:genid7719 _:genid7718 . _:genid7717 _:genid7719 . _:genid7718 . _:genid7718 . _:genid7718 . _:genid7719 . _:genid7716 _:genid7717 . _:genid7716 . . . "IEA"^^ . "A type of in vitro cleavage assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007394"^^ . "in vitro cleavage assay evidence used in automatic assertion"^^ . _:genid7720 . _:genid7720 . _:genid7720 . _:genid7720 . _:genid7720 "true"^^ . _:genid7721 . _:genid7721 . _:genid7721 . _:genid7721 . _:genid7721 "true"^^ . _:genid7722 . _:genid7722 . _:genid7722 . _:genid7722 "A type of in vitro cleavage assay evidence that is used in an automatic assertion."^^ . _:genid7722 "ECO:RCT"^^ . . _:genid7723 . _:genid7724 . _:genid7726 _:genid7725 . _:genid7724 _:genid7726 . _:genid7725 . _:genid7725 . _:genid7725 . _:genid7726 . _:genid7723 _:genid7724 . _:genid7723 . . . "IEA"^^ . "A type of in vitro deacetylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007395"^^ . "in vitro deacetylation assay evidence used in automatic assertion"^^ . _:genid7727 . _:genid7727 . _:genid7727 . _:genid7727 . _:genid7727 "true"^^ . _:genid7728 . _:genid7728 . _:genid7728 . _:genid7728 . _:genid7728 "true"^^ . _:genid7729 . _:genid7729 . _:genid7729 . _:genid7729 "A type of in vitro deacetylation assay evidence that is used in an automatic assertion."^^ . _:genid7729 "ECO:RCT"^^ . . _:genid7730 . _:genid7731 . _:genid7733 _:genid7732 . _:genid7731 _:genid7733 . _:genid7732 . _:genid7732 . _:genid7732 . _:genid7733 . _:genid7730 _:genid7731 . _:genid7730 . . . "IEA"^^ . "A type of in vitro defarnesylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007396"^^ . "in vitro defarnesylation assay evidence used in automatic assertion"^^ . _:genid7734 . _:genid7734 . _:genid7734 . _:genid7734 . _:genid7734 "true"^^ . _:genid7735 . _:genid7735 . _:genid7735 . _:genid7735 . _:genid7735 "true"^^ . _:genid7736 . _:genid7736 . _:genid7736 . _:genid7736 "A type of in vitro defarnesylation assay evidence that is used in an automatic assertion."^^ . _:genid7736 "ECO:RCT"^^ . . _:genid7737 . _:genid7738 . _:genid7740 _:genid7739 . _:genid7738 _:genid7740 . _:genid7739 . _:genid7739 . _:genid7739 . _:genid7740 . _:genid7737 _:genid7738 . _:genid7737 . . . "IEA"^^ . "A type of in vitro demethylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007397"^^ . "in vitro demethylation assay evidence used in automatic assertion"^^ . _:genid7741 . _:genid7741 . _:genid7741 . _:genid7741 . _:genid7741 "true"^^ . _:genid7742 . _:genid7742 . _:genid7742 . _:genid7742 . _:genid7742 "true"^^ . _:genid7743 . _:genid7743 . _:genid7743 . _:genid7743 "A type of in vitro demethylation assay evidence that is used in an automatic assertion."^^ . _:genid7743 "ECO:RCT"^^ . . _:genid7744 . _:genid7745 . _:genid7747 _:genid7746 . _:genid7745 _:genid7747 . _:genid7746 . _:genid7746 . _:genid7746 . _:genid7747 . _:genid7744 _:genid7745 . _:genid7744 . . . "IEA"^^ . "A type of in vitro desumoylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007398"^^ . "in vitro desumoylation assay evidence used in automatic assertion"^^ . _:genid7748 . _:genid7748 . _:genid7748 . _:genid7748 . _:genid7748 "true"^^ . _:genid7749 . _:genid7749 . _:genid7749 . _:genid7749 . _:genid7749 "true"^^ . _:genid7750 . _:genid7750 . _:genid7750 . _:genid7750 "A type of in vitro desumoylation assay evidence that is used in an automatic assertion."^^ . _:genid7750 "ECO:RCT"^^ . . _:genid7751 . _:genid7752 . _:genid7754 _:genid7753 . _:genid7752 _:genid7754 . _:genid7753 . _:genid7753 . _:genid7753 . _:genid7754 . _:genid7751 _:genid7752 . _:genid7751 . . . "IEA"^^ . "A type of in vitro deubiquitination assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007399"^^ . "in vitro deubiquitination assay evidence used in automatic assertion"^^ . _:genid7755 . _:genid7755 . _:genid7755 . _:genid7755 . _:genid7755 "true"^^ . _:genid7756 . _:genid7756 . _:genid7756 . _:genid7756 . _:genid7756 "true"^^ . _:genid7757 . _:genid7757 . _:genid7757 . _:genid7757 "A type of in vitro deubiquitination assay evidence that is used in an automatic assertion."^^ . _:genid7757 "ECO:RCT"^^ . . _:genid7758 . _:genid7759 . _:genid7761 _:genid7760 . _:genid7759 _:genid7761 . _:genid7760 . _:genid7760 . _:genid7760 . _:genid7761 . _:genid7758 _:genid7759 . _:genid7758 . . . "IEA"^^ . "A type of in vitro farnesylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007400"^^ . "in vitro farnesylation assay evidence used in automatic assertion"^^ . _:genid7762 . _:genid7762 . _:genid7762 . _:genid7762 . _:genid7762 "true"^^ . _:genid7763 . _:genid7763 . _:genid7763 . _:genid7763 . _:genid7763 "true"^^ . _:genid7764 . _:genid7764 . _:genid7764 . _:genid7764 "A type of in vitro farnesylation assay evidence that is used in an automatic assertion."^^ . _:genid7764 "ECO:RCT"^^ . . _:genid7765 . _:genid7766 . _:genid7768 _:genid7767 . _:genid7766 _:genid7768 . _:genid7767 . _:genid7767 . _:genid7767 . _:genid7768 . _:genid7765 _:genid7766 . _:genid7765 . . . "IEA"^^ . "A type of in vitro methylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007401"^^ . "in vitro methylation assay evidence used in automatic assertion"^^ . _:genid7769 . _:genid7769 . _:genid7769 . _:genid7769 . _:genid7769 "true"^^ . _:genid7770 . _:genid7770 . _:genid7770 . _:genid7770 . _:genid7770 "true"^^ . _:genid7771 . _:genid7771 . _:genid7771 . _:genid7771 "A type of in vitro methylation assay evidence that is used in an automatic assertion."^^ . _:genid7771 "ECO:RCT"^^ . . _:genid7772 . _:genid7773 . _:genid7775 _:genid7774 . _:genid7773 _:genid7775 . _:genid7774 . _:genid7774 . _:genid7774 . _:genid7775 . _:genid7772 _:genid7773 . _:genid7772 . . . "IEA"^^ . "A type of in vitro palmitoylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007402"^^ . "in vitro palmitoylation assay evidence used in automatic assertion"^^ . _:genid7776 . _:genid7776 . _:genid7776 . _:genid7776 . _:genid7776 "true"^^ . _:genid7777 . _:genid7777 . _:genid7777 . _:genid7777 . _:genid7777 "true"^^ . _:genid7778 . _:genid7778 . _:genid7778 . _:genid7778 "A type of in vitro palmitoylation assay evidence that is used in an automatic assertion."^^ . _:genid7778 "ECO:RCT"^^ . . _:genid7779 . _:genid7780 . _:genid7782 _:genid7781 . _:genid7780 _:genid7782 . _:genid7781 . _:genid7781 . _:genid7781 . _:genid7782 . _:genid7779 _:genid7780 . _:genid7779 . . . "IEA"^^ . "A type of in vitro phosphatase assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007403"^^ . "in vitro phosphatase assay evidence used in automatic assertion"^^ . _:genid7783 . _:genid7783 . _:genid7783 . _:genid7783 . _:genid7783 "true"^^ . _:genid7784 . _:genid7784 . _:genid7784 . _:genid7784 . _:genid7784 "true"^^ . _:genid7785 . _:genid7785 . _:genid7785 . _:genid7785 "A type of in vitro phosphatase assay evidence that is used in an automatic assertion."^^ . _:genid7785 "ECO:RCT"^^ . . _:genid7786 . _:genid7787 . _:genid7789 _:genid7788 . _:genid7787 _:genid7789 . _:genid7788 . _:genid7788 . _:genid7788 . _:genid7789 . _:genid7786 _:genid7787 . _:genid7786 . . . "IEA"^^ . "A type of in vitro polyADP-ribosylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007404"^^ . "in vitro polyADP-ribosylation assay evidence used in automatic assertion"^^ . _:genid7790 . _:genid7790 . _:genid7790 . _:genid7790 . _:genid7790 "true"^^ . _:genid7791 . _:genid7791 . _:genid7791 . _:genid7791 . _:genid7791 "true"^^ . _:genid7792 . _:genid7792 . _:genid7792 . _:genid7792 "A type of in vitro polyADP-ribosylation assay evidence that is used in an automatic assertion."^^ . _:genid7792 "ECO:RCT"^^ . . _:genid7793 . _:genid7794 . _:genid7796 _:genid7795 . _:genid7794 _:genid7796 . _:genid7795 . _:genid7795 . _:genid7795 . _:genid7796 . _:genid7793 _:genid7794 . _:genid7793 . . . "IEA"^^ . "A type of in vitro protein kinase assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007405"^^ . "in vitro protein kinase assay evidence used in automatic assertion"^^ . _:genid7797 . _:genid7797 . _:genid7797 . _:genid7797 . _:genid7797 "true"^^ . _:genid7798 . _:genid7798 . _:genid7798 . _:genid7798 . _:genid7798 "true"^^ . _:genid7799 . _:genid7799 . _:genid7799 . _:genid7799 "A type of in vitro protein kinase assay evidence that is used in an automatic assertion."^^ . _:genid7799 "ECO:RCT"^^ . . _:genid7800 . _:genid7801 . _:genid7803 _:genid7802 . _:genid7801 _:genid7803 . _:genid7802 . _:genid7802 . _:genid7802 . _:genid7803 . _:genid7800 _:genid7801 . _:genid7800 . . . "IEA"^^ . "A type of in vitro sumoylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007406"^^ . "in vitro sumoylation assay evidence used in automatic assertion"^^ . _:genid7804 . _:genid7804 . _:genid7804 . _:genid7804 . _:genid7804 "true"^^ . _:genid7805 . _:genid7805 . _:genid7805 . _:genid7805 . _:genid7805 "true"^^ . _:genid7806 . _:genid7806 . _:genid7806 . _:genid7806 "A type of in vitro sumoylation assay evidence that is used in an automatic assertion."^^ . _:genid7806 "ECO:RCT"^^ . . _:genid7807 . _:genid7808 . _:genid7810 _:genid7809 . _:genid7808 _:genid7810 . _:genid7809 . _:genid7809 . _:genid7809 . _:genid7810 . _:genid7807 _:genid7808 . _:genid7807 . . . "IEA"^^ . "A type of in vitro transcription assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007407"^^ . "in vitro transcription assay evidence used in automatic assertion"^^ . _:genid7811 . _:genid7811 . _:genid7811 . _:genid7811 . _:genid7811 "true"^^ . _:genid7812 . _:genid7812 . _:genid7812 . _:genid7812 . _:genid7812 "true"^^ . _:genid7813 . _:genid7813 . _:genid7813 . _:genid7813 "A type of in vitro transcription assay evidence that is used in an automatic assertion."^^ . _:genid7813 "ECO:RCT"^^ . . _:genid7814 . _:genid7815 . _:genid7817 _:genid7816 . _:genid7815 _:genid7817 . _:genid7816 . _:genid7816 . _:genid7816 . _:genid7817 . _:genid7814 _:genid7815 . _:genid7814 . . . "IEA"^^ . "A type of in vitro translation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007408"^^ . "in vitro translation assay evidence used in automatic assertion"^^ . _:genid7818 . _:genid7818 . _:genid7818 . _:genid7818 . _:genid7818 "true"^^ . _:genid7819 . _:genid7819 . _:genid7819 . _:genid7819 . _:genid7819 "true"^^ . _:genid7820 . _:genid7820 . _:genid7820 . _:genid7820 "A type of in vitro translation assay evidence that is used in an automatic assertion."^^ . _:genid7820 "ECO:RCT"^^ . . _:genid7821 . _:genid7822 . _:genid7824 _:genid7823 . _:genid7822 _:genid7824 . _:genid7823 . _:genid7823 . _:genid7823 . _:genid7824 . _:genid7821 _:genid7822 . _:genid7821 . . . "IEA"^^ . "A type of in vitro ubiquitination assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007409"^^ . "in vitro ubiquitination assay evidence used in automatic assertion"^^ . _:genid7825 . _:genid7825 . _:genid7825 . _:genid7825 . _:genid7825 "true"^^ . _:genid7826 . _:genid7826 . _:genid7826 . _:genid7826 . _:genid7826 "true"^^ . _:genid7827 . _:genid7827 . _:genid7827 . _:genid7827 "A type of in vitro ubiquitination assay evidence that is used in an automatic assertion."^^ . _:genid7827 "ECO:RCT"^^ . . _:genid7828 . _:genid7829 . _:genid7831 _:genid7830 . _:genid7829 _:genid7831 . _:genid7830 . _:genid7830 . _:genid7830 . _:genid7831 . _:genid7828 _:genid7829 . _:genid7828 . . . "IEA"^^ . "A type of in vivo acetylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007410"^^ . "in vivo acetylation assay evidence used in automatic assertion"^^ . _:genid7832 . _:genid7832 . _:genid7832 . _:genid7832 . _:genid7832 "true"^^ . _:genid7833 . _:genid7833 . _:genid7833 . _:genid7833 . _:genid7833 "true"^^ . _:genid7834 . _:genid7834 . _:genid7834 . _:genid7834 "A type of in vivo acetylation assay evidence that is used in an automatic assertion."^^ . _:genid7834 "ECO:RCT"^^ . . _:genid7835 . _:genid7836 . _:genid7838 _:genid7837 . _:genid7836 _:genid7838 . _:genid7837 . _:genid7837 . _:genid7837 . _:genid7838 . _:genid7835 _:genid7836 . _:genid7835 . . . "IEA"^^ . "A type of in vivo cleavage assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007411"^^ . "in vivo cleavage assay evidence used in automatic assertion"^^ . _:genid7839 . _:genid7839 . _:genid7839 . _:genid7839 . _:genid7839 "true"^^ . _:genid7840 . _:genid7840 . _:genid7840 . _:genid7840 . _:genid7840 "true"^^ . _:genid7841 . _:genid7841 . _:genid7841 . _:genid7841 "A type of in vivo cleavage assay evidence that is used in an automatic assertion."^^ . _:genid7841 "ECO:RCT"^^ . . _:genid7842 . _:genid7843 . _:genid7845 _:genid7844 . _:genid7843 _:genid7845 . _:genid7844 . _:genid7844 . _:genid7844 . _:genid7845 . _:genid7842 _:genid7843 . _:genid7842 . . . "IEA"^^ . "A type of in vivo deacetylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007412"^^ . "in vivo deacetylation assay evidence used in automatic assertion"^^ . _:genid7846 . _:genid7846 . _:genid7846 . _:genid7846 . _:genid7846 "true"^^ . _:genid7847 . _:genid7847 . _:genid7847 . _:genid7847 . _:genid7847 "true"^^ . _:genid7848 . _:genid7848 . _:genid7848 . _:genid7848 "A type of in vivo deacetylation assay evidence that is used in an automatic assertion."^^ . _:genid7848 "ECO:RCT"^^ . . _:genid7849 . _:genid7850 . _:genid7852 _:genid7851 . _:genid7850 _:genid7852 . _:genid7851 . _:genid7851 . _:genid7851 . _:genid7852 . _:genid7849 _:genid7850 . _:genid7849 . . . "IEA"^^ . "A type of in vivo defarnesylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007413"^^ . "in vivo defarnesylation assay evidence used in automatic assertion"^^ . _:genid7853 . _:genid7853 . _:genid7853 . _:genid7853 . _:genid7853 "true"^^ . _:genid7854 . _:genid7854 . _:genid7854 . _:genid7854 . _:genid7854 "true"^^ . _:genid7855 . _:genid7855 . _:genid7855 . _:genid7855 "A type of in vivo defarnesylation assay evidence that is used in an automatic assertion."^^ . _:genid7855 "ECO:RCT"^^ . . _:genid7856 . _:genid7857 . _:genid7859 _:genid7858 . _:genid7857 _:genid7859 . _:genid7858 . _:genid7858 . _:genid7858 . _:genid7859 . _:genid7856 _:genid7857 . _:genid7856 . . . "IEA"^^ . "A type of in vivo demethylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007414"^^ . "in vivo demethylation assay evidence used in automatic assertion"^^ . _:genid7860 . _:genid7860 . _:genid7860 . _:genid7860 . _:genid7860 "true"^^ . _:genid7861 . _:genid7861 . _:genid7861 . _:genid7861 . _:genid7861 "true"^^ . _:genid7862 . _:genid7862 . _:genid7862 . _:genid7862 "A type of in vivo demethylation assay evidence that is used in an automatic assertion."^^ . _:genid7862 "ECO:RCT"^^ . . _:genid7863 . _:genid7864 . _:genid7866 _:genid7865 . _:genid7864 _:genid7866 . _:genid7865 . _:genid7865 . _:genid7865 . _:genid7866 . _:genid7863 _:genid7864 . _:genid7863 . . . "IEA"^^ . "A type of in vivo desumoylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007415"^^ . "in vivo desumoylation assay evidence used in automatic assertion"^^ . _:genid7867 . _:genid7867 . _:genid7867 . _:genid7867 . _:genid7867 "true"^^ . _:genid7868 . _:genid7868 . _:genid7868 . _:genid7868 . _:genid7868 "true"^^ . _:genid7869 . _:genid7869 . _:genid7869 . _:genid7869 "A type of in vivo desumoylation assay evidence that is used in an automatic assertion."^^ . _:genid7869 "ECO:RCT"^^ . . _:genid7870 . _:genid7871 . _:genid7873 _:genid7872 . _:genid7871 _:genid7873 . _:genid7872 . _:genid7872 . _:genid7872 . _:genid7873 . _:genid7870 _:genid7871 . _:genid7870 . . . "IEA"^^ . "A type of in vivo deubiquitination assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007416"^^ . "in vivo deubiquitination assay evidence used in automatic assertion"^^ . _:genid7874 . _:genid7874 . _:genid7874 . _:genid7874 . _:genid7874 "true"^^ . _:genid7875 . _:genid7875 . _:genid7875 . _:genid7875 . _:genid7875 "true"^^ . _:genid7876 . _:genid7876 . _:genid7876 . _:genid7876 "A type of in vivo deubiquitination assay evidence that is used in an automatic assertion."^^ . _:genid7876 "ECO:RCT"^^ . . _:genid7877 . _:genid7878 . _:genid7880 _:genid7879 . _:genid7878 _:genid7880 . _:genid7879 . _:genid7879 . _:genid7879 . _:genid7880 . _:genid7877 _:genid7878 . _:genid7877 . . . "IEA"^^ . "A type of in vivo farnesylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007417"^^ . "in vivo farnesylation assay evidence used in automatic assertion"^^ . _:genid7881 . _:genid7881 . _:genid7881 . _:genid7881 . _:genid7881 "true"^^ . _:genid7882 . _:genid7882 . _:genid7882 . _:genid7882 . _:genid7882 "true"^^ . _:genid7883 . _:genid7883 . _:genid7883 . _:genid7883 "A type of in vivo farnesylation assay evidence that is used in an automatic assertion."^^ . _:genid7883 "ECO:RCT"^^ . . _:genid7884 . _:genid7885 . _:genid7887 _:genid7886 . _:genid7885 _:genid7887 . _:genid7886 . _:genid7886 . _:genid7886 . _:genid7887 . _:genid7884 _:genid7885 . _:genid7884 . . . "IEA"^^ . "A type of in vivo methylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007418"^^ . "in vivo methylation assay evidence used in automatic assertion"^^ . _:genid7888 . _:genid7888 . _:genid7888 . _:genid7888 . _:genid7888 "true"^^ . _:genid7889 . _:genid7889 . _:genid7889 . _:genid7889 . _:genid7889 "true"^^ . _:genid7890 . _:genid7890 . _:genid7890 . _:genid7890 "A type of in vivo methylation assay evidence that is used in an automatic assertion."^^ . _:genid7890 "ECO:RCT"^^ . . _:genid7891 . _:genid7892 . _:genid7894 _:genid7893 . _:genid7892 _:genid7894 . _:genid7893 . _:genid7893 . _:genid7893 . _:genid7894 . _:genid7891 _:genid7892 . _:genid7891 . . . "IEA"^^ . "A type of in vivo palmitoylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007419"^^ . "in vivo palmitoylation assay evidence used in automatic assertion"^^ . _:genid7895 . _:genid7895 . _:genid7895 . _:genid7895 . _:genid7895 "true"^^ . _:genid7896 . _:genid7896 . _:genid7896 . _:genid7896 . _:genid7896 "true"^^ . _:genid7897 . _:genid7897 . _:genid7897 . _:genid7897 "A type of in vivo palmitoylation assay evidence that is used in an automatic assertion."^^ . _:genid7897 "ECO:RCT"^^ . . _:genid7898 . _:genid7899 . _:genid7901 _:genid7900 . _:genid7899 _:genid7901 . _:genid7900 . _:genid7900 . _:genid7900 . _:genid7901 . _:genid7898 _:genid7899 . _:genid7898 . . . "IEA"^^ . "A type of in vivo phosphatase assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007420"^^ . "in vivo phosphatase assay evidence used in automatic assertion"^^ . _:genid7902 . _:genid7902 . _:genid7902 . _:genid7902 . _:genid7902 "true"^^ . _:genid7903 . _:genid7903 . _:genid7903 . _:genid7903 . _:genid7903 "true"^^ . _:genid7904 . _:genid7904 . _:genid7904 . _:genid7904 "A type of in vivo phosphatase assay evidence that is used in an automatic assertion."^^ . _:genid7904 "ECO:RCT"^^ . . _:genid7905 . _:genid7906 . _:genid7908 _:genid7907 . _:genid7906 _:genid7908 . _:genid7907 . _:genid7907 . _:genid7907 . _:genid7908 . _:genid7905 _:genid7906 . _:genid7905 . . . "IEA"^^ . "A type of in vivo protein kinase assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007421"^^ . "in vivo protein kinase assay evidence used in automatic assertion"^^ . _:genid7909 . _:genid7909 . _:genid7909 . _:genid7909 . _:genid7909 "true"^^ . _:genid7910 . _:genid7910 . _:genid7910 . _:genid7910 . _:genid7910 "true"^^ . _:genid7911 . _:genid7911 . _:genid7911 . _:genid7911 "A type of in vivo protein kinase assay evidence that is used in an automatic assertion."^^ . _:genid7911 "ECO:RCT"^^ . . _:genid7912 . _:genid7913 . _:genid7915 _:genid7914 . _:genid7913 _:genid7915 . _:genid7914 . _:genid7914 . _:genid7914 . _:genid7915 . _:genid7912 _:genid7913 . _:genid7912 . . . "IEA"^^ . "A type of in vivo sumoylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007422"^^ . "in vivo sumoylation assay evidence used in automatic assertion"^^ . _:genid7916 . _:genid7916 . _:genid7916 . _:genid7916 . _:genid7916 "true"^^ . _:genid7917 . _:genid7917 . _:genid7917 . _:genid7917 . _:genid7917 "true"^^ . _:genid7918 . _:genid7918 . _:genid7918 . _:genid7918 "A type of in vivo sumoylation assay evidence that is used in an automatic assertion."^^ . _:genid7918 "ECO:RCT"^^ . . _:genid7919 . _:genid7920 . _:genid7922 _:genid7921 . _:genid7920 _:genid7922 . _:genid7921 . _:genid7921 . _:genid7921 . _:genid7922 . _:genid7919 _:genid7920 . _:genid7919 . . . "IEA"^^ . "A type of in vivo transcription assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007423"^^ . "in vivo transcription assay evidence used in automatic assertion"^^ . _:genid7923 . _:genid7923 . _:genid7923 . _:genid7923 . _:genid7923 "true"^^ . _:genid7924 . _:genid7924 . _:genid7924 . _:genid7924 . _:genid7924 "true"^^ . _:genid7925 . _:genid7925 . _:genid7925 . _:genid7925 "A type of in vivo transcription assay evidence that is used in an automatic assertion."^^ . _:genid7925 "ECO:RCT"^^ . . _:genid7926 . _:genid7927 . _:genid7929 _:genid7928 . _:genid7927 _:genid7929 . _:genid7928 . _:genid7928 . _:genid7928 . _:genid7929 . _:genid7926 _:genid7927 . _:genid7926 . . . "IEA"^^ . "A type of in vivo translation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007424"^^ . "in vivo translation assay evidence used in automatic assertion"^^ . _:genid7930 . _:genid7930 . _:genid7930 . _:genid7930 . _:genid7930 "true"^^ . _:genid7931 . _:genid7931 . _:genid7931 . _:genid7931 . _:genid7931 "true"^^ . _:genid7932 . _:genid7932 . _:genid7932 . _:genid7932 "A type of in vivo translation assay evidence that is used in an automatic assertion."^^ . _:genid7932 "ECO:RCT"^^ . . _:genid7933 . _:genid7934 . _:genid7936 _:genid7935 . _:genid7934 _:genid7936 . _:genid7935 . _:genid7935 . _:genid7935 . _:genid7936 . _:genid7933 _:genid7934 . _:genid7933 . . . "IEA"^^ . "A type of in vivo ubiquitination assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007425"^^ . "in vivo ubiquitination assay evidence used in automatic assertion"^^ . _:genid7937 . _:genid7937 . _:genid7937 . _:genid7937 . _:genid7937 "true"^^ . _:genid7938 . _:genid7938 . _:genid7938 . _:genid7938 . _:genid7938 "true"^^ . _:genid7939 . _:genid7939 . _:genid7939 . _:genid7939 "A type of in vivo ubiquitination assay evidence that is used in an automatic assertion."^^ . _:genid7939 "ECO:RCT"^^ . . "A type of induced mutation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007426"^^ . "induced mutation evidence used in automatic assertion"^^ . "true"^^ . _:genid7940 . _:genid7940 . _:genid7940 . _:genid7940 "A type of induced mutation evidence that is used in an automatic assertion."^^ . _:genid7940 "ECO:RCT"^^ . . _:genid7941 . _:genid7942 . _:genid7944 _:genid7943 . _:genid7942 _:genid7944 . _:genid7943 . _:genid7943 . _:genid7943 . _:genid7944 . _:genid7941 _:genid7942 . _:genid7941 . . . "IEA"^^ . "A type of genetic transformation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007427"^^ . "genetic transformation evidence used in automatic assertion"^^ . _:genid7945 . _:genid7945 . _:genid7945 . _:genid7945 . _:genid7945 "true"^^ . _:genid7946 . _:genid7946 . _:genid7946 . _:genid7946 . _:genid7946 "true"^^ . _:genid7947 . _:genid7947 . _:genid7947 . _:genid7947 "A type of genetic transformation evidence that is used in an automatic assertion."^^ . _:genid7947 "ECO:RCT"^^ . . _:genid7948 . _:genid7949 . _:genid7951 _:genid7950 . _:genid7949 _:genid7951 . _:genid7950 . _:genid7950 . _:genid7950 . _:genid7951 . _:genid7948 _:genid7949 . _:genid7948 . . . "IEA"^^ . "A type of lipid binding assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007428"^^ . "lipid binding assay evidence used in automatic assertion"^^ . _:genid7952 . _:genid7952 . _:genid7952 . _:genid7952 . _:genid7952 "true"^^ . _:genid7953 . _:genid7953 . _:genid7953 . _:genid7953 . _:genid7953 "true"^^ . _:genid7954 . _:genid7954 . _:genid7954 . _:genid7954 "A type of lipid binding assay evidence that is used in an automatic assertion."^^ . _:genid7954 "ECO:RCT"^^ . . _:genid7955 . _:genid7956 . _:genid7958 _:genid7957 . _:genid7956 _:genid7958 . _:genid7957 . _:genid7957 . _:genid7957 . _:genid7958 . _:genid7955 _:genid7956 . _:genid7955 . . . "IEA"^^ . "A type of luminescence-based mammalian interactome mapping assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007429"^^ . "luminescence-based mammalian interactome mapping assay evidence used in automatic assertion"^^ . _:genid7959 . _:genid7959 . _:genid7959 . _:genid7959 . _:genid7959 "true"^^ . _:genid7960 . _:genid7960 . _:genid7960 . _:genid7960 . _:genid7960 "true"^^ . _:genid7961 . _:genid7961 . _:genid7961 . _:genid7961 "A type of luminescence-based mammalian interactome mapping assay evidence that is used in an automatic assertion."^^ . _:genid7961 "ECO:RCT"^^ . . _:genid7962 . _:genid7963 . _:genid7965 _:genid7964 . _:genid7963 _:genid7965 . _:genid7964 . _:genid7964 . _:genid7964 . _:genid7965 . _:genid7962 _:genid7963 . _:genid7962 . . . "IEA"^^ . "A type of macroscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007430"^^ . "macroscopy evidence used in automatic assertion"^^ . _:genid7966 . _:genid7966 . _:genid7966 . _:genid7966 . _:genid7966 "true"^^ . _:genid7967 . _:genid7967 . _:genid7967 . _:genid7967 . _:genid7967 "true"^^ . _:genid7968 . _:genid7968 . _:genid7968 . _:genid7968 "A type of macroscopy evidence that is used in an automatic assertion."^^ . _:genid7968 "ECO:RCT"^^ . . _:genid7969 . _:genid7970 . _:genid7972 _:genid7971 . _:genid7970 _:genid7972 . _:genid7971 . _:genid7971 . _:genid7971 . _:genid7972 . _:genid7969 _:genid7970 . _:genid7969 . . . "IEA"^^ . "A type of mammalian 2-hybrid assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007431"^^ . "mammalian 2-hybrid assay evidence used in automatic assertion"^^ . _:genid7973 . _:genid7973 . _:genid7973 . _:genid7973 . _:genid7973 "true"^^ . _:genid7974 . _:genid7974 . _:genid7974 . _:genid7974 . _:genid7974 "true"^^ . _:genid7975 . _:genid7975 . _:genid7975 . _:genid7975 "A type of mammalian 2-hybrid assay evidence that is used in an automatic assertion."^^ . _:genid7975 "ECO:RCT"^^ . . _:genid7976 . _:genid7977 . _:genid7979 _:genid7978 . _:genid7977 _:genid7979 . _:genid7978 . _:genid7978 . _:genid7978 . _:genid7979 . _:genid7976 _:genid7977 . _:genid7976 . . . "IEA"^^ . "A type of bait-prey hybrid interaction evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "bait-prey protein pull-down evidence"^^ . "eco"^^ . "ECO:0007432"^^ . "bait-prey hybrid interaction evidence used in automatic assertion"^^ . _:genid7980 . _:genid7980 . _:genid7980 . _:genid7980 . _:genid7980 "true"^^ . _:genid7981 . _:genid7981 . _:genid7981 . _:genid7981 . _:genid7981 "true"^^ . _:genid7982 . _:genid7982 . _:genid7982 . _:genid7982 "A type of bait-prey hybrid interaction evidence that is used in an automatic assertion."^^ . _:genid7982 "ECO:RCT"^^ . . _:genid7983 . _:genid7984 . _:genid7986 _:genid7985 . _:genid7984 _:genid7986 . _:genid7985 . _:genid7985 . _:genid7985 . _:genid7986 . _:genid7983 _:genid7984 . _:genid7983 . . . "IEA"^^ . "A type of mass spectrometry evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007433"^^ . "mass spectrometry evidence used in automatic assertion"^^ . _:genid7987 . _:genid7987 . _:genid7987 . _:genid7987 . _:genid7987 "true"^^ . _:genid7988 . _:genid7988 . _:genid7988 . _:genid7988 . _:genid7988 "true"^^ . _:genid7989 . _:genid7989 . _:genid7989 . _:genid7989 "A type of mass spectrometry evidence that is used in an automatic assertion."^^ . _:genid7989 "ECO:RCT"^^ . . _:genid7990 . _:genid7991 . _:genid7993 _:genid7992 . _:genid7991 _:genid7993 . _:genid7992 . _:genid7992 . _:genid7992 . _:genid7993 . _:genid7990 _:genid7991 . _:genid7990 . . . "IEA"^^ . "A type of medical imaging evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007434"^^ . "medical imaging evidence used in automatic assertion"^^ . _:genid7994 . _:genid7994 . _:genid7994 . _:genid7994 . _:genid7994 "true"^^ . _:genid7995 . _:genid7995 . _:genid7995 . _:genid7995 . _:genid7995 "true"^^ . _:genid7996 . _:genid7996 . _:genid7996 . _:genid7996 "A type of medical imaging evidence that is used in an automatic assertion."^^ . _:genid7996 "ECO:RCT"^^ . . _:genid7997 . _:genid7998 . _:genid8000 _:genid7999 . _:genid7998 _:genid8000 . _:genid7999 . _:genid7999 . _:genid7999 . _:genid8000 . _:genid7997 _:genid7998 . _:genid7997 . . . "IEA"^^ . "A type of microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007435"^^ . "microscopy evidence used in automatic assertion"^^ . _:genid8001 . _:genid8001 . _:genid8001 . _:genid8001 . _:genid8001 "true"^^ . _:genid8002 . _:genid8002 . _:genid8002 . _:genid8002 . _:genid8002 "true"^^ . _:genid8003 . _:genid8003 . _:genid8003 . _:genid8003 "A type of microscopy evidence that is used in an automatic assertion."^^ . _:genid8003 "ECO:RCT"^^ . . _:genid8004 . _:genid8005 . _:genid8007 _:genid8006 . _:genid8005 _:genid8007 . _:genid8006 . _:genid8006 . _:genid8006 . _:genid8007 . _:genid8004 _:genid8005 . _:genid8004 . . . "IEA"^^ . "A type of motility wound healing assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007436"^^ . "motility wound healing assay evidence used in automatic assertion"^^ . _:genid8008 . _:genid8008 . _:genid8008 . _:genid8008 . _:genid8008 "true"^^ . _:genid8009 . _:genid8009 . _:genid8009 . _:genid8009 . _:genid8009 "true"^^ . _:genid8010 . _:genid8010 . _:genid8010 . _:genid8010 "A type of motility wound healing assay evidence that is used in an automatic assertion."^^ . _:genid8010 "ECO:RCT"^^ . . _:genid8011 . _:genid8012 . _:genid8014 _:genid8013 . _:genid8012 _:genid8014 . _:genid8013 . _:genid8013 . _:genid8013 . _:genid8014 . _:genid8011 _:genid8012 . _:genid8011 . . . "IEA"^^ . "A type of MTS assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007437"^^ . "MTS assay evidence used in automatic assertion"^^ . _:genid8015 . _:genid8015 . _:genid8015 . _:genid8015 . _:genid8015 "true"^^ . _:genid8016 . _:genid8016 . _:genid8016 . _:genid8016 . _:genid8016 "true"^^ . _:genid8017 . _:genid8017 . _:genid8017 . _:genid8017 "A type of MTS assay evidence that is used in an automatic assertion."^^ . _:genid8017 "ECO:RCT"^^ . . _:genid8018 . _:genid8019 . _:genid8021 _:genid8020 . _:genid8019 _:genid8021 . _:genid8020 . _:genid8020 . _:genid8020 . _:genid8021 . _:genid8018 _:genid8019 . _:genid8018 . . . "IEA"^^ . "A type of MTT assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007438"^^ . "MTT assay evidence used in automatic assertion"^^ . _:genid8022 . _:genid8022 . _:genid8022 . _:genid8022 . _:genid8022 "true"^^ . _:genid8023 . _:genid8023 . _:genid8023 . _:genid8023 . _:genid8023 "true"^^ . _:genid8024 . _:genid8024 . _:genid8024 . _:genid8024 "A type of MTT assay evidence that is used in an automatic assertion."^^ . _:genid8024 "ECO:RCT"^^ . . _:genid8025 . _:genid8026 . _:genid8028 _:genid8027 . _:genid8026 _:genid8028 . _:genid8027 . _:genid8027 . _:genid8027 . _:genid8028 . _:genid8025 _:genid8026 . _:genid8025 . . . "IEA"^^ . "A type of multiplex bead-based immunoassay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007439"^^ . "multiplex bead-based immunoassay evidence used in automatic assertion"^^ . _:genid8029 . _:genid8029 . _:genid8029 . _:genid8029 . _:genid8029 "true"^^ . _:genid8030 . _:genid8030 . _:genid8030 . _:genid8030 . _:genid8030 "true"^^ . _:genid8031 . _:genid8031 . _:genid8031 . _:genid8031 "A type of multiplex bead-based immunoassay evidence that is used in an automatic assertion."^^ . _:genid8031 "ECO:RCT"^^ . . _:genid8032 . _:genid8033 . _:genid8035 _:genid8034 . _:genid8033 _:genid8035 . _:genid8034 . _:genid8034 . _:genid8034 . _:genid8035 . _:genid8032 _:genid8033 . _:genid8032 . . . "IEA"^^ . "A type of natural variation mutant evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007440"^^ . "natural variation mutant evidence used in automatic assertion"^^ . _:genid8036 . _:genid8036 . _:genid8036 . _:genid8036 . _:genid8036 "true"^^ . _:genid8037 . _:genid8037 . _:genid8037 . _:genid8037 . _:genid8037 "true"^^ . _:genid8038 . _:genid8038 . _:genid8038 . _:genid8038 "A type of natural variation mutant evidence that is used in an automatic assertion."^^ . _:genid8038 "ECO:RCT"^^ . . _:genid8039 . _:genid8040 . _:genid8042 _:genid8041 . _:genid8040 _:genid8042 . _:genid8041 . _:genid8041 . _:genid8041 . _:genid8042 . _:genid8039 _:genid8040 . _:genid8039 . . . "IEA"^^ . "A type of nuclear magnetic resonance evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007441"^^ . "nuclear magnetic resonance evidence used in automatic assertion"^^ . _:genid8043 . _:genid8043 . _:genid8043 . _:genid8043 . _:genid8043 "true"^^ . _:genid8044 . _:genid8044 . _:genid8044 . _:genid8044 . _:genid8044 "true"^^ . _:genid8045 . _:genid8045 . _:genid8045 . _:genid8045 "A type of nuclear magnetic resonance evidence that is used in an automatic assertion."^^ . _:genid8045 "ECO:RCT"^^ . . _:genid8046 . _:genid8047 . _:genid8049 _:genid8048 . _:genid8047 _:genid8049 . _:genid8048 . _:genid8048 . _:genid8048 . _:genid8049 . _:genid8046 _:genid8047 . _:genid8046 . . . "IEA"^^ . "A type of nuclear fragmentation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007442"^^ . "nuclear fragmentation evidence used in automatic assertion"^^ . _:genid8050 . _:genid8050 . _:genid8050 . _:genid8050 . _:genid8050 "true"^^ . _:genid8051 . _:genid8051 . _:genid8051 . _:genid8051 . _:genid8051 "true"^^ . _:genid8052 . _:genid8052 . _:genid8052 . _:genid8052 "A type of nuclear fragmentation evidence that is used in an automatic assertion."^^ . _:genid8052 "ECO:RCT"^^ . . _:genid8053 . _:genid8054 . _:genid8056 _:genid8055 . _:genid8054 _:genid8056 . _:genid8055 . _:genid8055 . _:genid8055 . _:genid8056 . _:genid8053 _:genid8054 . _:genid8053 . . . "IEA"^^ . "A type of phage display evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007443"^^ . "phage display evidence used in automatic assertion"^^ . _:genid8057 . _:genid8057 . _:genid8057 . _:genid8057 . _:genid8057 "true"^^ . _:genid8058 . _:genid8058 . _:genid8058 . _:genid8058 . _:genid8058 "true"^^ . _:genid8059 . _:genid8059 . _:genid8059 . _:genid8059 "A type of phage display evidence that is used in an automatic assertion."^^ . _:genid8059 "ECO:RCT"^^ . . _:genid8060 . _:genid8061 . _:genid8063 _:genid8062 . _:genid8061 _:genid8063 . _:genid8062 . _:genid8062 . _:genid8062 . _:genid8063 . _:genid8060 _:genid8061 . _:genid8060 . . . "IEA"^^ . "A type of phosphoamino acid analysis evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007444"^^ . "phosphoamino acid analysis evidence used in automatic assertion"^^ . _:genid8064 . _:genid8064 . _:genid8064 . _:genid8064 . _:genid8064 "true"^^ . _:genid8065 . _:genid8065 . _:genid8065 . _:genid8065 . _:genid8065 "true"^^ . _:genid8066 . _:genid8066 . _:genid8066 . _:genid8066 "A type of phosphoamino acid analysis evidence that is used in an automatic assertion."^^ . _:genid8066 "ECO:RCT"^^ . . _:genid8067 . _:genid8068 . _:genid8070 _:genid8069 . _:genid8068 _:genid8070 . _:genid8069 . _:genid8069 . _:genid8069 . _:genid8070 . _:genid8067 _:genid8068 . _:genid8067 . . . "IEA"^^ . "A type of peptide affinity enrichment evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007445"^^ . "peptide affinity enrichment evidence used in automatic assertion"^^ . _:genid8071 . _:genid8071 . _:genid8071 . _:genid8071 . _:genid8071 "true"^^ . _:genid8072 . _:genid8072 . _:genid8072 . _:genid8072 . _:genid8072 "true"^^ . _:genid8073 . _:genid8073 . _:genid8073 . _:genid8073 "A type of peptide affinity enrichment evidence that is used in an automatic assertion."^^ . _:genid8073 "ECO:RCT"^^ . . _:genid8074 . _:genid8075 . _:genid8077 _:genid8076 . _:genid8075 _:genid8077 . _:genid8076 . _:genid8076 . _:genid8076 . _:genid8077 . _:genid8074 _:genid8075 . _:genid8074 . . . "IEA"^^ . "A type of peptide array evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007446"^^ . "peptide array evidence used in automatic assertion"^^ . _:genid8078 . _:genid8078 . _:genid8078 . _:genid8078 . _:genid8078 "true"^^ . _:genid8079 . _:genid8079 . _:genid8079 . _:genid8079 . _:genid8079 "true"^^ . _:genid8080 . _:genid8080 . _:genid8080 . _:genid8080 "A type of peptide array evidence that is used in an automatic assertion."^^ . _:genid8080 "ECO:RCT"^^ . . _:genid8081 . _:genid8082 . _:genid8084 _:genid8083 . _:genid8082 _:genid8084 . _:genid8083 . _:genid8083 . _:genid8083 . _:genid8084 . _:genid8081 _:genid8082 . _:genid8081 . . . "IEA"^^ . "A type of physical examination evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007447"^^ . "physical examination evidence used in automatic assertion"^^ . _:genid8085 . _:genid8085 . _:genid8085 . _:genid8085 . _:genid8085 "true"^^ . _:genid8086 . _:genid8086 . _:genid8086 . _:genid8086 . _:genid8086 "true"^^ . _:genid8087 . _:genid8087 . _:genid8087 . _:genid8087 "A type of physical examination evidence that is used in an automatic assertion."^^ . _:genid8087 "ECO:RCT"^^ . . _:genid8088 . _:genid8089 . _:genid8091 _:genid8090 . _:genid8089 _:genid8091 . _:genid8090 . _:genid8090 . _:genid8090 . _:genid8091 . _:genid8088 _:genid8089 . _:genid8088 . . . "IEA"^^ . "A type of point mutation phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "point mutation evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007448"^^ . "point mutation phenotypic evidence used in automatic assertion"^^ . _:genid8092 . _:genid8092 . _:genid8092 . _:genid8092 . _:genid8092 "true"^^ . _:genid8093 . _:genid8093 . _:genid8093 . _:genid8093 . _:genid8093 "true"^^ . _:genid8094 . _:genid8094 . _:genid8094 . _:genid8094 "A type of point mutation phenotypic evidence that is used in an automatic assertion."^^ . _:genid8094 "ECO:RCT"^^ . . _:genid8095 . _:genid8096 . _:genid8098 _:genid8097 . _:genid8096 _:genid8098 . _:genid8097 . _:genid8097 . _:genid8097 . _:genid8098 . _:genid8095 _:genid8096 . _:genid8095 . . . "IEA"^^ . "A type of propidium iodide staining evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007449"^^ . "propidium iodide staining evidence used in automatic assertion"^^ . _:genid8099 . _:genid8099 . _:genid8099 . _:genid8099 . _:genid8099 "true"^^ . _:genid8100 . _:genid8100 . _:genid8100 . _:genid8100 . _:genid8100 "true"^^ . _:genid8101 . _:genid8101 . _:genid8101 . _:genid8101 "A type of propidium iodide staining evidence that is used in an automatic assertion."^^ . _:genid8101 "ECO:RCT"^^ . . _:genid8102 . _:genid8103 . _:genid8105 _:genid8104 . _:genid8103 _:genid8105 . _:genid8104 . _:genid8104 . _:genid8104 . _:genid8105 . _:genid8102 _:genid8103 . _:genid8102 . . . "IEA"^^ . "A type of fluorescence evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007450"^^ . "fluorescence evidence used in automatic assertion"^^ . _:genid8106 . _:genid8106 . _:genid8106 . _:genid8106 . _:genid8106 "true"^^ . _:genid8107 . _:genid8107 . _:genid8107 . _:genid8107 . _:genid8107 "true"^^ . _:genid8108 . _:genid8108 . _:genid8108 . _:genid8108 "A type of fluorescence evidence that is used in an automatic assertion."^^ . _:genid8108 "ECO:RCT"^^ . . _:genid8109 . _:genid8110 . _:genid8112 _:genid8111 . _:genid8110 _:genid8112 . _:genid8111 . _:genid8111 . _:genid8111 . _:genid8112 . _:genid8109 _:genid8110 . _:genid8109 . . . "IEA"^^ . "A type of protein dot blot assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007451"^^ . "protein dot blot assay evidence used in automatic assertion"^^ . _:genid8113 . _:genid8113 . _:genid8113 . _:genid8113 . _:genid8113 "true"^^ . _:genid8114 . _:genid8114 . _:genid8114 . _:genid8114 . _:genid8114 "true"^^ . _:genid8115 . _:genid8115 . _:genid8115 . _:genid8115 "A type of protein dot blot assay evidence that is used in an automatic assertion."^^ . _:genid8115 "ECO:RCT"^^ . . _:genid8116 . _:genid8117 . _:genid8119 _:genid8118 . _:genid8117 _:genid8119 . _:genid8118 . _:genid8118 . _:genid8118 . _:genid8119 . _:genid8116 _:genid8117 . _:genid8116 . . . "IEA"^^ . "A type of protein microarray evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007452"^^ . "protein microarray evidence used in automatic assertion"^^ . _:genid8120 . _:genid8120 . _:genid8120 . _:genid8120 . _:genid8120 "true"^^ . _:genid8121 . _:genid8121 . _:genid8121 . _:genid8121 . _:genid8121 "true"^^ . _:genid8122 . _:genid8122 . _:genid8122 . _:genid8122 "A type of protein microarray evidence that is used in an automatic assertion."^^ . _:genid8122 "ECO:RCT"^^ . . _:genid8123 . _:genid8124 . _:genid8126 _:genid8125 . _:genid8124 _:genid8126 . _:genid8125 . _:genid8125 . _:genid8125 . _:genid8126 . _:genid8123 _:genid8124 . _:genid8123 . . . "IEA"^^ . "A type of protein sequencing assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007453"^^ . "protein sequencing assay evidence used in automatic assertion"^^ . _:genid8127 . _:genid8127 . _:genid8127 . _:genid8127 . _:genid8127 "true"^^ . _:genid8128 . _:genid8128 . _:genid8128 . _:genid8128 . _:genid8128 "true"^^ . _:genid8129 . _:genid8129 . _:genid8129 . _:genid8129 "A type of protein sequencing assay evidence that is used in an automatic assertion."^^ . _:genid8129 "ECO:RCT"^^ . . _:genid8130 . _:genid8131 . _:genid8133 _:genid8132 . _:genid8131 _:genid8133 . _:genid8132 . _:genid8132 . _:genid8132 . _:genid8133 . _:genid8130 _:genid8131 . _:genid8130 . . . "IEA"^^ . "A type of quantitative mass spectrometry evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007454"^^ . "quantitative mass spectrometry evidence used in automatic assertion"^^ . _:genid8134 . _:genid8134 . _:genid8134 . _:genid8134 . _:genid8134 "true"^^ . _:genid8135 . _:genid8135 . _:genid8135 . _:genid8135 . _:genid8135 "true"^^ . _:genid8136 . _:genid8136 . _:genid8136 . _:genid8136 "A type of quantitative mass spectrometry evidence that is used in an automatic assertion."^^ . _:genid8136 "ECO:RCT"^^ . . _:genid8137 . _:genid8138 . _:genid8140 _:genid8139 . _:genid8138 _:genid8140 . _:genid8139 . _:genid8139 . _:genid8139 . _:genid8140 . _:genid8137 _:genid8138 . _:genid8137 . . . "IEA"^^ . "A type of radioisotope assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007455"^^ . "radioisotope assay evidence used in automatic assertion"^^ . _:genid8141 . _:genid8141 . _:genid8141 . _:genid8141 . _:genid8141 "true"^^ . _:genid8142 . _:genid8142 . _:genid8142 . _:genid8142 . _:genid8142 "true"^^ . _:genid8143 . _:genid8143 . _:genid8143 . _:genid8143 "A type of radioisotope assay evidence that is used in an automatic assertion."^^ . _:genid8143 "ECO:RCT"^^ . . _:genid8144 . _:genid8145 . _:genid8147 _:genid8146 . _:genid8145 _:genid8147 . _:genid8146 . _:genid8146 . _:genid8146 . _:genid8147 . _:genid8144 _:genid8145 . _:genid8144 . . . "IEA"^^ . "A type of radioimmunoassay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007456"^^ . "radioimmunoassay evidence used in automatic assertion"^^ . _:genid8148 . _:genid8148 . _:genid8148 . _:genid8148 . _:genid8148 "true"^^ . _:genid8149 . _:genid8149 . _:genid8149 . _:genid8149 . _:genid8149 "true"^^ . _:genid8150 . _:genid8150 . _:genid8150 . _:genid8150 "A type of radioimmunoassay evidence that is used in an automatic assertion."^^ . _:genid8150 "ECO:RCT"^^ . . _:genid8151 . _:genid8152 . _:genid8154 _:genid8153 . _:genid8152 _:genid8154 . _:genid8153 . _:genid8153 . _:genid8153 . _:genid8154 . _:genid8151 _:genid8152 . _:genid8151 . . . "IEA"^^ . "A type of restriction fragment detection evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007457"^^ . "restriction fragment detection evidence used in automatic assertion"^^ . _:genid8155 . _:genid8155 . _:genid8155 . _:genid8155 . _:genid8155 "true"^^ . _:genid8156 . _:genid8156 . _:genid8156 . _:genid8156 . _:genid8156 "true"^^ . _:genid8157 . _:genid8157 . _:genid8157 . _:genid8157 "A type of restriction fragment detection evidence that is used in an automatic assertion."^^ . _:genid8157 "ECO:RCT"^^ . . _:genid8158 . _:genid8159 . _:genid8161 _:genid8160 . _:genid8159 _:genid8161 . _:genid8160 . _:genid8160 . _:genid8160 . _:genid8161 . _:genid8158 _:genid8159 . _:genid8158 . . . "IEA"^^ . "A type of spectrophotometry evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007458"^^ . "spectrophotometry evidence used in automatic assertion"^^ . _:genid8162 . _:genid8162 . _:genid8162 . _:genid8162 . _:genid8162 "true"^^ . _:genid8163 . _:genid8163 . _:genid8163 . _:genid8163 . _:genid8163 "true"^^ . _:genid8164 . _:genid8164 . _:genid8164 . _:genid8164 "A type of spectrophotometry evidence that is used in an automatic assertion."^^ . _:genid8164 "ECO:RCT"^^ . . _:genid8165 . _:genid8166 . _:genid8168 _:genid8167 . _:genid8166 _:genid8168 . _:genid8167 . _:genid8167 . _:genid8167 . _:genid8168 . _:genid8165 _:genid8166 . _:genid8165 . . . "IEA"^^ . "A type of syngeneic transplantation experiment evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007459"^^ . "syngeneic transplantation experiment evidence used in automatic assertion"^^ . _:genid8169 . _:genid8169 . _:genid8169 . _:genid8169 . _:genid8169 "true"^^ . _:genid8170 . _:genid8170 . _:genid8170 . _:genid8170 . _:genid8170 "true"^^ . _:genid8171 . _:genid8171 . _:genid8171 . _:genid8171 "A type of syngeneic transplantation experiment evidence that is used in an automatic assertion."^^ . _:genid8171 "ECO:RCT"^^ . . _:genid8172 . _:genid8173 . _:genid8175 _:genid8174 . _:genid8173 _:genid8175 . _:genid8174 . _:genid8174 . _:genid8174 . _:genid8175 . _:genid8172 _:genid8173 . _:genid8172 . . . "IEA"^^ . "A type of xenotransplantation phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "xenotransplantation experiment evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007460"^^ . "xenotransplantation phenotypic evidence used in automatic assertion"^^ . _:genid8176 . _:genid8176 . _:genid8176 . _:genid8176 . _:genid8176 "true"^^ . _:genid8177 . _:genid8177 . _:genid8177 . _:genid8177 . _:genid8177 "true"^^ . _:genid8178 . _:genid8178 . _:genid8178 . _:genid8178 "A type of xenotransplantation phenotypic evidence that is used in an automatic assertion."^^ . _:genid8178 "ECO:RCT"^^ . . _:genid8179 . _:genid8180 . _:genid8182 _:genid8181 . _:genid8180 _:genid8182 . _:genid8181 . _:genid8181 . _:genid8181 . _:genid8182 . _:genid8179 _:genid8180 . _:genid8179 . . . "IEA"^^ . "A type of WST-1 assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007461"^^ . "WST-1 assay evidence used in automatic assertion"^^ . _:genid8183 . _:genid8183 . _:genid8183 . _:genid8183 . _:genid8183 "true"^^ . _:genid8184 . _:genid8184 . _:genid8184 . _:genid8184 . _:genid8184 "true"^^ . _:genid8185 . _:genid8185 . _:genid8185 . _:genid8185 "A type of WST-1 assay evidence that is used in an automatic assertion."^^ . _:genid8185 "ECO:RCT"^^ . . _:genid8186 . _:genid8187 . _:genid8189 _:genid8188 . _:genid8187 _:genid8189 . _:genid8188 . _:genid8188 . _:genid8188 . _:genid8189 . _:genid8186 _:genid8187 . _:genid8186 . . . "IEA"^^ . "A type of urine test evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007462"^^ . "urine test evidence used in automatic assertion"^^ . _:genid8190 . _:genid8190 . _:genid8190 . _:genid8190 . _:genid8190 "true"^^ . _:genid8191 . _:genid8191 . _:genid8191 . _:genid8191 . _:genid8191 "true"^^ . _:genid8192 . _:genid8192 . _:genid8192 . _:genid8192 "A type of urine test evidence that is used in an automatic assertion."^^ . _:genid8192 "ECO:RCT"^^ . . _:genid8193 . _:genid8194 . _:genid8196 _:genid8195 . _:genid8194 _:genid8196 . _:genid8195 . _:genid8195 . _:genid8195 . _:genid8196 . _:genid8193 _:genid8194 . _:genid8193 . . . "IEA"^^ . "A type of terminal deoxynucleotidyl transferase dUTP nick end labeling assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007463"^^ . "terminal deoxynucleotidyl transferase dUTP nick end labeling assay evidence used in automatic assertion"^^ . _:genid8197 . _:genid8197 . _:genid8197 . _:genid8197 . _:genid8197 "true"^^ . _:genid8198 . _:genid8198 . _:genid8198 . _:genid8198 . _:genid8198 "true"^^ . _:genid8199 . _:genid8199 . _:genid8199 . _:genid8199 "A type of terminal deoxynucleotidyl transferase dUTP nick end labeling assay evidence that is used in an automatic assertion."^^ . _:genid8199 "ECO:RCT"^^ . . _:genid8200 . _:genid8201 . _:genid8203 _:genid8202 . _:genid8201 _:genid8203 . _:genid8202 . _:genid8202 . _:genid8202 . _:genid8203 . _:genid8200 _:genid8201 . _:genid8200 . . . "IEA"^^ . "A type of tryptic phosphopeptide mapping assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007464"^^ . "tryptic phosphopeptide mapping assay evidence used in automatic assertion"^^ . _:genid8204 . _:genid8204 . _:genid8204 . _:genid8204 . _:genid8204 "true"^^ . _:genid8205 . _:genid8205 . _:genid8205 . _:genid8205 . _:genid8205 "true"^^ . _:genid8206 . _:genid8206 . _:genid8206 . _:genid8206 "A type of tryptic phosphopeptide mapping assay evidence that is used in an automatic assertion."^^ . _:genid8206 "ECO:RCT"^^ . . _:genid8207 . _:genid8208 . _:genid8210 _:genid8209 . _:genid8208 _:genid8210 . _:genid8209 . _:genid8209 . _:genid8209 . _:genid8210 . _:genid8207 _:genid8208 . _:genid8207 . . . "IEA"^^ . "A type of transgenic organism evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007465"^^ . "transgenic organism evidence used in automatic assertion"^^ . _:genid8211 . _:genid8211 . _:genid8211 . _:genid8211 . _:genid8211 "true"^^ . _:genid8212 . _:genid8212 . _:genid8212 . _:genid8212 . _:genid8212 "true"^^ . _:genid8213 . _:genid8213 . _:genid8213 . _:genid8213 "A type of transgenic organism evidence that is used in an automatic assertion."^^ . _:genid8213 "ECO:RCT"^^ . . _:genid8214 . _:genid8215 . _:genid8217 _:genid8216 . _:genid8215 _:genid8217 . _:genid8216 . _:genid8216 . _:genid8216 . _:genid8217 . _:genid8214 _:genid8215 . _:genid8214 . . . "IEA"^^ . "A type of tissue microarray evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007466"^^ . "tissue microarray evidence used in automatic assertion"^^ . _:genid8218 . _:genid8218 . _:genid8218 . _:genid8218 . _:genid8218 "true"^^ . _:genid8219 . _:genid8219 . _:genid8219 . _:genid8219 . _:genid8219 "true"^^ . _:genid8220 . _:genid8220 . _:genid8220 . _:genid8220 "A type of tissue microarray evidence that is used in an automatic assertion."^^ . _:genid8220 "ECO:RCT"^^ . . _:genid8221 . _:genid8222 . _:genid8224 _:genid8223 . _:genid8222 _:genid8224 . _:genid8223 . _:genid8223 . _:genid8223 . _:genid8224 . _:genid8221 _:genid8222 . _:genid8221 . . . "IEA"^^ . "A type of TACE activity assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007467"^^ . "TACE activity assay evidence used in automatic assertion"^^ . _:genid8225 . _:genid8225 . _:genid8225 . _:genid8225 . _:genid8225 "true"^^ . _:genid8226 . _:genid8226 . _:genid8226 . _:genid8226 . _:genid8226 "true"^^ . _:genid8227 . _:genid8227 . _:genid8227 . _:genid8227 "A type of TACE activity assay evidence that is used in an automatic assertion."^^ . _:genid8227 "ECO:RCT"^^ . . _:genid8228 . _:genid8229 . _:genid8231 _:genid8230 . _:genid8229 _:genid8231 . _:genid8230 . _:genid8230 . _:genid8230 . _:genid8231 . _:genid8228 _:genid8229 . _:genid8228 . . . "IEA"^^ . "A type of enzyme assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007468"^^ . "enzymatic activity assay evidence used in automatic assertion"^^ . _:genid8232 . _:genid8232 . _:genid8232 . _:genid8232 . _:genid8232 "true"^^ . _:genid8233 . _:genid8233 . _:genid8233 . _:genid8233 . _:genid8233 "true"^^ . _:genid8234 . _:genid8234 . _:genid8234 . _:genid8234 "A type of enzyme assay evidence that is used in an automatic assertion."^^ . _:genid8234 "ECO:RCT"^^ . . _:genid8235 . _:genid8236 . _:genid8238 _:genid8237 . _:genid8236 _:genid8238 . _:genid8237 . _:genid8237 . _:genid8237 . _:genid8238 . _:genid8235 _:genid8236 . _:genid8235 . . . "IEA"^^ . "A type of surface plasmon resonance evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007469"^^ . "surface plasmon resonance evidence used in automatic assertion"^^ . _:genid8239 . _:genid8239 . _:genid8239 . _:genid8239 . _:genid8239 "true"^^ . _:genid8240 . _:genid8240 . _:genid8240 . _:genid8240 . _:genid8240 "true"^^ . _:genid8241 . _:genid8241 . _:genid8241 . _:genid8241 "A type of surface plasmon resonance evidence that is used in an automatic assertion."^^ . _:genid8241 "ECO:RCT"^^ . . _:genid8242 . _:genid8243 . _:genid8245 _:genid8244 . _:genid8243 _:genid8245 . _:genid8244 . _:genid8244 . _:genid8244 . _:genid8245 . _:genid8242 _:genid8243 . _:genid8242 . . . "IEA"^^ . "A type of restriction landmark genomic scanning evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007470"^^ . "restriction landmark genomic scanning evidence used in automatic assertion"^^ . _:genid8246 . _:genid8246 . _:genid8246 . _:genid8246 . _:genid8246 "true"^^ . _:genid8247 . _:genid8247 . _:genid8247 . _:genid8247 . _:genid8247 "true"^^ . _:genid8248 . _:genid8248 . _:genid8248 . _:genid8248 "A type of restriction landmark genomic scanning evidence that is used in an automatic assertion."^^ . _:genid8248 "ECO:RCT"^^ . . _:genid8249 . _:genid8250 . _:genid8252 _:genid8251 . _:genid8250 _:genid8252 . _:genid8251 . _:genid8251 . _:genid8251 . _:genid8252 . _:genid8249 _:genid8250 . _:genid8249 . . . "IEA"^^ . "A type of resonant mirror biosensor evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007471"^^ . "resonant mirror biosensor evidence used in automatic assertion"^^ . _:genid8253 . _:genid8253 . _:genid8253 . _:genid8253 . _:genid8253 "true"^^ . _:genid8254 . _:genid8254 . _:genid8254 . _:genid8254 . _:genid8254 "true"^^ . _:genid8255 . _:genid8255 . _:genid8255 . _:genid8255 "A type of resonant mirror biosensor evidence that is used in an automatic assertion."^^ . _:genid8255 "ECO:RCT"^^ . . _:genid8256 . _:genid8257 . _:genid8259 _:genid8258 . _:genid8257 _:genid8259 . _:genid8258 . _:genid8258 . _:genid8258 . _:genid8259 . _:genid8256 _:genid8257 . _:genid8256 . . . "IEA"^^ . "A type of high-performance liquid chromatography evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007472"^^ . "high-performance liquid chromatography evidence used in automatic assertion"^^ . _:genid8260 . _:genid8260 . _:genid8260 . _:genid8260 . _:genid8260 "true"^^ . _:genid8261 . _:genid8261 . _:genid8261 . _:genid8261 . _:genid8261 "true"^^ . _:genid8262 . _:genid8262 . _:genid8262 . _:genid8262 "A type of high-performance liquid chromatography evidence that is used in an automatic assertion."^^ . _:genid8262 "ECO:RCT"^^ . . _:genid8263 . _:genid8264 . _:genid8266 _:genid8265 . _:genid8264 _:genid8266 . _:genid8265 . _:genid8265 . _:genid8265 . _:genid8266 . _:genid8263 _:genid8264 . _:genid8263 . . . "IEA"^^ . "A type of ectopic expression evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007473"^^ . "ectopic expression evidence used in automatic assertion"^^ . _:genid8267 . _:genid8267 . _:genid8267 . _:genid8267 . _:genid8267 "true"^^ . _:genid8268 . _:genid8268 . _:genid8268 . _:genid8268 . _:genid8268 "true"^^ . _:genid8269 . _:genid8269 . _:genid8269 . _:genid8269 "A type of ectopic expression evidence that is used in an automatic assertion."^^ . _:genid8269 "ECO:RCT"^^ . . _:genid8270 . _:genid8271 . _:genid8273 _:genid8272 . _:genid8271 _:genid8273 . _:genid8272 . _:genid8272 . _:genid8272 . _:genid8273 . _:genid8270 _:genid8271 . _:genid8270 . . . "IEA"^^ . "A type of electrophoretic mobility shift assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007474"^^ . "electrophoretic mobility shift assay evidence used in automatic assertion"^^ . _:genid8274 . _:genid8274 . _:genid8274 . _:genid8274 . _:genid8274 "true"^^ . _:genid8275 . _:genid8275 . _:genid8275 . _:genid8275 . _:genid8275 "true"^^ . _:genid8276 . _:genid8276 . _:genid8276 . _:genid8276 "A type of electrophoretic mobility shift assay evidence that is used in an automatic assertion."^^ . _:genid8276 "ECO:RCT"^^ . . _:genid8277 . _:genid8278 . _:genid8280 _:genid8279 . _:genid8278 _:genid8280 . _:genid8279 . _:genid8279 . _:genid8279 . _:genid8280 . _:genid8277 _:genid8278 . _:genid8277 . . . "IEA"^^ . "A type of reverse transcription polymerase chain reaction evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "ECO:000108"^^ . "eco"^^ . "ECO:0007475"^^ . "reverse transcription polymerase chain reaction evidence used in automatic assertion"^^ . _:genid8281 . _:genid8281 . _:genid8281 . _:genid8281 . _:genid8281 "true"^^ . _:genid8282 . _:genid8282 . _:genid8282 . _:genid8282 . _:genid8282 "true"^^ . _:genid8283 . _:genid8283 . _:genid8283 . _:genid8283 "A type of reverse transcription polymerase chain reaction evidence that is used in an automatic assertion."^^ . _:genid8283 "ECO:RCT"^^ . . _:genid8284 . _:genid8285 . _:genid8287 _:genid8286 . _:genid8285 _:genid8287 . _:genid8286 . _:genid8286 . _:genid8286 . _:genid8287 . _:genid8284 _:genid8285 . _:genid8284 . . . "IEA"^^ . "A type of in vivo polyADP-ribosylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007476"^^ . "in vivo polyADP-ribosylation assay evidence used in automatic assertion"^^ . _:genid8288 . _:genid8288 . _:genid8288 . _:genid8288 . _:genid8288 "true"^^ . _:genid8289 . _:genid8289 . _:genid8289 . _:genid8289 . _:genid8289 "true"^^ . _:genid8290 . _:genid8290 . _:genid8290 . _:genid8290 "A type of in vivo polyADP-ribosylation assay evidence that is used in an automatic assertion."^^ . _:genid8290 "ECO:RCT"^^ . . _:genid8291 . _:genid8292 . _:genid8294 _:genid8293 . _:genid8292 _:genid8294 . _:genid8293 . _:genid8293 . _:genid8293 . _:genid8294 . _:genid8291 _:genid8292 . _:genid8291 . . . "IEA"^^ . "A type of DNA dot blot assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007477"^^ . "DNA dot blot assay evidence used in automatic assertion"^^ . _:genid8295 . _:genid8295 . _:genid8295 . _:genid8295 . _:genid8295 "true"^^ . _:genid8296 . _:genid8296 . _:genid8296 . _:genid8296 . _:genid8296 "true"^^ . _:genid8297 . _:genid8297 . _:genid8297 . _:genid8297 "A type of DNA dot blot assay evidence that is used in an automatic assertion."^^ . _:genid8297 "ECO:RCT"^^ . . _:genid8298 . _:genid8299 . _:genid8301 _:genid8300 . _:genid8299 _:genid8301 . _:genid8300 . _:genid8300 . _:genid8300 . _:genid8301 . _:genid8298 _:genid8299 . _:genid8298 . . . "IEA"^^ . "A type of random mutagenesis phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007478"^^ . "random mutagenesis evidence used in automatic assertion"^^ . _:genid8302 . _:genid8302 . _:genid8302 . _:genid8302 . _:genid8302 "true"^^ . _:genid8303 . _:genid8303 . _:genid8303 . _:genid8303 . _:genid8303 "true"^^ . _:genid8304 . _:genid8304 . _:genid8304 . _:genid8304 "A type of random mutagenesis phenotypic evidence that is used in an automatic assertion."^^ . _:genid8304 "ECO:RCT"^^ . . _:genid8305 . _:genid8306 . _:genid8308 _:genid8307 . _:genid8306 _:genid8308 . _:genid8307 . _:genid8307 . _:genid8307 . _:genid8308 . _:genid8305 _:genid8306 . _:genid8305 . . . "IEA"^^ . "A type of biological system reconstruction evidence by experimental evidence from single species that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007479"^^ . "biological system reconstruction evidence by experimental evidence from single species used in automatic assertion"^^ . _:genid8309 . _:genid8309 . _:genid8309 . _:genid8309 . _:genid8309 "true"^^ . _:genid8310 . _:genid8310 . _:genid8310 . _:genid8310 . _:genid8310 "true"^^ . _:genid8311 . _:genid8311 . _:genid8311 . _:genid8311 "A type of biological system reconstruction evidence by experimental evidence from single species that is used in an automatic assertion."^^ . _:genid8311 "ECO:RCT"^^ . . _:genid8312 . _:genid8313 . _:genid8315 _:genid8314 . _:genid8313 _:genid8315 . _:genid8314 . _:genid8314 . _:genid8314 . _:genid8315 . _:genid8312 _:genid8313 . _:genid8312 . . . "IEA"^^ . "A type of biological system reconstruction evidence by experimental evidence from mixed species that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007480"^^ . "biological system reconstruction evidence by experimental evidence from mixed species used in automatic assertion"^^ . _:genid8316 . _:genid8316 . _:genid8316 . _:genid8316 . _:genid8316 "true"^^ . _:genid8317 . _:genid8317 . _:genid8317 . _:genid8317 . _:genid8317 "true"^^ . _:genid8318 . _:genid8318 . _:genid8318 . _:genid8318 "A type of biological system reconstruction evidence by experimental evidence from mixed species that is used in an automatic assertion."^^ . _:genid8318 "ECO:RCT"^^ . . _:genid8319 . _:genid8320 . _:genid8322 _:genid8321 . _:genid8320 _:genid8322 . _:genid8321 . _:genid8321 . _:genid8321 . _:genid8322 . _:genid8319 _:genid8320 . _:genid8319 . . . "IEA"^^ . "A type of biological system reconstruction evidence based on orthology evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007481"^^ . "biological system reconstruction evidence based on orthology evidence used in automatic assertion"^^ . _:genid8323 . _:genid8323 . _:genid8323 . _:genid8323 . _:genid8323 "true"^^ . _:genid8324 . _:genid8324 . _:genid8324 . _:genid8324 . _:genid8324 "true"^^ . _:genid8325 . _:genid8325 . _:genid8325 . _:genid8325 "A type of biological system reconstruction evidence based on orthology evidence that is used in an automatic assertion."^^ . _:genid8325 "ECO:RCT"^^ . . _:genid8326 . _:genid8327 . _:genid8329 _:genid8328 . _:genid8327 _:genid8329 . _:genid8328 . _:genid8328 . _:genid8328 . _:genid8329 . _:genid8326 _:genid8327 . _:genid8326 . . . "IEA"^^ . "A type of biological system reconstruction evidence based on homology evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007482"^^ . "biological system reconstruction evidence based on homology evidence used in automatic assertion"^^ . _:genid8330 . _:genid8330 . _:genid8330 . _:genid8330 . _:genid8330 "true"^^ . _:genid8331 . _:genid8331 . _:genid8331 . _:genid8331 . _:genid8331 "true"^^ . _:genid8332 . _:genid8332 . _:genid8332 . _:genid8332 "A type of biological system reconstruction evidence based on homology evidence that is used in an automatic assertion."^^ . _:genid8332 "ECO:RCT"^^ . . _:genid8333 . _:genid8334 . _:genid8336 _:genid8335 . _:genid8334 _:genid8336 . _:genid8335 . _:genid8335 . _:genid8335 . _:genid8336 . _:genid8333 _:genid8334 . _:genid8333 . . . "IEA"^^ . "A type of biological system reconstruction evidence based on paralogy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007483"^^ . "biological system reconstruction evidence based on paralogy evidence used in automatic assertion"^^ . _:genid8337 . _:genid8337 . _:genid8337 . _:genid8337 . _:genid8337 "true"^^ . _:genid8338 . _:genid8338 . _:genid8338 . _:genid8338 . _:genid8338 "true"^^ . _:genid8339 . _:genid8339 . _:genid8339 . _:genid8339 "A type of biological system reconstruction evidence based on paralogy evidence that is used in an automatic assertion."^^ . _:genid8339 "ECO:RCT"^^ . . _:genid8340 . _:genid8341 . _:genid8343 _:genid8342 . _:genid8341 _:genid8343 . _:genid8342 . _:genid8342 . _:genid8342 . _:genid8343 . _:genid8340 _:genid8341 . _:genid8340 . . . "IEA"^^ . "A type of biological system reconstruction evidence based on inference from background scientific knowledge that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007484"^^ . "biological system reconstruction evidence based on inference from background scientific knowledge used in automatic assertion"^^ . _:genid8344 . _:genid8344 . _:genid8344 . _:genid8344 . _:genid8344 "true"^^ . _:genid8345 . _:genid8345 . _:genid8345 . _:genid8345 . _:genid8345 "true"^^ . _:genid8346 . _:genid8346 . _:genid8346 . _:genid8346 "A type of biological system reconstruction evidence based on inference from background scientific knowledge that is used in an automatic assertion."^^ . _:genid8346 "ECO:RCT"^^ . . _:genid8347 . _:genid8348 . _:genid8350 _:genid8349 . _:genid8348 _:genid8350 . _:genid8349 . _:genid8349 . _:genid8349 . _:genid8350 . _:genid8347 _:genid8348 . _:genid8347 . . . "IEA"^^ . "A type of immunogold labelling evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007485"^^ . "immunogold labelling evidence used in automatic assertion"^^ . _:genid8351 . _:genid8351 . _:genid8351 . _:genid8351 . _:genid8351 "true"^^ . _:genid8352 . _:genid8352 . _:genid8352 . _:genid8352 . _:genid8352 "true"^^ . _:genid8353 . _:genid8353 . _:genid8353 . _:genid8353 "A type of immunogold labelling evidence that is used in an automatic assertion."^^ . _:genid8353 "ECO:RCT"^^ . . _:genid8354 . _:genid8355 . _:genid8357 _:genid8356 . _:genid8355 _:genid8357 . _:genid8356 . _:genid8356 . _:genid8356 . _:genid8357 . _:genid8354 _:genid8355 . _:genid8354 . . . . "IEA"^^ . "A type of immunolocalization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007486"^^ . "immunolocalization evidence used in automatic assertion"^^ . _:genid8358 . _:genid8358 . _:genid8358 . _:genid8358 . _:genid8358 "true"^^ . _:genid8359 . _:genid8359 . _:genid8359 . _:genid8359 . _:genid8359 "true"^^ . _:genid8360 . _:genid8360 . _:genid8360 . _:genid8360 . _:genid8360 "true"^^ . _:genid8361 . _:genid8361 . _:genid8361 . _:genid8361 "A type of immunolocalization evidence that is used in an automatic assertion."^^ . _:genid8361 "ECO:RCT"^^ . . _:genid8362 . _:genid8363 . _:genid8365 _:genid8364 . _:genid8363 _:genid8365 . _:genid8364 . _:genid8364 . _:genid8364 . _:genid8365 . _:genid8362 _:genid8363 . _:genid8362 . . . "IEA"^^ . "A type of flow cytometry evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007487"^^ . "flow cytometry evidence used in automatic assertion"^^ . _:genid8366 . _:genid8366 . _:genid8366 . _:genid8366 . _:genid8366 "true"^^ . _:genid8367 . _:genid8367 . _:genid8367 . _:genid8367 . _:genid8367 "true"^^ . _:genid8368 . _:genid8368 . _:genid8368 . _:genid8368 "A type of flow cytometry evidence that is used in an automatic assertion."^^ . _:genid8368 "ECO:RCT"^^ . . _:genid8369 . _:genid8370 . _:genid8372 _:genid8371 . _:genid8370 _:genid8372 . _:genid8371 . _:genid8371 . _:genid8371 . _:genid8372 . _:genid8369 _:genid8370 . _:genid8369 . . . "IEA"^^ . "A type of enzyme-linked immunoabsorbent assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007488"^^ . "enzyme-linked immunoabsorbent assay evidence used in automatic assertion"^^ . _:genid8373 . _:genid8373 . _:genid8373 . _:genid8373 . _:genid8373 "true"^^ . _:genid8374 . _:genid8374 . _:genid8374 . _:genid8374 . _:genid8374 "true"^^ . _:genid8375 . _:genid8375 . _:genid8375 . _:genid8375 "A type of enzyme-linked immunoabsorbent assay evidence that is used in an automatic assertion."^^ . _:genid8375 "ECO:RCT"^^ . . _:genid8376 . _:genid8377 . _:genid8379 _:genid8378 . _:genid8377 _:genid8379 . _:genid8378 . _:genid8378 . _:genid8378 . _:genid8379 . _:genid8376 _:genid8377 . _:genid8376 . . . "IEA"^^ . "A type of high throughput mass spectrometry evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007489"^^ . "high throughput mass spectrometry evidence used in automatic assertion"^^ . _:genid8380 . _:genid8380 . _:genid8380 . _:genid8380 . _:genid8380 "true"^^ . _:genid8381 . _:genid8381 . _:genid8381 . _:genid8381 . _:genid8381 "true"^^ . _:genid8382 . _:genid8382 . _:genid8382 . _:genid8382 "A type of high throughput mass spectrometry evidence that is used in an automatic assertion."^^ . _:genid8382 "ECO:RCT"^^ . . _:genid8383 . _:genid8384 . _:genid8386 _:genid8385 . _:genid8384 _:genid8386 . _:genid8385 . _:genid8385 . _:genid8385 . _:genid8386 . _:genid8383 _:genid8384 . _:genid8383 . . . "IEA"^^ . "A type of confocal microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007490"^^ . "confocal microscopy evidence used in automatic assertion"^^ . _:genid8387 . _:genid8387 . _:genid8387 . _:genid8387 . _:genid8387 "true"^^ . _:genid8388 . _:genid8388 . _:genid8388 . _:genid8388 . _:genid8388 "true"^^ . _:genid8389 . _:genid8389 . _:genid8389 . _:genid8389 "A type of confocal microscopy evidence that is used in an automatic assertion."^^ . _:genid8389 "ECO:RCT"^^ . . _:genid8390 . _:genid8391 . _:genid8393 _:genid8392 . _:genid8391 _:genid8393 . _:genid8392 . _:genid8392 . _:genid8392 . _:genid8393 . _:genid8390 _:genid8391 . _:genid8390 . . . "IEA"^^ . "A type of wide-field microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007491"^^ . "wide-field microscopy evidence used in automatic assertion"^^ . _:genid8394 . _:genid8394 . _:genid8394 . _:genid8394 . _:genid8394 "true"^^ . _:genid8395 . _:genid8395 . _:genid8395 . _:genid8395 . _:genid8395 "true"^^ . _:genid8396 . _:genid8396 . _:genid8396 . _:genid8396 "A type of wide-field microscopy evidence that is used in an automatic assertion."^^ . _:genid8396 "ECO:RCT"^^ . . _:genid8397 . _:genid8398 . _:genid8400 _:genid8399 . _:genid8398 _:genid8400 . _:genid8399 . _:genid8399 . _:genid8399 . _:genid8400 . _:genid8397 _:genid8398 . _:genid8397 . . . . "IEA"^^ . "A type of immunogold labelling electron microscopy assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007492"^^ . "immunogold labelling electron microscopy assay evidence used in automatic assertion"^^ . _:genid8401 . _:genid8401 . _:genid8401 . _:genid8401 . _:genid8401 "true"^^ . _:genid8402 . _:genid8402 . _:genid8402 . _:genid8402 . _:genid8402 "true"^^ . _:genid8403 . _:genid8403 . _:genid8403 . _:genid8403 . _:genid8403 "true"^^ . _:genid8404 . _:genid8404 . _:genid8404 . _:genid8404 "A type of immunogold labelling electron microscopy assay evidence that is used in an automatic assertion."^^ . _:genid8404 "ECO:RCT"^^ . . _:genid8405 . _:genid8406 . _:genid8408 _:genid8407 . _:genid8406 _:genid8408 . _:genid8407 . _:genid8407 . _:genid8407 . _:genid8408 . _:genid8405 _:genid8406 . _:genid8405 . . . . "IEA"^^ . "A type of electron microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007493"^^ . "electron microscopy evidence used in automatic assertion"^^ . _:genid8409 . _:genid8409 . _:genid8409 . _:genid8409 . _:genid8409 "true"^^ . _:genid8410 . _:genid8410 . _:genid8410 . _:genid8410 . _:genid8410 "true"^^ . _:genid8411 . _:genid8411 . _:genid8411 . _:genid8411 . _:genid8411 "true"^^ . _:genid8412 . _:genid8412 . _:genid8412 . _:genid8412 "A type of electron microscopy evidence that is used in an automatic assertion."^^ . _:genid8412 "ECO:RCT"^^ . . _:genid8413 . _:genid8414 . _:genid8416 _:genid8415 . _:genid8414 _:genid8416 . _:genid8415 . _:genid8415 . _:genid8415 . _:genid8416 . _:genid8413 _:genid8414 . _:genid8413 . . . "IEA"^^ . "A type of immunoperoxidase immunolocalization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007494"^^ . "immunoperoxidase immunolocalization evidence used in automatic assertion"^^ . _:genid8417 . _:genid8417 . _:genid8417 . _:genid8417 . _:genid8417 "true"^^ . _:genid8418 . _:genid8418 . _:genid8418 . _:genid8418 . _:genid8418 "true"^^ . _:genid8419 . _:genid8419 . _:genid8419 . _:genid8419 "A type of immunoperoxidase immunolocalization evidence that is used in an automatic assertion."^^ . _:genid8419 "ECO:RCT"^^ . . _:genid8420 . _:genid8421 . _:genid8423 _:genid8422 . _:genid8421 _:genid8423 . _:genid8422 . _:genid8422 . _:genid8422 . _:genid8423 . _:genid8420 _:genid8421 . _:genid8420 . . . . "IEA"^^ . "A type of immunoperoxidase immunolocalization electron microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007495"^^ . "immunoperoxidase immunolocalization electron microscopy evidence used in automatic assertion"^^ . _:genid8424 . _:genid8424 . _:genid8424 . _:genid8424 . _:genid8424 "true"^^ . _:genid8425 . _:genid8425 . _:genid8425 . _:genid8425 . _:genid8425 "true"^^ . _:genid8426 . _:genid8426 . _:genid8426 . _:genid8426 . _:genid8426 "true"^^ . _:genid8427 . _:genid8427 . _:genid8427 . _:genid8427 "A type of immunoperoxidase immunolocalization electron microscopy evidence that is used in an automatic assertion."^^ . _:genid8427 "ECO:RCT"^^ . . _:genid8428 . _:genid8429 . _:genid8431 _:genid8430 . _:genid8429 _:genid8431 . _:genid8430 . _:genid8430 . _:genid8430 . _:genid8431 . _:genid8428 _:genid8429 . _:genid8428 . . . . "IEA"^^ . "A type of immunofluorescence confocal microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007496"^^ . "immunofluorescence confocal microscopy evidence used in automatic assertion"^^ . _:genid8432 . _:genid8432 . _:genid8432 . _:genid8432 . _:genid8432 "true"^^ . _:genid8433 . _:genid8433 . _:genid8433 . _:genid8433 . _:genid8433 "true"^^ . _:genid8434 . _:genid8434 . _:genid8434 . _:genid8434 . _:genid8434 "true"^^ . _:genid8435 . _:genid8435 . _:genid8435 . _:genid8435 "A type of immunofluorescence confocal microscopy evidence that is used in an automatic assertion."^^ . _:genid8435 "ECO:RCT"^^ . . _:genid8436 . _:genid8437 . _:genid8439 _:genid8438 . _:genid8437 _:genid8439 . _:genid8438 . _:genid8438 . _:genid8438 . _:genid8439 . _:genid8436 _:genid8437 . _:genid8436 . . . "IEA"^^ . "A type of immunofluorescence evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007497"^^ . "immunofluorescence evidence used in automatic assertion"^^ . _:genid8440 . _:genid8440 . _:genid8440 . _:genid8440 . _:genid8440 "true"^^ . _:genid8441 . _:genid8441 . _:genid8441 . _:genid8441 . _:genid8441 "true"^^ . _:genid8442 . _:genid8442 . _:genid8442 . _:genid8442 "A type of immunofluorescence evidence that is used in an automatic assertion."^^ . _:genid8442 "ECO:RCT"^^ . . _:genid8443 . _:genid8444 . _:genid8446 _:genid8445 . _:genid8444 _:genid8446 . _:genid8445 . _:genid8445 . _:genid8445 . _:genid8446 . _:genid8443 _:genid8444 . _:genid8443 . . . "IEA"^^ . "A type of two-dimensional polyacrylamide gel electrophoresis evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007498"^^ . "two-dimensional polyacrylamide gel electrophoresis evidence used in automatic assertion"^^ . _:genid8447 . _:genid8447 . _:genid8447 . _:genid8447 . _:genid8447 "true"^^ . _:genid8448 . _:genid8448 . _:genid8448 . _:genid8448 . _:genid8448 "true"^^ . _:genid8449 . _:genid8449 . _:genid8449 . _:genid8449 "A type of two-dimensional polyacrylamide gel electrophoresis evidence that is used in an automatic assertion."^^ . _:genid8449 "ECO:RCT"^^ . . _:genid8450 . _:genid8451 . _:genid8453 _:genid8452 . _:genid8451 _:genid8453 . _:genid8452 . _:genid8452 . _:genid8452 . _:genid8453 . _:genid8450 _:genid8451 . _:genid8450 . . . "IEA"^^ . "A type of alkaline phosphatase reporter gene assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007499"^^ . "alkaline phosphatase reporter gene assay evidence used in automatic assertion"^^ . _:genid8454 . _:genid8454 . _:genid8454 . _:genid8454 . _:genid8454 "true"^^ . _:genid8455 . _:genid8455 . _:genid8455 . _:genid8455 . _:genid8455 "true"^^ . _:genid8456 . _:genid8456 . _:genid8456 . _:genid8456 "A type of alkaline phosphatase reporter gene assay evidence that is used in an automatic assertion."^^ . _:genid8456 "ECO:RCT"^^ . . _:genid8457 . _:genid8458 . _:genid8460 _:genid8459 . _:genid8458 _:genid8460 . _:genid8459 . _:genid8459 . _:genid8459 . _:genid8460 . _:genid8457 _:genid8458 . _:genid8457 . . . "IEA"^^ . "A type of beta-galactosidase reporter gene assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "LacZ transcript localization evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007500"^^ . "beta-galactosidase reporter gene assay evidence used in automatic assertion"^^ . _:genid8461 . _:genid8461 . _:genid8461 . _:genid8461 . _:genid8461 "true"^^ . _:genid8462 . _:genid8462 . _:genid8462 . _:genid8462 . _:genid8462 "true"^^ . _:genid8463 . _:genid8463 . _:genid8463 . _:genid8463 "A type of beta-galactosidase reporter gene assay evidence that is used in an automatic assertion."^^ . _:genid8463 "ECO:RCT"^^ . . _:genid8464 . _:genid8465 . _:genid8467 _:genid8466 . _:genid8465 _:genid8467 . _:genid8466 . _:genid8466 . _:genid8466 . _:genid8467 . _:genid8464 _:genid8465 . _:genid8464 . . . "IEA"^^ . "A type of chloramphenicol acetyltransferase reporter gene assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007501"^^ . "chloramphenicol acetyltransferase reporter gene assay evidence used in automatic assertion"^^ . _:genid8468 . _:genid8468 . _:genid8468 . _:genid8468 . _:genid8468 "true"^^ . _:genid8469 . _:genid8469 . _:genid8469 . _:genid8469 . _:genid8469 "true"^^ . _:genid8470 . _:genid8470 . _:genid8470 . _:genid8470 "A type of chloramphenicol acetyltransferase reporter gene assay evidence that is used in an automatic assertion."^^ . _:genid8470 "ECO:RCT"^^ . . _:genid8471 . _:genid8472 . _:genid8474 _:genid8473 . _:genid8472 _:genid8474 . _:genid8473 . _:genid8473 . _:genid8473 . _:genid8474 . _:genid8471 _:genid8472 . _:genid8471 . . . "IEA"^^ . "A type of chromatin immunoprecipitation-PCR evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007502"^^ . "chromatin immunoprecipitation-PCR evidence used in automatic assertion"^^ . _:genid8475 . _:genid8475 . _:genid8475 . _:genid8475 . _:genid8475 "true"^^ . _:genid8476 . _:genid8476 . _:genid8476 . _:genid8476 . _:genid8476 "true"^^ . _:genid8477 . _:genid8477 . _:genid8477 . _:genid8477 "A type of chromatin immunoprecipitation-PCR evidence that is used in an automatic assertion."^^ . _:genid8477 "ECO:RCT"^^ . . _:genid8478 . _:genid8479 . _:genid8481 _:genid8480 . _:genid8479 _:genid8481 . _:genid8480 . _:genid8480 . _:genid8480 . _:genid8481 . _:genid8478 _:genid8479 . _:genid8478 . . . "IEA"^^ . "A type of immunoprecipitation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007503"^^ . "immunoprecipitation evidence used in automatic assertion"^^ . _:genid8482 . _:genid8482 . _:genid8482 . _:genid8482 . _:genid8482 "true"^^ . _:genid8483 . _:genid8483 . _:genid8483 . _:genid8483 . _:genid8483 "true"^^ . _:genid8484 . _:genid8484 . _:genid8484 . _:genid8484 "A type of immunoprecipitation evidence that is used in an automatic assertion."^^ . _:genid8484 "ECO:RCT"^^ . . _:genid8485 . _:genid8486 . _:genid8488 _:genid8487 . _:genid8486 _:genid8488 . _:genid8487 . _:genid8487 . _:genid8487 . _:genid8488 . _:genid8485 _:genid8486 . _:genid8485 . . . "IEA"^^ . "A type of copper-phenanthroline footprinting evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007504"^^ . "copper-phenanthroline footprinting evidence used in automatic assertion"^^ . _:genid8489 . _:genid8489 . _:genid8489 . _:genid8489 . _:genid8489 "true"^^ . _:genid8490 . _:genid8490 . _:genid8490 . _:genid8490 . _:genid8490 "true"^^ . _:genid8491 . _:genid8491 . _:genid8491 . _:genid8491 "A type of copper-phenanthroline footprinting evidence that is used in an automatic assertion."^^ . _:genid8491 "ECO:RCT"^^ . . _:genid8492 . _:genid8493 . _:genid8495 _:genid8494 . _:genid8493 _:genid8495 . _:genid8494 . _:genid8494 . _:genid8494 . _:genid8495 . _:genid8492 _:genid8493 . _:genid8492 . . . "IEA"^^ . "A type of nucleic acid binding evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007505"^^ . "nucleic acid binding evidence used in automatic assertion"^^ . _:genid8496 . _:genid8496 . _:genid8496 . _:genid8496 . _:genid8496 "true"^^ . _:genid8497 . _:genid8497 . _:genid8497 . _:genid8497 . _:genid8497 "true"^^ . _:genid8498 . _:genid8498 . _:genid8498 . _:genid8498 "A type of nucleic acid binding evidence that is used in an automatic assertion."^^ . _:genid8498 "ECO:RCT"^^ . . _:genid8499 . _:genid8500 . _:genid8502 _:genid8501 . _:genid8500 _:genid8502 . _:genid8501 . _:genid8501 . _:genid8501 . _:genid8502 . _:genid8499 _:genid8500 . _:genid8499 . . . "IEA"^^ . "A type of DNA affinity chromatography evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007506"^^ . "DNA affinity chromatography evidence used in automatic assertion"^^ . _:genid8503 . _:genid8503 . _:genid8503 . _:genid8503 . _:genid8503 "true"^^ . _:genid8504 . _:genid8504 . _:genid8504 . _:genid8504 . _:genid8504 "true"^^ . _:genid8505 . _:genid8505 . _:genid8505 . _:genid8505 "A type of DNA affinity chromatography evidence that is used in an automatic assertion."^^ . _:genid8505 "ECO:RCT"^^ . . _:genid8506 . _:genid8507 . _:genid8509 _:genid8508 . _:genid8507 _:genid8509 . _:genid8508 . _:genid8508 . _:genid8508 . _:genid8509 . _:genid8506 _:genid8507 . _:genid8506 . . . "IEA"^^ . "A type of DNAse footprinting evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007507"^^ . "DNAse footprinting evidence used in automatic assertion"^^ . _:genid8510 . _:genid8510 . _:genid8510 . _:genid8510 . _:genid8510 "true"^^ . _:genid8511 . _:genid8511 . _:genid8511 . _:genid8511 . _:genid8511 "true"^^ . _:genid8512 . _:genid8512 . _:genid8512 . _:genid8512 "A type of DNAse footprinting evidence that is used in an automatic assertion."^^ . _:genid8512 "ECO:RCT"^^ . . _:genid8513 . _:genid8514 . _:genid8516 _:genid8515 . _:genid8514 _:genid8516 . _:genid8515 . _:genid8515 . _:genid8515 . _:genid8516 . _:genid8513 _:genid8514 . _:genid8513 . . . "IEA"^^ . "A type of fluorescence anisotropy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007508"^^ . "fluorescence anisotropy evidence used in automatic assertion"^^ . _:genid8517 . _:genid8517 . _:genid8517 . _:genid8517 . _:genid8517 "true"^^ . _:genid8518 . _:genid8518 . _:genid8518 . _:genid8518 . _:genid8518 "true"^^ . _:genid8519 . _:genid8519 . _:genid8519 . _:genid8519 "A type of fluorescence anisotropy evidence that is used in an automatic assertion."^^ . _:genid8519 "ECO:RCT"^^ . . _:genid8520 . _:genid8521 . _:genid8523 _:genid8522 . _:genid8521 _:genid8523 . _:genid8522 . _:genid8522 . _:genid8522 . _:genid8523 . _:genid8520 _:genid8521 . _:genid8520 . . . "IEA"^^ . "A type of ferric uptake regulator titration assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007509"^^ . "ferric uptake regulator titration assay evidence used in automatic assertion"^^ . _:genid8524 . _:genid8524 . _:genid8524 . _:genid8524 . _:genid8524 "true"^^ . _:genid8525 . _:genid8525 . _:genid8525 . _:genid8525 . _:genid8525 "true"^^ . _:genid8526 . _:genid8526 . _:genid8526 . _:genid8526 "A type of ferric uptake regulator titration assay evidence that is used in an automatic assertion."^^ . _:genid8526 "ECO:RCT"^^ . . _:genid8527 . _:genid8528 . _:genid8530 _:genid8529 . _:genid8528 _:genid8530 . _:genid8529 . _:genid8529 . _:genid8529 . _:genid8530 . _:genid8527 _:genid8528 . _:genid8527 . . . "IEA"^^ . "A type of systematic evolution of ligands by exponential amplification evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007510"^^ . "systematic evolution of ligands by exponential amplification evidence used in automatic assertion"^^ . _:genid8531 . _:genid8531 . _:genid8531 . _:genid8531 . _:genid8531 "true"^^ . _:genid8532 . _:genid8532 . _:genid8532 . _:genid8532 . _:genid8532 "true"^^ . _:genid8533 . _:genid8533 . _:genid8533 . _:genid8533 "A type of systematic evolution of ligands by exponential amplification evidence that is used in an automatic assertion."^^ . _:genid8533 "ECO:RCT"^^ . . _:genid8534 . _:genid8535 . _:genid8537 _:genid8536 . _:genid8535 _:genid8537 . _:genid8536 . _:genid8536 . _:genid8536 . _:genid8537 . _:genid8534 _:genid8535 . _:genid8534 . . . "IEA"^^ . "A type of glutathione S-transferase pull-down assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007511"^^ . "glutathione S-transferase pull-down assay evidence used in automatic assertion"^^ . _:genid8538 . _:genid8538 . _:genid8538 . _:genid8538 . _:genid8538 "true"^^ . _:genid8539 . _:genid8539 . _:genid8539 . _:genid8539 . _:genid8539 "true"^^ . _:genid8540 . _:genid8540 . _:genid8540 . _:genid8540 "A type of glutathione S-transferase pull-down assay evidence that is used in an automatic assertion."^^ . _:genid8540 "ECO:RCT"^^ . . _:genid8541 . _:genid8542 . _:genid8544 _:genid8543 . _:genid8542 _:genid8544 . _:genid8543 . _:genid8543 . _:genid8543 . _:genid8544 . _:genid8541 _:genid8542 . _:genid8541 . . . "IEA"^^ . "A type of beta-glucuronidase reporter gene assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007512"^^ . "beta-glucuronidase reporter gene assay evidence used in automatic assertion"^^ . _:genid8545 . _:genid8545 . _:genid8545 . _:genid8545 . _:genid8545 "true"^^ . _:genid8546 . _:genid8546 . _:genid8546 . _:genid8546 . _:genid8546 "true"^^ . _:genid8547 . _:genid8547 . _:genid8547 . _:genid8547 "A type of beta-glucuronidase reporter gene assay evidence that is used in an automatic assertion."^^ . _:genid8547 "ECO:RCT"^^ . . _:genid8548 . _:genid8549 . _:genid8551 _:genid8550 . _:genid8549 _:genid8551 . _:genid8550 . _:genid8550 . _:genid8550 . _:genid8551 . _:genid8548 _:genid8549 . _:genid8548 . . . "IEA"^^ . "A type of heteronuclear single quantum coherence spectroscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007513"^^ . "heteronuclear single quantum coherence spectroscopy evidence used in automatic assertion"^^ . _:genid8552 . _:genid8552 . _:genid8552 . _:genid8552 . _:genid8552 "true"^^ . _:genid8553 . _:genid8553 . _:genid8553 . _:genid8553 . _:genid8553 "true"^^ . _:genid8554 . _:genid8554 . _:genid8554 . _:genid8554 "A type of heteronuclear single quantum coherence spectroscopy evidence that is used in an automatic assertion."^^ . _:genid8554 "ECO:RCT"^^ . . _:genid8555 . _:genid8556 . _:genid8558 _:genid8557 . _:genid8556 _:genid8558 . _:genid8557 . _:genid8557 . _:genid8557 . _:genid8558 . _:genid8555 _:genid8556 . _:genid8555 . . . "IEA"^^ . "A type of hydroxyl-radical footprinting evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007514"^^ . "hydroxyl-radical footprinting evidence used in automatic assertion"^^ . _:genid8559 . _:genid8559 . _:genid8559 . _:genid8559 . _:genid8559 "true"^^ . _:genid8560 . _:genid8560 . _:genid8560 . _:genid8560 . _:genid8560 "true"^^ . _:genid8561 . _:genid8561 . _:genid8561 . _:genid8561 "A type of hydroxyl-radical footprinting evidence that is used in an automatic assertion."^^ . _:genid8561 "ECO:RCT"^^ . . _:genid8562 . _:genid8563 . _:genid8565 _:genid8564 . _:genid8563 _:genid8565 . _:genid8564 . _:genid8564 . _:genid8564 . _:genid8565 . _:genid8562 _:genid8563 . _:genid8562 . . . "IEA"^^ . "A type of isothermal titration calorimetry evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007515"^^ . "isothermal titration calorimetry evidence used in automatic assertion"^^ . _:genid8566 . _:genid8566 . _:genid8566 . _:genid8566 . _:genid8566 "true"^^ . _:genid8567 . _:genid8567 . _:genid8567 . _:genid8567 . _:genid8567 "true"^^ . _:genid8568 . _:genid8568 . _:genid8568 . _:genid8568 "A type of isothermal titration calorimetry evidence that is used in an automatic assertion."^^ . _:genid8568 "ECO:RCT"^^ . . _:genid8569 . _:genid8570 . _:genid8572 _:genid8571 . _:genid8570 _:genid8572 . _:genid8571 . _:genid8571 . _:genid8571 . _:genid8572 . _:genid8569 _:genid8570 . _:genid8569 . . . "IEA"^^ . "A type of luciferase reporter gene assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007516"^^ . "luciferase reporter gene assay evidence used in automatic assertion"^^ . _:genid8573 . _:genid8573 . _:genid8573 . _:genid8573 . _:genid8573 "true"^^ . _:genid8574 . _:genid8574 . _:genid8574 . _:genid8574 . _:genid8574 "true"^^ . _:genid8575 . _:genid8575 . _:genid8575 . _:genid8575 "A type of luciferase reporter gene assay evidence that is used in an automatic assertion."^^ . _:genid8575 "ECO:RCT"^^ . . _:genid8576 . _:genid8577 . _:genid8579 _:genid8578 . _:genid8577 _:genid8579 . _:genid8578 . _:genid8578 . _:genid8578 . _:genid8579 . _:genid8576 _:genid8577 . _:genid8576 . . . "IEA"^^ . "A type of methidiumpropyl-ethylenediaminetetraacetic acid iron (II) footprinting evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007517"^^ . "methidiumpropyl-ethylenediaminetetraacetic acid iron (II) footprinting evidence used in automatic assertion"^^ . _:genid8580 . _:genid8580 . _:genid8580 . _:genid8580 . _:genid8580 "true"^^ . _:genid8581 . _:genid8581 . _:genid8581 . _:genid8581 . _:genid8581 "true"^^ . _:genid8582 . _:genid8582 . _:genid8582 . _:genid8582 "A type of methidiumpropyl-ethylenediaminetetraacetic acid iron (II) footprinting evidence that is used in an automatic assertion."^^ . _:genid8582 "ECO:RCT"^^ . . _:genid8583 . _:genid8584 . _:genid8586 _:genid8585 . _:genid8584 _:genid8586 . _:genid8585 . _:genid8585 . _:genid8585 . _:genid8586 . _:genid8583 _:genid8584 . _:genid8583 . . . "IEA"^^ . "A type of northern blot evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007518"^^ . "northern blot evidence used in automatic assertion"^^ . _:genid8587 . _:genid8587 . _:genid8587 . _:genid8587 . _:genid8587 "true"^^ . _:genid8588 . _:genid8588 . _:genid8588 . _:genid8588 . _:genid8588 "true"^^ . _:genid8589 . _:genid8589 . _:genid8589 . _:genid8589 "A type of northern blot evidence that is used in an automatic assertion."^^ . _:genid8589 "ECO:RCT"^^ . . _:genid8590 . _:genid8591 . _:genid8593 _:genid8592 . _:genid8591 _:genid8593 . _:genid8592 . _:genid8592 . _:genid8592 . _:genid8593 . _:genid8590 _:genid8591 . _:genid8590 . . . "IEA"^^ . "A type of methylation interference footprinting evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "premethylation interference footprinting evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007519"^^ . "methylation interference footprinting evidence used in automatic assertion"^^ . _:genid8594 . _:genid8594 . _:genid8594 . _:genid8594 . _:genid8594 "true"^^ . _:genid8595 . _:genid8595 . _:genid8595 . _:genid8595 . _:genid8595 "true"^^ . _:genid8596 . _:genid8596 . _:genid8596 . _:genid8596 "A type of methylation interference footprinting evidence that is used in an automatic assertion."^^ . _:genid8596 "ECO:RCT"^^ . . _:genid8597 . _:genid8598 . _:genid8600 _:genid8599 . _:genid8598 _:genid8600 . _:genid8599 . _:genid8599 . _:genid8599 . _:genid8600 . _:genid8597 _:genid8598 . _:genid8597 . . . "IEA"^^ . "A type of primer extension assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007520"^^ . "primer extension assay evidence used in automatic assertion"^^ . _:genid8601 . _:genid8601 . _:genid8601 . _:genid8601 . _:genid8601 "true"^^ . _:genid8602 . _:genid8602 . _:genid8602 . _:genid8602 . _:genid8602 "true"^^ . _:genid8603 . _:genid8603 . _:genid8603 . _:genid8603 "A type of primer extension assay evidence that is used in an automatic assertion."^^ . _:genid8603 "ECO:RCT"^^ . . _:genid8604 . _:genid8605 . _:genid8607 _:genid8606 . _:genid8605 _:genid8607 . _:genid8606 . _:genid8606 . _:genid8606 . _:genid8607 . _:genid8604 _:genid8605 . _:genid8604 . . . "IEA"^^ . "A type of quantitative polymerase chain reaction evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007521"^^ . "quantitative polymerase chain reaction evidence used in automatic assertion"^^ . _:genid8608 . _:genid8608 . _:genid8608 . _:genid8608 . _:genid8608 "true"^^ . _:genid8609 . _:genid8609 . _:genid8609 . _:genid8609 . _:genid8609 "true"^^ . _:genid8610 . _:genid8610 . _:genid8610 . _:genid8610 "A type of quantitative polymerase chain reaction evidence that is used in an automatic assertion."^^ . _:genid8610 "ECO:RCT"^^ . . _:genid8611 . _:genid8612 . _:genid8614 _:genid8613 . _:genid8612 _:genid8614 . _:genid8613 . _:genid8613 . _:genid8613 . _:genid8614 . _:genid8611 _:genid8612 . _:genid8611 . . . "IEA"^^ . "A type of rapid amplification of cDNA ends polymerase chain reaction evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007522"^^ . "rapid amplification of cDNA ends polymerase chain reaction evidence used in automatic assertion"^^ . _:genid8615 . _:genid8615 . _:genid8615 . _:genid8615 . _:genid8615 "true"^^ . _:genid8616 . _:genid8616 . _:genid8616 . _:genid8616 . _:genid8616 "true"^^ . _:genid8617 . _:genid8617 . _:genid8617 . _:genid8617 "A type of rapid amplification of cDNA ends polymerase chain reaction evidence that is used in an automatic assertion."^^ . _:genid8617 "ECO:RCT"^^ . . _:genid8618 . _:genid8619 . _:genid8621 _:genid8620 . _:genid8619 _:genid8621 . _:genid8620 . _:genid8620 . _:genid8620 . _:genid8621 . _:genid8618 _:genid8619 . _:genid8618 . . . "IEA"^^ . "A type of S1 nuclease protection assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007523"^^ . "S1 nuclease protection assay evidence used in automatic assertion"^^ . _:genid8622 . _:genid8622 . _:genid8622 . _:genid8622 . _:genid8622 "true"^^ . _:genid8623 . _:genid8623 . _:genid8623 . _:genid8623 . _:genid8623 "true"^^ . _:genid8624 . _:genid8624 . _:genid8624 . _:genid8624 "A type of S1 nuclease protection assay evidence that is used in an automatic assertion."^^ . _:genid8624 "ECO:RCT"^^ . . _:genid8625 . _:genid8626 . _:genid8628 _:genid8627 . _:genid8626 _:genid8628 . _:genid8627 . _:genid8627 . _:genid8627 . _:genid8628 . _:genid8625 _:genid8626 . _:genid8625 . . . "IEA"^^ . "A type of site-directed mutagenesis phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "site-directed mutagenesis evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007524"^^ . "site-directed mutagenesis phenotypic evidence used in automatic assertion"^^ . _:genid8629 . _:genid8629 . _:genid8629 . _:genid8629 . _:genid8629 "true"^^ . _:genid8630 . _:genid8630 . _:genid8630 . _:genid8630 . _:genid8630 "true"^^ . _:genid8631 . _:genid8631 . _:genid8631 . _:genid8631 "A type of site-directed mutagenesis phenotypic evidence that is used in an automatic assertion."^^ . _:genid8631 "ECO:RCT"^^ . . _:genid8632 . _:genid8633 . _:genid8635 _:genid8634 . _:genid8633 _:genid8635 . _:genid8634 . _:genid8634 . _:genid8634 . _:genid8635 . _:genid8632 _:genid8633 . _:genid8632 . . . "IEA"^^ . "A type of survival rate analysis evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007525"^^ . "survival rate analysis evidence used in automatic assertion"^^ . _:genid8636 . _:genid8636 . _:genid8636 . _:genid8636 . _:genid8636 "true"^^ . _:genid8637 . _:genid8637 . _:genid8637 . _:genid8637 . _:genid8637 "true"^^ . _:genid8638 . _:genid8638 . _:genid8638 . _:genid8638 "A type of survival rate analysis evidence that is used in an automatic assertion."^^ . _:genid8638 "ECO:RCT"^^ . . _:genid8639 . _:genid8640 . _:genid8642 _:genid8641 . _:genid8640 _:genid8642 . _:genid8641 . _:genid8641 . _:genid8641 . _:genid8642 . _:genid8639 _:genid8640 . _:genid8639 . . . "IEA"^^ . "A type of ultraviolet light footprinting evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007526"^^ . "ultraviolet light footprinting evidence used in automatic assertion"^^ . _:genid8643 . _:genid8643 . _:genid8643 . _:genid8643 . _:genid8643 "true"^^ . _:genid8644 . _:genid8644 . _:genid8644 . _:genid8644 . _:genid8644 "true"^^ . _:genid8645 . _:genid8645 . _:genid8645 . _:genid8645 "A type of ultraviolet light footprinting evidence that is used in an automatic assertion."^^ . _:genid8645 "ECO:RCT"^^ . . _:genid8646 . _:genid8647 . _:genid8649 _:genid8648 . _:genid8647 _:genid8649 . _:genid8648 . _:genid8648 . _:genid8648 . _:genid8649 . _:genid8646 _:genid8647 . _:genid8646 . . . "IEA"^^ . "A type of xylE reporter gene assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007527"^^ . "xylE reporter gene assay evidence used in automatic assertion"^^ . _:genid8650 . _:genid8650 . _:genid8650 . _:genid8650 . _:genid8650 "true"^^ . _:genid8651 . _:genid8651 . _:genid8651 . _:genid8651 . _:genid8651 "true"^^ . _:genid8652 . _:genid8652 . _:genid8652 . _:genid8652 "A type of xylE reporter gene assay evidence that is used in an automatic assertion."^^ . _:genid8652 "ECO:RCT"^^ . . _:genid8653 . _:genid8654 . _:genid8656 _:genid8655 . _:genid8654 _:genid8656 . _:genid8655 . _:genid8655 . _:genid8655 . _:genid8656 . _:genid8653 _:genid8654 . _:genid8653 . . . "IEA"^^ . "A type of ad-hoc qualitative phenotype observation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007528"^^ . "ad-hoc qualitative phenotype observation evidence used in automatic assertion"^^ . _:genid8657 . _:genid8657 . _:genid8657 . _:genid8657 . _:genid8657 "true"^^ . _:genid8658 . _:genid8658 . _:genid8658 . _:genid8658 . _:genid8658 "true"^^ . _:genid8659 . _:genid8659 . _:genid8659 . _:genid8659 "A type of ad-hoc qualitative phenotype observation evidence that is used in an automatic assertion."^^ . _:genid8659 "ECO:RCT"^^ . . _:genid8660 . _:genid8661 . _:genid8663 _:genid8662 . _:genid8661 _:genid8663 . _:genid8662 . _:genid8662 . _:genid8662 . _:genid8663 . _:genid8660 _:genid8661 . _:genid8660 . . . "IEA"^^ . "A type of ad-hoc quantitative phenotype observation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007529"^^ . "ad-hoc quantitative phenotype observation evidence used in automatic assertion"^^ . _:genid8664 . _:genid8664 . _:genid8664 . _:genid8664 . _:genid8664 "true"^^ . _:genid8665 . _:genid8665 . _:genid8665 . _:genid8665 . _:genid8665 "true"^^ . _:genid8666 . _:genid8666 . _:genid8666 . _:genid8666 "A type of ad-hoc quantitative phenotype observation evidence that is used in an automatic assertion."^^ . _:genid8666 "ECO:RCT"^^ . . _:genid8667 . _:genid8668 . _:genid8670 _:genid8669 . _:genid8668 _:genid8670 . _:genid8669 . _:genid8669 . _:genid8669 . _:genid8670 . _:genid8667 _:genid8668 . _:genid8667 . . . "IEA"^^ . "A type of cell transfection experiment evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007530"^^ . "cell transfection experiment evidence used in automatic assertion"^^ . _:genid8671 . _:genid8671 . _:genid8671 . _:genid8671 . _:genid8671 "true"^^ . _:genid8672 . _:genid8672 . _:genid8672 . _:genid8672 . _:genid8672 "true"^^ . _:genid8673 . _:genid8673 . _:genid8673 . _:genid8673 "A type of cell transfection experiment evidence that is used in an automatic assertion."^^ . _:genid8673 "ECO:RCT"^^ . . _:genid8674 . _:genid8675 . _:genid8677 _:genid8676 . _:genid8675 _:genid8677 . _:genid8676 . _:genid8676 . _:genid8676 . _:genid8677 . _:genid8674 _:genid8675 . _:genid8674 . . . "IEA"^^ . "A type of yeast 2-hybrid evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007531"^^ . "yeast 2-hybrid evidence used in automatic assertion"^^ . _:genid8678 . _:genid8678 . _:genid8678 . _:genid8678 . _:genid8678 "true"^^ . _:genid8679 . _:genid8679 . _:genid8679 . _:genid8679 . _:genid8679 "true"^^ . _:genid8680 . _:genid8680 . _:genid8680 . _:genid8680 "A type of yeast 2-hybrid evidence that is used in an automatic assertion."^^ . _:genid8680 "ECO:RCT"^^ . . _:genid8681 . _:genid8682 . _:genid8684 _:genid8683 . _:genid8682 _:genid8684 . _:genid8683 . _:genid8683 . _:genid8683 . _:genid8684 . _:genid8681 _:genid8682 . _:genid8681 . . . . "IEA"^^ . "A type of Cya fusion reporter assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007532"^^ . "Cya fusion reporter assay evidence used in automatic assertion"^^ . _:genid8685 . _:genid8685 . _:genid8685 . _:genid8685 . _:genid8685 "true"^^ . _:genid8686 . _:genid8686 . _:genid8686 . _:genid8686 . _:genid8686 "true"^^ . _:genid8687 . _:genid8687 . _:genid8687 . _:genid8687 . _:genid8687 "true"^^ . _:genid8688 . _:genid8688 . _:genid8688 . _:genid8688 "A type of Cya fusion reporter assay evidence that is used in an automatic assertion."^^ . _:genid8688 "ECO:RCT"^^ . . _:genid8689 . _:genid8690 . _:genid8692 _:genid8691 . _:genid8690 _:genid8692 . _:genid8691 . _:genid8691 . _:genid8691 . _:genid8692 . _:genid8689 _:genid8690 . _:genid8689 . . . "IEA"^^ . "A type of super-resolution microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007533"^^ . "super-resolution microscopy evidence used in automatic assertion"^^ . _:genid8693 . _:genid8693 . _:genid8693 . _:genid8693 . _:genid8693 "true"^^ . _:genid8694 . _:genid8694 . _:genid8694 . _:genid8694 . _:genid8694 "true"^^ . _:genid8695 . _:genid8695 . _:genid8695 . _:genid8695 "A type of super-resolution microscopy evidence that is used in an automatic assertion."^^ . _:genid8695 "ECO:RCT"^^ . . _:genid8696 . _:genid8697 . _:genid8699 _:genid8698 . _:genid8697 _:genid8699 . _:genid8698 . _:genid8698 . _:genid8698 . _:genid8699 . _:genid8696 _:genid8697 . _:genid8696 . . . "IEA"^^ . "A type of fractionation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007534"^^ . "fractionation evidence used in automatic assertion"^^ . _:genid8700 . _:genid8700 . _:genid8700 . _:genid8700 . _:genid8700 "true"^^ . _:genid8701 . _:genid8701 . _:genid8701 . _:genid8701 . _:genid8701 "true"^^ . _:genid8702 . _:genid8702 . _:genid8702 . _:genid8702 "A type of fractionation evidence that is used in an automatic assertion."^^ . _:genid8702 "ECO:RCT"^^ . . _:genid8703 . _:genid8704 . _:genid8706 _:genid8705 . _:genid8704 _:genid8706 . _:genid8705 . _:genid8705 . _:genid8705 . _:genid8706 . _:genid8703 _:genid8704 . _:genid8703 . . . "IEA"^^ . "A type of electrophysiology assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007535"^^ . "electrophysiology assay evidence used in automatic assertion"^^ . _:genid8707 . _:genid8707 . _:genid8707 . _:genid8707 . _:genid8707 "true"^^ . _:genid8708 . _:genid8708 . _:genid8708 . _:genid8708 . _:genid8708 "true"^^ . _:genid8709 . _:genid8709 . _:genid8709 . _:genid8709 "A type of electrophysiology assay evidence that is used in an automatic assertion."^^ . _:genid8709 "ECO:RCT"^^ . . _:genid8710 . _:genid8711 . _:genid8713 _:genid8712 . _:genid8711 _:genid8713 . _:genid8712 . _:genid8712 . _:genid8712 . _:genid8713 . _:genid8710 _:genid8711 . _:genid8710 . . . "IEA"^^ . "A type of mRNA interactome capture evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007536"^^ . "mRNA interactome capture evidence used in automatic assertion"^^ . _:genid8714 . _:genid8714 . _:genid8714 . _:genid8714 . _:genid8714 "true"^^ . _:genid8715 . _:genid8715 . _:genid8715 . _:genid8715 . _:genid8715 "true"^^ . _:genid8716 . _:genid8716 . _:genid8716 . _:genid8716 "A type of mRNA interactome capture evidence that is used in an automatic assertion."^^ . _:genid8716 "ECO:RCT"^^ . . _:genid8717 . _:genid8718 . _:genid8720 _:genid8719 . _:genid8718 _:genid8720 . _:genid8719 . _:genid8719 . _:genid8719 . _:genid8720 . _:genid8717 _:genid8718 . _:genid8717 . . . "IEA"^^ . "A type of patch-clamp recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007537"^^ . "patch-clamp recording evidence used in automatic assertion"^^ . _:genid8721 . _:genid8721 . _:genid8721 . _:genid8721 . _:genid8721 "true"^^ . _:genid8722 . _:genid8722 . _:genid8722 . _:genid8722 . _:genid8722 "true"^^ . _:genid8723 . _:genid8723 . _:genid8723 . _:genid8723 "A type of patch-clamp recording evidence that is used in an automatic assertion."^^ . _:genid8723 "ECO:RCT"^^ . . _:genid8724 . _:genid8725 . _:genid8727 _:genid8726 . _:genid8725 _:genid8727 . _:genid8726 . _:genid8726 . _:genid8726 . _:genid8727 . _:genid8724 _:genid8725 . _:genid8724 . . . "IEA"^^ . "A type of whole-cell patch-clamp recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007538"^^ . "whole-cell patch-clamp recording evidence used in automatic assertion"^^ . _:genid8728 . _:genid8728 . _:genid8728 . _:genid8728 . _:genid8728 "true"^^ . _:genid8729 . _:genid8729 . _:genid8729 . _:genid8729 . _:genid8729 "true"^^ . _:genid8730 . _:genid8730 . _:genid8730 . _:genid8730 "A type of whole-cell patch-clamp recording evidence that is used in an automatic assertion."^^ . _:genid8730 "ECO:RCT"^^ . . _:genid8731 . _:genid8732 . _:genid8734 _:genid8733 . _:genid8732 _:genid8734 . _:genid8733 . _:genid8733 . _:genid8733 . _:genid8734 . _:genid8731 _:genid8732 . _:genid8731 . . . "IEA"^^ . "A type of author statement from published clinical study that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "traceable author statement from published clinical study used in automatic assertion"^^ . "ECO:0007539"^^ . "author statement from published clinical study used in automatic assertion"^^ . _:genid8735 . _:genid8735 . _:genid8735 . _:genid8735 . _:genid8735 "true"^^ . _:genid8736 . _:genid8736 . _:genid8736 . _:genid8736 . _:genid8736 "true"^^ . _:genid8737 . _:genid8737 . _:genid8737 . _:genid8737 "A type of author statement from published clinical study that is used in an automatic assertion."^^ . _:genid8737 "ECO:RCT"^^ . . _:genid8738 . _:genid8739 . _:genid8741 _:genid8740 . _:genid8739 _:genid8741 . _:genid8740 . _:genid8740 . _:genid8740 . _:genid8741 . _:genid8738 _:genid8739 . _:genid8738 . . . "IEA"^^ . "A type of inference based on individual clinical experience that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007540"^^ . "inference based on individual clinical experience used in automatic assertion"^^ . _:genid8742 . _:genid8742 . _:genid8742 . _:genid8742 . _:genid8742 "true"^^ . _:genid8743 . _:genid8743 . _:genid8743 . _:genid8743 . _:genid8743 "true"^^ . _:genid8744 . _:genid8744 . _:genid8744 . _:genid8744 "A type of inference based on individual clinical experience that is used in an automatic assertion."^^ . _:genid8744 "ECO:RCT"^^ . . _:genid8745 . _:genid8746 . _:genid8748 _:genid8747 . _:genid8746 _:genid8748 . _:genid8747 . _:genid8747 . _:genid8747 . _:genid8748 . _:genid8745 _:genid8746 . _:genid8745 . . . "IEA"^^ . "A type of biofilm formation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007541"^^ . "biofilm formation assay evidence used in automatic assertion"^^ . _:genid8749 . _:genid8749 . _:genid8749 . _:genid8749 . _:genid8749 "true"^^ . _:genid8750 . _:genid8750 . _:genid8750 . _:genid8750 . _:genid8750 "true"^^ . _:genid8751 . _:genid8751 . _:genid8751 . _:genid8751 "A type of biofilm formation assay evidence that is used in an automatic assertion."^^ . _:genid8751 "ECO:RCT"^^ . . _:genid8752 . _:genid8753 . _:genid8755 _:genid8754 . _:genid8753 _:genid8755 . _:genid8754 . _:genid8754 . _:genid8754 . _:genid8755 . _:genid8752 _:genid8753 . _:genid8752 . . . "IEA"^^ . "A type of microtiter plate biofilm assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007542"^^ . "microtiter plate biofilm assay evidence used in automatic assertion"^^ . _:genid8756 . _:genid8756 . _:genid8756 . _:genid8756 . _:genid8756 "true"^^ . _:genid8757 . _:genid8757 . _:genid8757 . _:genid8757 . _:genid8757 "true"^^ . _:genid8758 . _:genid8758 . _:genid8758 . _:genid8758 "A type of microtiter plate biofilm assay evidence that is used in an automatic assertion."^^ . _:genid8758 "ECO:RCT"^^ . . _:genid8759 . _:genid8760 . _:genid8762 _:genid8761 . _:genid8760 _:genid8762 . _:genid8761 . _:genid8761 . _:genid8761 . _:genid8762 . _:genid8759 _:genid8760 . _:genid8759 . . . "IEA"^^ . "A type of air-liquid interface assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007543"^^ . "air-liquid interface assay evidence used in automatic assertion"^^ . _:genid8763 . _:genid8763 . _:genid8763 . _:genid8763 . _:genid8763 "true"^^ . _:genid8764 . _:genid8764 . _:genid8764 . _:genid8764 . _:genid8764 "true"^^ . _:genid8765 . _:genid8765 . _:genid8765 . _:genid8765 "A type of air-liquid interface assay evidence that is used in an automatic assertion."^^ . _:genid8765 "ECO:RCT"^^ . . _:genid8766 . _:genid8767 . _:genid8769 _:genid8768 . _:genid8767 _:genid8769 . _:genid8768 . _:genid8768 . _:genid8768 . _:genid8769 . _:genid8766 _:genid8767 . _:genid8766 . . . "IEA"^^ . "A type of colony biofilm assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007544"^^ . "colony biofilm assay evidence used in automatic assertion"^^ . _:genid8770 . _:genid8770 . _:genid8770 . _:genid8770 . _:genid8770 "true"^^ . _:genid8771 . _:genid8771 . _:genid8771 . _:genid8771 . _:genid8771 "true"^^ . _:genid8772 . _:genid8772 . _:genid8772 . _:genid8772 "A type of colony biofilm assay evidence that is used in an automatic assertion."^^ . _:genid8772 "ECO:RCT"^^ . . _:genid8773 . _:genid8774 . _:genid8776 _:genid8775 . _:genid8774 _:genid8776 . _:genid8775 . _:genid8775 . _:genid8775 . _:genid8776 . _:genid8773 _:genid8774 . _:genid8773 . . . "IEA"^^ . "A type of Kadouri drip-fed biofilm assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007545"^^ . "Kadouri drip-fed biofilm assay evidence used in automatic assertion"^^ . _:genid8777 . _:genid8777 . _:genid8777 . _:genid8777 . _:genid8777 "true"^^ . _:genid8778 . _:genid8778 . _:genid8778 . _:genid8778 . _:genid8778 "true"^^ . _:genid8779 . _:genid8779 . _:genid8779 . _:genid8779 "A type of Kadouri drip-fed biofilm assay evidence that is used in an automatic assertion."^^ . _:genid8779 "ECO:RCT"^^ . . _:genid8780 . _:genid8781 . _:genid8783 _:genid8782 . _:genid8781 _:genid8783 . _:genid8782 . _:genid8782 . _:genid8782 . _:genid8783 . _:genid8780 _:genid8781 . _:genid8780 . . . "IEA"^^ . "A type of co-immunoprecipitation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007546"^^ . "co-immunoprecipitation evidence used in automatic assertion"^^ . _:genid8784 . _:genid8784 . _:genid8784 . _:genid8784 . _:genid8784 "true"^^ . _:genid8785 . _:genid8785 . _:genid8785 . _:genid8785 . _:genid8785 "true"^^ . _:genid8786 . _:genid8786 . _:genid8786 . _:genid8786 "A type of co-immunoprecipitation evidence that is used in an automatic assertion."^^ . _:genid8786 "ECO:RCT"^^ . . _:genid8787 . _:genid8788 . _:genid8790 _:genid8789 . _:genid8788 _:genid8790 . _:genid8789 . _:genid8789 . _:genid8789 . _:genid8790 . _:genid8787 _:genid8788 . _:genid8787 . . . "IEA"^^ . "A type of optogenetic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007547"^^ . "optogenetic evidence used in automatic assertion"^^ . _:genid8791 . _:genid8791 . _:genid8791 . _:genid8791 . _:genid8791 "true"^^ . _:genid8792 . _:genid8792 . _:genid8792 . _:genid8792 . _:genid8792 "true"^^ . _:genid8793 . _:genid8793 . _:genid8793 . _:genid8793 "A type of optogenetic evidence that is used in an automatic assertion."^^ . _:genid8793 "ECO:RCT"^^ . . _:genid8794 . _:genid8795 . _:genid8797 _:genid8796 . _:genid8795 _:genid8797 . _:genid8796 . _:genid8796 . _:genid8796 . _:genid8797 . _:genid8794 _:genid8795 . _:genid8794 . . . "IEA"^^ . "A type of fluorescent sensor evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007548"^^ . "fluorescent sensor evidence used in automatic assertion"^^ . _:genid8798 . _:genid8798 . _:genid8798 . _:genid8798 . _:genid8798 "true"^^ . _:genid8799 . _:genid8799 . _:genid8799 . _:genid8799 . _:genid8799 "true"^^ . _:genid8800 . _:genid8800 . _:genid8800 . _:genid8800 "A type of fluorescent sensor evidence that is used in an automatic assertion."^^ . _:genid8800 "ECO:RCT"^^ . . _:genid8801 . _:genid8802 . _:genid8804 _:genid8803 . _:genid8802 _:genid8804 . _:genid8803 . _:genid8803 . _:genid8803 . _:genid8804 . _:genid8801 _:genid8802 . _:genid8801 . . . "IEA"^^ . "A type of genetically encoded fluorescent sensor evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007549"^^ . "genetically encoded fluorescent sensor evidence used in automatic assertion"^^ . _:genid8805 . _:genid8805 . _:genid8805 . _:genid8805 . _:genid8805 "true"^^ . _:genid8806 . _:genid8806 . _:genid8806 . _:genid8806 . _:genid8806 "true"^^ . _:genid8807 . _:genid8807 . _:genid8807 . _:genid8807 "A type of genetically encoded fluorescent sensor evidence that is used in an automatic assertion."^^ . _:genid8807 "ECO:RCT"^^ . . _:genid8808 . _:genid8809 . _:genid8811 _:genid8810 . _:genid8809 _:genid8811 . _:genid8810 . _:genid8810 . _:genid8810 . _:genid8811 . _:genid8808 _:genid8809 . _:genid8808 . . . . "IEA"^^ . "A type of genetically encoded fluorescent electrophysiology assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007550"^^ . "genetically encoded fluorescent electrophysiology assay evidence used in automatic assertion"^^ . _:genid8812 . _:genid8812 . _:genid8812 . _:genid8812 . _:genid8812 "true"^^ . _:genid8813 . _:genid8813 . _:genid8813 . _:genid8813 . _:genid8813 "true"^^ . _:genid8814 . _:genid8814 . _:genid8814 . _:genid8814 . _:genid8814 "true"^^ . _:genid8815 . _:genid8815 . _:genid8815 . _:genid8815 "A type of genetically encoded fluorescent electrophysiology assay evidence that is used in an automatic assertion."^^ . _:genid8815 "ECO:RCT"^^ . . _:genid8816 . _:genid8817 . _:genid8819 _:genid8818 . _:genid8817 _:genid8819 . _:genid8818 . _:genid8818 . _:genid8818 . _:genid8819 . _:genid8816 _:genid8817 . _:genid8816 . . . "IEA"^^ . "A type of genetically encoded fluorescent ion concentration sensor assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007551"^^ . "genetically encoded fluorescent ion concentration sensor assay evidence used in automatic assertion"^^ . _:genid8820 . _:genid8820 . _:genid8820 . _:genid8820 . _:genid8820 "true"^^ . _:genid8821 . _:genid8821 . _:genid8821 . _:genid8821 . _:genid8821 "true"^^ . _:genid8822 . _:genid8822 . _:genid8822 . _:genid8822 "A type of genetically encoded fluorescent ion concentration sensor assay evidence that is used in an automatic assertion."^^ . _:genid8822 "ECO:RCT"^^ . . _:genid8823 . _:genid8824 . _:genid8826 _:genid8825 . _:genid8824 _:genid8826 . _:genid8825 . _:genid8825 . _:genid8825 . _:genid8826 . _:genid8823 _:genid8824 . _:genid8823 . . . "IEA"^^ . "A type of cell fractionation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007552"^^ . "cell fractionation evidence used in automatic assertion"^^ . _:genid8827 . _:genid8827 . _:genid8827 . _:genid8827 . _:genid8827 "true"^^ . _:genid8828 . _:genid8828 . _:genid8828 . _:genid8828 . _:genid8828 "true"^^ . _:genid8829 . _:genid8829 . _:genid8829 . _:genid8829 "A type of cell fractionation evidence that is used in an automatic assertion."^^ . _:genid8829 "ECO:RCT"^^ . . _:genid8830 . _:genid8831 . _:genid8833 _:genid8832 . _:genid8831 _:genid8833 . _:genid8832 . _:genid8832 . _:genid8832 . _:genid8833 . _:genid8830 _:genid8831 . _:genid8830 . . . "IEA"^^ . "A type of extracellular recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007553"^^ . "extracellular recording evidence used in automatic assertion"^^ . _:genid8834 . _:genid8834 . _:genid8834 . _:genid8834 . _:genid8834 "true"^^ . _:genid8835 . _:genid8835 . _:genid8835 . _:genid8835 . _:genid8835 "true"^^ . _:genid8836 . _:genid8836 . _:genid8836 . _:genid8836 "A type of extracellular recording evidence that is used in an automatic assertion."^^ . _:genid8836 "ECO:RCT"^^ . . _:genid8837 . _:genid8838 . _:genid8840 _:genid8839 . _:genid8838 _:genid8840 . _:genid8839 . _:genid8839 . _:genid8839 . _:genid8840 . _:genid8837 _:genid8838 . _:genid8837 . . . "IEA"^^ . "A type of single-unit extracellular recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007554"^^ . "single-unit extracellular recording evidence used in automatic assertion"^^ . _:genid8841 . _:genid8841 . _:genid8841 . _:genid8841 . _:genid8841 "true"^^ . _:genid8842 . _:genid8842 . _:genid8842 . _:genid8842 . _:genid8842 "true"^^ . _:genid8843 . _:genid8843 . _:genid8843 . _:genid8843 "A type of single-unit extracellular recording evidence that is used in an automatic assertion."^^ . _:genid8843 "ECO:RCT"^^ . . _:genid8844 . _:genid8845 . _:genid8847 _:genid8846 . _:genid8845 _:genid8847 . _:genid8846 . _:genid8846 . _:genid8846 . _:genid8847 . _:genid8844 _:genid8845 . _:genid8844 . . . "IEA"^^ . "A type of field potential recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007555"^^ . "field potential recording evidence used in automatic assertion"^^ . _:genid8848 . _:genid8848 . _:genid8848 . _:genid8848 . _:genid8848 "true"^^ . _:genid8849 . _:genid8849 . _:genid8849 . _:genid8849 . _:genid8849 "true"^^ . _:genid8850 . _:genid8850 . _:genid8850 . _:genid8850 "A type of field potential recording evidence that is used in an automatic assertion."^^ . _:genid8850 "ECO:RCT"^^ . . _:genid8851 . _:genid8852 . _:genid8854 _:genid8853 . _:genid8852 _:genid8854 . _:genid8853 . _:genid8853 . _:genid8853 . _:genid8854 . _:genid8851 _:genid8852 . _:genid8851 . . . "IEA"^^ . "A type of anti-sense experiment evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007556"^^ . "anti-sense experiment evidence used in automatic assertion"^^ . _:genid8855 . _:genid8855 . _:genid8855 . _:genid8855 . _:genid8855 "true"^^ . _:genid8856 . _:genid8856 . _:genid8856 . _:genid8856 . _:genid8856 "true"^^ . _:genid8857 . _:genid8857 . _:genid8857 . _:genid8857 "A type of anti-sense experiment evidence that is used in an automatic assertion."^^ . _:genid8857 "ECO:RCT"^^ . . _:genid8858 . _:genid8859 . _:genid8861 _:genid8860 . _:genid8859 _:genid8861 . _:genid8860 . _:genid8860 . _:genid8860 . _:genid8861 . _:genid8858 _:genid8859 . _:genid8858 . . . "IEA"^^ . "A type of morpholino experiment evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007557"^^ . "morpholino experiment evidence used in automatic assertion"^^ . _:genid8862 . _:genid8862 . _:genid8862 . _:genid8862 . _:genid8862 "true"^^ . _:genid8863 . _:genid8863 . _:genid8863 . _:genid8863 . _:genid8863 "true"^^ . _:genid8864 . _:genid8864 . _:genid8864 . _:genid8864 "A type of morpholino experiment evidence that is used in an automatic assertion."^^ . _:genid8864 "ECO:RCT"^^ . . _:genid8865 . _:genid8866 . _:genid8868 _:genid8867 . _:genid8866 _:genid8868 . _:genid8867 . _:genid8867 . _:genid8867 . _:genid8868 . _:genid8865 _:genid8866 . _:genid8865 . . . "IEA"^^ . "A type of RNAi evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007558"^^ . "RNAi evidence used in automatic assertion"^^ . _:genid8869 . _:genid8869 . _:genid8869 . _:genid8869 . _:genid8869 "true"^^ . _:genid8870 . _:genid8870 . _:genid8870 . _:genid8870 . _:genid8870 "true"^^ . _:genid8871 . _:genid8871 . _:genid8871 . _:genid8871 "A type of RNAi evidence that is used in an automatic assertion."^^ . _:genid8871 "ECO:RCT"^^ . . _:genid8872 . _:genid8873 . _:genid8875 _:genid8874 . _:genid8873 _:genid8875 . _:genid8874 . _:genid8874 . _:genid8874 . _:genid8875 . _:genid8872 _:genid8873 . _:genid8872 . . . "IEA"^^ . "A type of pharmacological assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007559"^^ . "pharmacological assay evidence used in automatic assertion"^^ . _:genid8876 . _:genid8876 . _:genid8876 . _:genid8876 . _:genid8876 "true"^^ . _:genid8877 . _:genid8877 . _:genid8877 . _:genid8877 . _:genid8877 "true"^^ . _:genid8878 . _:genid8878 . _:genid8878 . _:genid8878 "A type of pharmacological assay evidence that is used in an automatic assertion."^^ . _:genid8878 "ECO:RCT"^^ . . _:genid8879 . _:genid8880 . _:genid8882 _:genid8881 . _:genid8880 _:genid8882 . _:genid8881 . _:genid8881 . _:genid8881 . _:genid8882 . _:genid8879 _:genid8880 . _:genid8879 . . . . "IEA"^^ . "A type of immunofluorescence wide-field microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007560"^^ . "immunofluorescence wide-field microscopy evidence used in automatic assertion"^^ . _:genid8883 . _:genid8883 . _:genid8883 . _:genid8883 . _:genid8883 "true"^^ . _:genid8884 . _:genid8884 . _:genid8884 . _:genid8884 . _:genid8884 "true"^^ . _:genid8885 . _:genid8885 . _:genid8885 . _:genid8885 . _:genid8885 "true"^^ . _:genid8886 . _:genid8886 . _:genid8886 . _:genid8886 "A type of immunofluorescence wide-field microscopy evidence that is used in an automatic assertion."^^ . _:genid8886 "ECO:RCT"^^ . . _:genid8887 . _:genid8888 . _:genid8890 _:genid8889 . _:genid8888 _:genid8890 . _:genid8889 . _:genid8889 . _:genid8889 . _:genid8890 . _:genid8887 _:genid8888 . _:genid8887 . . . "IEA"^^ . "A type of wide-field fluorescence microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007561"^^ . "wide-field fluorescence microscopy evidence used in automatic assertion"^^ . _:genid8891 . _:genid8891 . _:genid8891 . _:genid8891 . _:genid8891 "true"^^ . _:genid8892 . _:genid8892 . _:genid8892 . _:genid8892 . _:genid8892 "true"^^ . _:genid8893 . _:genid8893 . _:genid8893 . _:genid8893 "A type of wide-field fluorescence microscopy evidence that is used in an automatic assertion."^^ . _:genid8893 "ECO:RCT"^^ . . _:genid8894 . _:genid8895 . _:genid8897 _:genid8896 . _:genid8895 _:genid8897 . _:genid8896 . _:genid8896 . _:genid8896 . _:genid8897 . _:genid8894 _:genid8895 . _:genid8894 . . . "IEA"^^ . "A type of over expression analysis evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007562"^^ . "over expression analysis evidence used in automatic assertion"^^ . _:genid8898 . _:genid8898 . _:genid8898 . _:genid8898 . _:genid8898 "true"^^ . _:genid8899 . _:genid8899 . _:genid8899 . _:genid8899 . _:genid8899 "true"^^ . _:genid8900 . _:genid8900 . _:genid8900 . _:genid8900 "A type of over expression analysis evidence that is used in an automatic assertion."^^ . _:genid8900 "ECO:RCT"^^ . . _:genid8901 . _:genid8902 . _:genid8904 _:genid8903 . _:genid8902 _:genid8904 . _:genid8903 . _:genid8903 . _:genid8903 . _:genid8904 . _:genid8901 _:genid8902 . _:genid8901 . . . "IEA"^^ . "A type of cell-free assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007563"^^ . "cell-free assay evidence used in automatic assertion"^^ . _:genid8905 . _:genid8905 . _:genid8905 . _:genid8905 . _:genid8905 "true"^^ . _:genid8906 . _:genid8906 . _:genid8906 . _:genid8906 . _:genid8906 "true"^^ . _:genid8907 . _:genid8907 . _:genid8907 . _:genid8907 "A type of cell-free assay evidence that is used in an automatic assertion."^^ . _:genid8907 "ECO:RCT"^^ . . _:genid8908 . _:genid8909 . _:genid8911 _:genid8910 . _:genid8909 _:genid8911 . _:genid8910 . _:genid8910 . _:genid8910 . _:genid8911 . _:genid8908 _:genid8909 . _:genid8908 . . . "IEA"^^ . "A type of fluorescence recovery after photobleaching evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007564"^^ . "fluorescence recovery after photobleaching evidence used in automatic assertion"^^ . _:genid8912 . _:genid8912 . _:genid8912 . _:genid8912 . _:genid8912 "true"^^ . _:genid8913 . _:genid8913 . _:genid8913 . _:genid8913 . _:genid8913 "true"^^ . _:genid8914 . _:genid8914 . _:genid8914 . _:genid8914 "A type of fluorescence recovery after photobleaching evidence that is used in an automatic assertion."^^ . _:genid8914 "ECO:RCT"^^ . . _:genid8915 . _:genid8916 . _:genid8918 _:genid8917 . _:genid8916 _:genid8918 . _:genid8917 . _:genid8917 . _:genid8917 . _:genid8918 . _:genid8915 _:genid8916 . _:genid8915 . . . "IEA"^^ . "A type of immuno-labelling electron microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007565"^^ . "immuno-labelling electron microscopy evidence used in automatic assertion"^^ . _:genid8919 . _:genid8919 . _:genid8919 . _:genid8919 . _:genid8919 "true"^^ . _:genid8920 . _:genid8920 . _:genid8920 . _:genid8920 . _:genid8920 "true"^^ . _:genid8921 . _:genid8921 . _:genid8921 . _:genid8921 "A type of immuno-labelling electron microscopy evidence that is used in an automatic assertion."^^ . _:genid8921 "ECO:RCT"^^ . . _:genid8922 . _:genid8923 . _:genid8925 _:genid8924 . _:genid8923 _:genid8925 . _:genid8924 . _:genid8924 . _:genid8924 . _:genid8925 . _:genid8922 _:genid8923 . _:genid8922 . . . "IEA"^^ . "A type of immunofluorescence super resolution microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007566"^^ . "immunofluorescence super resolution microscopy evidence used in automatic assertion"^^ . _:genid8926 . _:genid8926 . _:genid8926 . _:genid8926 . _:genid8926 "true"^^ . _:genid8927 . _:genid8927 . _:genid8927 . _:genid8927 . _:genid8927 "true"^^ . _:genid8928 . _:genid8928 . _:genid8928 . _:genid8928 "A type of immunofluorescence super resolution microscopy evidence that is used in an automatic assertion."^^ . _:genid8928 "ECO:RCT"^^ . . _:genid8929 . _:genid8930 . _:genid8932 _:genid8931 . _:genid8930 _:genid8932 . _:genid8931 . _:genid8931 . _:genid8931 . _:genid8932 . _:genid8929 _:genid8930 . _:genid8929 . . . "IEA"^^ . "A type of co-purification evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007567"^^ . "co-purification evidence used in automatic assertion"^^ . _:genid8933 . _:genid8933 . _:genid8933 . _:genid8933 . _:genid8933 "true"^^ . _:genid8934 . _:genid8934 . _:genid8934 . _:genid8934 . _:genid8934 "true"^^ . _:genid8935 . _:genid8935 . _:genid8935 . _:genid8935 "A type of co-purification evidence that is used in an automatic assertion."^^ . _:genid8935 "ECO:RCT"^^ . . _:genid8936 . _:genid8937 . _:genid8939 _:genid8938 . _:genid8937 _:genid8939 . _:genid8938 . _:genid8938 . _:genid8938 . _:genid8939 . _:genid8936 _:genid8937 . _:genid8936 . . . "IEA"^^ . "A type of yeast one-hybrid evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007568"^^ . "yeast one-hybrid evidence used in automatic assertion"^^ . _:genid8940 . _:genid8940 . _:genid8940 . _:genid8940 . _:genid8940 "true"^^ . _:genid8941 . _:genid8941 . _:genid8941 . _:genid8941 . _:genid8941 "true"^^ . _:genid8942 . _:genid8942 . _:genid8942 . _:genid8942 "A type of yeast one-hybrid evidence that is used in an automatic assertion."^^ . _:genid8942 "ECO:RCT"^^ . . _:genid8943 . _:genid8944 . _:genid8946 _:genid8945 . _:genid8944 _:genid8946 . _:genid8945 . _:genid8945 . _:genid8945 . _:genid8946 . _:genid8943 _:genid8944 . _:genid8943 . . . "IEA"^^ . "A type of split-ubiquitin functional complementation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007569"^^ . "split-ubiquitin functional complementation evidence used in automatic assertion"^^ . _:genid8947 . _:genid8947 . _:genid8947 . _:genid8947 . _:genid8947 "true"^^ . _:genid8948 . _:genid8948 . _:genid8948 . _:genid8948 . _:genid8948 "true"^^ . _:genid8949 . _:genid8949 . _:genid8949 . _:genid8949 "A type of split-ubiquitin functional complementation evidence that is used in an automatic assertion."^^ . _:genid8949 "ECO:RCT"^^ . . _:genid8950 . _:genid8951 . _:genid8953 _:genid8952 . _:genid8951 _:genid8953 . _:genid8952 . _:genid8952 . _:genid8952 . _:genid8953 . _:genid8950 _:genid8951 . _:genid8950 . . . "IEA"^^ . "A type of far-Western blotting evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007570"^^ . "far-Western blotting evidence used in automatic assertion"^^ . _:genid8954 . _:genid8954 . _:genid8954 . _:genid8954 . _:genid8954 "true"^^ . _:genid8955 . _:genid8955 . _:genid8955 . _:genid8955 . _:genid8955 "true"^^ . _:genid8956 . _:genid8956 . _:genid8956 . _:genid8956 "A type of far-Western blotting evidence that is used in an automatic assertion."^^ . _:genid8956 "ECO:RCT"^^ . . _:genid8957 . _:genid8958 . _:genid8960 _:genid8959 . _:genid8958 _:genid8960 . _:genid8959 . _:genid8959 . _:genid8959 . _:genid8960 . _:genid8957 _:genid8958 . _:genid8957 . . . "IEA"^^ . "A type of affinity chromatography evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007571"^^ . "affinity chromatography evidence used in automatic assertion"^^ . _:genid8961 . _:genid8961 . _:genid8961 . _:genid8961 . _:genid8961 "true"^^ . _:genid8962 . _:genid8962 . _:genid8962 . _:genid8962 . _:genid8962 "true"^^ . _:genid8963 . _:genid8963 . _:genid8963 . _:genid8963 "A type of affinity chromatography evidence that is used in an automatic assertion."^^ . _:genid8963 "ECO:RCT"^^ . . _:genid8964 . _:genid8965 . _:genid8967 _:genid8966 . _:genid8965 _:genid8967 . _:genid8966 . _:genid8966 . _:genid8966 . _:genid8967 . _:genid8964 _:genid8965 . _:genid8964 . . . "IEA"^^ . "A type of ribohomopolymer binding assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007572"^^ . "ribohomopolymer binding assay evidence used in automatic assertion"^^ . _:genid8968 . _:genid8968 . _:genid8968 . _:genid8968 . _:genid8968 "true"^^ . _:genid8969 . _:genid8969 . _:genid8969 . _:genid8969 . _:genid8969 "true"^^ . _:genid8970 . _:genid8970 . _:genid8970 . _:genid8970 "A type of ribohomopolymer binding assay evidence that is used in an automatic assertion."^^ . _:genid8970 "ECO:RCT"^^ . . _:genid8971 . _:genid8972 . _:genid8974 _:genid8973 . _:genid8972 _:genid8974 . _:genid8973 . _:genid8973 . _:genid8973 . _:genid8974 . _:genid8971 _:genid8972 . _:genid8971 . . . "IEA"^^ . "A type of protein:ion binding evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007573"^^ . "protein:ion binding evidence used in automatic assertion"^^ . _:genid8975 . _:genid8975 . _:genid8975 . _:genid8975 . _:genid8975 "true"^^ . _:genid8976 . _:genid8976 . _:genid8976 . _:genid8976 . _:genid8976 "true"^^ . _:genid8977 . _:genid8977 . _:genid8977 . _:genid8977 "A type of protein:ion binding evidence that is used in an automatic assertion."^^ . _:genid8977 "ECO:RCT"^^ . . _:genid8978 . _:genid8979 . _:genid8981 _:genid8980 . _:genid8979 _:genid8981 . _:genid8980 . _:genid8980 . _:genid8980 . _:genid8981 . _:genid8978 _:genid8979 . _:genid8978 . . . "IEA"^^ . "A type of Southwestern blot evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007574"^^ . "Southwestern blot evidence used in automatic assertion"^^ . _:genid8982 . _:genid8982 . _:genid8982 . _:genid8982 . _:genid8982 "true"^^ . _:genid8983 . _:genid8983 . _:genid8983 . _:genid8983 . _:genid8983 "true"^^ . _:genid8984 . _:genid8984 . _:genid8984 . _:genid8984 "A type of Southwestern blot evidence that is used in an automatic assertion."^^ . _:genid8984 "ECO:RCT"^^ . . _:genid8985 . _:genid8986 . _:genid8988 _:genid8987 . _:genid8986 _:genid8988 . _:genid8987 . _:genid8987 . _:genid8987 . _:genid8988 . _:genid8985 _:genid8986 . _:genid8985 . . . "IEA"^^ . "A type of Northwestern blot evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007575"^^ . "Northwestern blot evidence used in automatic assertion"^^ . _:genid8989 . _:genid8989 . _:genid8989 . _:genid8989 . _:genid8989 "true"^^ . _:genid8990 . _:genid8990 . _:genid8990 . _:genid8990 . _:genid8990 "true"^^ . _:genid8991 . _:genid8991 . _:genid8991 . _:genid8991 "A type of Northwestern blot evidence that is used in an automatic assertion."^^ . _:genid8991 "ECO:RCT"^^ . . _:genid8992 . _:genid8993 . _:genid8995 _:genid8994 . _:genid8993 _:genid8995 . _:genid8994 . _:genid8994 . _:genid8994 . _:genid8995 . _:genid8992 _:genid8993 . _:genid8992 . . . "IEA"^^ . "A type of bacterial one-hybrid evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007576"^^ . "bacterial one-hybrid evidence used in automatic assertion"^^ . _:genid8996 . _:genid8996 . _:genid8996 . _:genid8996 . _:genid8996 "true"^^ . _:genid8997 . _:genid8997 . _:genid8997 . _:genid8997 . _:genid8997 "true"^^ . _:genid8998 . _:genid8998 . _:genid8998 . _:genid8998 "A type of bacterial one-hybrid evidence that is used in an automatic assertion."^^ . _:genid8998 "ECO:RCT"^^ . . _:genid8999 . _:genid9000 . _:genid9002 _:genid9001 . _:genid9000 _:genid9002 . _:genid9001 . _:genid9001 . _:genid9001 . _:genid9002 . _:genid8999 _:genid9000 . _:genid8999 . . . . "IEA"^^ . "A type of protein-oligonucleotide microarray binding evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007577"^^ . "protein-oligonucleotide microarray binding evidence used in automatic assertion"^^ . _:genid9003 . _:genid9003 . _:genid9003 . _:genid9003 . _:genid9003 "true"^^ . _:genid9004 . _:genid9004 . _:genid9004 . _:genid9004 . _:genid9004 "true"^^ . _:genid9005 . _:genid9005 . _:genid9005 . _:genid9005 . _:genid9005 "true"^^ . _:genid9006 . _:genid9006 . _:genid9006 . _:genid9006 "A type of protein-oligonucleotide microarray binding evidence that is used in an automatic assertion."^^ . _:genid9006 "ECO:RCT"^^ . . _:genid9007 . _:genid9008 . _:genid9010 _:genid9009 . _:genid9008 _:genid9010 . _:genid9009 . _:genid9009 . _:genid9009 . _:genid9010 . _:genid9007 _:genid9008 . _:genid9007 . . . "IEA"^^ . "A type of functional complementation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007578"^^ . "functional complementation evidence used in automatic assertion"^^ . _:genid9011 . _:genid9011 . _:genid9011 . _:genid9011 . _:genid9011 "true"^^ . _:genid9012 . _:genid9012 . _:genid9012 . _:genid9012 . _:genid9012 "true"^^ . _:genid9013 . _:genid9013 . _:genid9013 . _:genid9013 "A type of functional complementation evidence that is used in an automatic assertion."^^ . _:genid9013 "ECO:RCT"^^ . . _:genid9014 . _:genid9015 . _:genid9017 _:genid9016 . _:genid9015 _:genid9017 . _:genid9016 . _:genid9016 . _:genid9016 . _:genid9017 . _:genid9014 _:genid9015 . _:genid9014 . . . "IEA"^^ . "A type of transgenic rescue experiment evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007579"^^ . "transgenic rescue experiment evidence used in automatic assertion"^^ . _:genid9018 . _:genid9018 . _:genid9018 . _:genid9018 . _:genid9018 "true"^^ . _:genid9019 . _:genid9019 . _:genid9019 . _:genid9019 . _:genid9019 "true"^^ . _:genid9020 . _:genid9020 . _:genid9020 . _:genid9020 "A type of transgenic rescue experiment evidence that is used in an automatic assertion."^^ . _:genid9020 "ECO:RCT"^^ . . _:genid9021 . _:genid9022 . _:genid9024 _:genid9023 . _:genid9022 _:genid9024 . _:genid9023 . _:genid9023 . _:genid9023 . _:genid9024 . _:genid9021 _:genid9022 . _:genid9021 . . . "IEA"^^ . "A type of transient rescue experiment evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007580"^^ . "transient rescue experiment evidence used in automatic assertion"^^ . _:genid9025 . _:genid9025 . _:genid9025 . _:genid9025 . _:genid9025 "true"^^ . _:genid9026 . _:genid9026 . _:genid9026 . _:genid9026 . _:genid9026 "true"^^ . _:genid9027 . _:genid9027 . _:genid9027 . _:genid9027 "A type of transient rescue experiment evidence that is used in an automatic assertion."^^ . _:genid9027 "ECO:RCT"^^ . . _:genid9028 . _:genid9029 . _:genid9031 _:genid9030 . _:genid9029 _:genid9031 . _:genid9030 . _:genid9030 . _:genid9030 . _:genid9031 . _:genid9028 _:genid9029 . _:genid9028 . . . "IEA"^^ . "A type of suppressor/enhancer interaction phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "suppressor/enhancer interaction evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007581"^^ . "suppressor/enhancer interaction phenotypic evidence used in automatic assertion"^^ . _:genid9032 . _:genid9032 . _:genid9032 . _:genid9032 . _:genid9032 "true"^^ . _:genid9033 . _:genid9033 . _:genid9033 . _:genid9033 . _:genid9033 "true"^^ . _:genid9034 . _:genid9034 . _:genid9034 . _:genid9034 "A type of suppressor/enhancer interaction phenotypic evidence that is used in an automatic assertion."^^ . _:genid9034 "ECO:RCT"^^ . . _:genid9035 . _:genid9036 . _:genid9038 _:genid9037 . _:genid9036 _:genid9038 . _:genid9037 . _:genid9037 . _:genid9037 . _:genid9038 . _:genid9035 _:genid9036 . _:genid9035 . . . "IEA"^^ . "A type of double mutant phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "double mutant phenotype evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007582"^^ . "double mutant phenotypic evidence used in automatic assertion"^^ . _:genid9039 . _:genid9039 . _:genid9039 . _:genid9039 . _:genid9039 "true"^^ . _:genid9040 . _:genid9040 . _:genid9040 . _:genid9040 . _:genid9040 "true"^^ . _:genid9041 . _:genid9041 . _:genid9041 . _:genid9041 "A type of double mutant phenotypic evidence that is used in an automatic assertion."^^ . _:genid9041 "ECO:RCT"^^ . . _:genid9042 . _:genid9043 . _:genid9045 _:genid9044 . _:genid9043 _:genid9045 . _:genid9044 . _:genid9044 . _:genid9044 . _:genid9045 . _:genid9042 _:genid9043 . _:genid9042 . . . "IEA"^^ . "A type of epistatic interaction phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "epistatic interaction evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007583"^^ . "epistatic interaction phenotypic evidence used in automatic assertion"^^ . _:genid9046 . _:genid9046 . _:genid9046 . _:genid9046 . _:genid9046 "true"^^ . _:genid9047 . _:genid9047 . _:genid9047 . _:genid9047 . _:genid9047 "true"^^ . _:genid9048 . _:genid9048 . _:genid9048 . _:genid9048 "A type of epistatic interaction phenotypic evidence that is used in an automatic assertion."^^ . _:genid9048 "ECO:RCT"^^ . . _:genid9049 . _:genid9050 . _:genid9052 _:genid9051 . _:genid9050 _:genid9052 . _:genid9051 . _:genid9051 . _:genid9051 . _:genid9052 . _:genid9049 _:genid9050 . _:genid9049 . . . "IEA"^^ . "A type of functional complementation in heterologous system evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007584"^^ . "functional complementation in heterologous system evidence used in automatic assertion"^^ . _:genid9053 . _:genid9053 . _:genid9053 . _:genid9053 . _:genid9053 "true"^^ . _:genid9054 . _:genid9054 . _:genid9054 . _:genid9054 . _:genid9054 "true"^^ . _:genid9055 . _:genid9055 . _:genid9055 . _:genid9055 "A type of functional complementation in heterologous system evidence that is used in an automatic assertion."^^ . _:genid9055 "ECO:RCT"^^ . . _:genid9056 . _:genid9057 . _:genid9059 _:genid9058 . _:genid9057 _:genid9059 . _:genid9058 . _:genid9058 . _:genid9058 . _:genid9059 . _:genid9056 _:genid9057 . _:genid9056 . . . "IEA"^^ . "A type of temperature-sensitive mutant phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "temperature-sensitive mutant phenotype evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007585"^^ . "temperature-sensitive mutant phenotypic evidence used in automatic assertion"^^ . _:genid9060 . _:genid9060 . _:genid9060 . _:genid9060 . _:genid9060 "true"^^ . _:genid9061 . _:genid9061 . _:genid9061 . _:genid9061 . _:genid9061 "true"^^ . _:genid9062 . _:genid9062 . _:genid9062 . _:genid9062 "A type of temperature-sensitive mutant phenotypic evidence that is used in an automatic assertion."^^ . _:genid9062 "ECO:RCT"^^ . . _:genid9063 . _:genid9064 . _:genid9066 _:genid9065 . _:genid9064 _:genid9066 . _:genid9065 . _:genid9065 . _:genid9065 . _:genid9066 . _:genid9063 _:genid9064 . _:genid9063 . . . "IEA"^^ . "A type of recessive mutant phenotype evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007586"^^ . "recessive mutant phenotype evidence used in automatic assertion"^^ . _:genid9067 . _:genid9067 . _:genid9067 . _:genid9067 . _:genid9067 "true"^^ . _:genid9068 . _:genid9068 . _:genid9068 . _:genid9068 . _:genid9068 "true"^^ . _:genid9069 . _:genid9069 . _:genid9069 . _:genid9069 "A type of recessive mutant phenotype evidence that is used in an automatic assertion."^^ . _:genid9069 "ECO:RCT"^^ . . _:genid9070 . _:genid9071 . _:genid9073 _:genid9072 . _:genid9071 _:genid9073 . _:genid9072 . _:genid9072 . _:genid9072 . _:genid9073 . _:genid9070 _:genid9071 . _:genid9070 . . . . "IEA"^^ . "A type of high throughput mutant phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "high throughput mutant phenotype evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007587"^^ . "high throughput mutant phenotypic evidence used in automatic assertion"^^ . _:genid9074 . _:genid9074 . _:genid9074 . _:genid9074 . _:genid9074 "true"^^ . _:genid9075 . _:genid9075 . _:genid9075 . _:genid9075 . _:genid9075 "true"^^ . _:genid9076 . _:genid9076 . _:genid9076 . _:genid9076 . _:genid9076 "true"^^ . _:genid9077 . _:genid9077 . _:genid9077 . _:genid9077 "A type of high throughput mutant phenotypic evidence that is used in an automatic assertion."^^ . _:genid9077 "ECO:RCT"^^ . . _:genid9078 . _:genid9079 . _:genid9081 _:genid9080 . _:genid9079 _:genid9081 . _:genid9080 . _:genid9080 . _:genid9080 . _:genid9081 . _:genid9078 _:genid9079 . _:genid9078 . . . . "IEA"^^ . "A type of high throughput genetic interaction phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "high throughput genetic interaction evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007588"^^ . "high throughput genetic interaction phenotypic evidence used in automatic assertion"^^ . _:genid9082 . _:genid9082 . _:genid9082 . _:genid9082 . _:genid9082 "true"^^ . _:genid9083 . _:genid9083 . _:genid9083 . _:genid9083 . _:genid9083 "true"^^ . _:genid9084 . _:genid9084 . _:genid9084 . _:genid9084 . _:genid9084 "true"^^ . _:genid9085 . _:genid9085 . _:genid9085 . _:genid9085 "A type of high throughput genetic interaction phenotypic evidence that is used in an automatic assertion."^^ . _:genid9085 "ECO:RCT"^^ . . _:genid9086 . _:genid9087 . _:genid9089 _:genid9088 . _:genid9087 _:genid9089 . _:genid9088 . _:genid9088 . _:genid9088 . _:genid9089 . _:genid9086 _:genid9087 . _:genid9086 . . . . "IEA"^^ . "A type of high throughput direct assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007589"^^ . "high throughput direct assay evidence used in automatic assertion"^^ . _:genid9090 . _:genid9090 . _:genid9090 . _:genid9090 . _:genid9090 "true"^^ . _:genid9091 . _:genid9091 . _:genid9091 . _:genid9091 . _:genid9091 "true"^^ . _:genid9092 . _:genid9092 . _:genid9092 . _:genid9092 . _:genid9092 "true"^^ . _:genid9093 . _:genid9093 . _:genid9093 . _:genid9093 "A type of high throughput direct assay evidence that is used in an automatic assertion."^^ . _:genid9093 "ECO:RCT"^^ . . _:genid9094 . _:genid9095 . _:genid9097 _:genid9096 . _:genid9095 _:genid9097 . _:genid9096 . _:genid9096 . _:genid9096 . _:genid9097 . _:genid9094 _:genid9095 . _:genid9094 . . . . "IEA"^^ . "A type of high throughput expression pattern evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007590"^^ . "high throughput expression pattern evidence used in automatic assertion"^^ . _:genid9098 . _:genid9098 . _:genid9098 . _:genid9098 . _:genid9098 "true"^^ . _:genid9099 . _:genid9099 . _:genid9099 . _:genid9099 . _:genid9099 "true"^^ . _:genid9100 . _:genid9100 . _:genid9100 . _:genid9100 . _:genid9100 "true"^^ . _:genid9101 . _:genid9101 . _:genid9101 . _:genid9101 "A type of high throughput expression pattern evidence that is used in an automatic assertion."^^ . _:genid9101 "ECO:RCT"^^ . . _:genid9102 . _:genid9103 . _:genid9105 _:genid9104 . _:genid9103 _:genid9105 . _:genid9104 . _:genid9104 . _:genid9104 . _:genid9105 . _:genid9102 _:genid9103 . _:genid9102 . . . "IEA"^^ . "A type of radioligand binding assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007591"^^ . "radioligand binding assay evidence used in automatic assertion"^^ . _:genid9106 . _:genid9106 . _:genid9106 . _:genid9106 . _:genid9106 "true"^^ . _:genid9107 . _:genid9107 . _:genid9107 . _:genid9107 . _:genid9107 "true"^^ . _:genid9108 . _:genid9108 . _:genid9108 . _:genid9108 "A type of radioligand binding assay evidence that is used in an automatic assertion."^^ . _:genid9108 "ECO:RCT"^^ . . _:genid9109 . _:genid9110 . _:genid9112 _:genid9111 . _:genid9110 _:genid9112 . _:genid9111 . _:genid9111 . _:genid9111 . _:genid9112 . _:genid9109 _:genid9110 . _:genid9109 . . . "IEA"^^ . "A type of combinatorial evidence from author knowledge and experimental evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "combinatorial evidence from author knowledge and experimental evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007592"^^ . "combinatorial experimental and author inference evidence used in automatic assertion"^^ . _:genid9113 . _:genid9113 . _:genid9113 . _:genid9113 . _:genid9113 "true"^^ . _:genid9114 . _:genid9114 . _:genid9114 . _:genid9114 . _:genid9114 "true"^^ . _:genid9115 . _:genid9115 . _:genid9115 . _:genid9115 "A type of combinatorial evidence from author knowledge and experimental evidence that is used in an automatic assertion."^^ . _:genid9115 "ECO:RCT"^^ . . _:genid9116 . _:genid9117 . _:genid9119 _:genid9118 . _:genid9117 _:genid9119 . _:genid9118 . _:genid9118 . _:genid9118 . _:genid9119 . _:genid9116 _:genid9117 . _:genid9116 . . . "IEA"^^ . "A type of combinatorial evidence from curator knowledge and experimental evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "combinatorial evidence from curator knowledge and experimental evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007593"^^ . "combinatorial experimental and curator inference evidence used in automatic assertion"^^ . _:genid9120 . _:genid9120 . _:genid9120 . _:genid9120 . _:genid9120 "true"^^ . _:genid9121 . _:genid9121 . _:genid9121 . _:genid9121 . _:genid9121 "true"^^ . _:genid9122 . _:genid9122 . _:genid9122 . _:genid9122 "A type of combinatorial evidence from curator knowledge and experimental evidence that is used in an automatic assertion."^^ . _:genid9122 "ECO:RCT"^^ . . _:genid9123 . _:genid9124 . _:genid9126 _:genid9125 . _:genid9124 _:genid9126 . _:genid9125 . _:genid9125 . _:genid9125 . _:genid9126 . _:genid9123 _:genid9124 . _:genid9123 . . . "IEA"^^ . "A type of voltammetry evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007594"^^ . "voltammetry evidence used in automatic assertion"^^ . _:genid9127 . _:genid9127 . _:genid9127 . _:genid9127 . _:genid9127 "true"^^ . _:genid9128 . _:genid9128 . _:genid9128 . _:genid9128 . _:genid9128 "true"^^ . _:genid9129 . _:genid9129 . _:genid9129 . _:genid9129 "A type of voltammetry evidence that is used in an automatic assertion."^^ . _:genid9129 "ECO:RCT"^^ . . _:genid9130 . _:genid9131 . _:genid9133 _:genid9132 . _:genid9131 _:genid9133 . _:genid9132 . _:genid9132 . _:genid9132 . _:genid9133 . _:genid9130 _:genid9131 . _:genid9130 . . . "IEA"^^ . "A type of photoconversion evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007595"^^ . "photoconversion evidence used in automatic assertion"^^ . _:genid9134 . _:genid9134 . _:genid9134 . _:genid9134 . _:genid9134 "true"^^ . _:genid9135 . _:genid9135 . _:genid9135 . _:genid9135 . _:genid9135 "true"^^ . _:genid9136 . _:genid9136 . _:genid9136 . _:genid9136 "A type of photoconversion evidence that is used in an automatic assertion."^^ . _:genid9136 "ECO:RCT"^^ . . _:genid9137 . _:genid9138 . _:genid9140 _:genid9139 . _:genid9138 _:genid9140 . _:genid9139 . _:genid9139 . _:genid9139 . _:genid9140 . _:genid9137 _:genid9138 . _:genid9137 . . . "IEA"^^ . "A type of agglutination test evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007596"^^ . "agglutination test evidence used in automatic assertion"^^ . _:genid9141 . _:genid9141 . _:genid9141 . _:genid9141 . _:genid9141 "true"^^ . _:genid9142 . _:genid9142 . _:genid9142 . _:genid9142 . _:genid9142 "true"^^ . _:genid9143 . _:genid9143 . _:genid9143 . _:genid9143 "A type of agglutination test evidence that is used in an automatic assertion."^^ . _:genid9143 "ECO:RCT"^^ . . _:genid9144 . _:genid9145 . _:genid9147 _:genid9146 . _:genid9145 _:genid9147 . _:genid9146 . _:genid9146 . _:genid9146 . _:genid9147 . _:genid9144 _:genid9145 . _:genid9144 . . . "IEA"^^ . "A type of slide agglutination test evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007597"^^ . "slide agglutination test evidence used in automatic assertion"^^ . _:genid9148 . _:genid9148 . _:genid9148 . _:genid9148 . _:genid9148 "true"^^ . _:genid9149 . _:genid9149 . _:genid9149 . _:genid9149 . _:genid9149 "true"^^ . _:genid9150 . _:genid9150 . _:genid9150 . _:genid9150 "A type of slide agglutination test evidence that is used in an automatic assertion."^^ . _:genid9150 "ECO:RCT"^^ . . _:genid9151 . _:genid9152 . _:genid9154 _:genid9153 . _:genid9152 _:genid9154 . _:genid9153 . _:genid9153 . _:genid9153 . _:genid9154 . _:genid9151 _:genid9152 . _:genid9151 . . . "IEA"^^ . "A type of direct Coombs test evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007598"^^ . "direct Coombs test evidence used in automatic assertion"^^ . _:genid9155 . _:genid9155 . _:genid9155 . _:genid9155 . _:genid9155 "true"^^ . _:genid9156 . _:genid9156 . _:genid9156 . _:genid9156 . _:genid9156 "true"^^ . _:genid9157 . _:genid9157 . _:genid9157 . _:genid9157 "A type of direct Coombs test evidence that is used in an automatic assertion."^^ . _:genid9157 "ECO:RCT"^^ . . _:genid9158 . _:genid9159 . _:genid9161 _:genid9160 . _:genid9159 _:genid9161 . _:genid9160 . _:genid9160 . _:genid9160 . _:genid9161 . _:genid9158 _:genid9159 . _:genid9158 . . . "IEA"^^ . "A type of indirect Coombs test evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007599"^^ . "indirect Coombs test evidence used in automatic assertion"^^ . _:genid9162 . _:genid9162 . _:genid9162 . _:genid9162 . _:genid9162 "true"^^ . _:genid9163 . _:genid9163 . _:genid9163 . _:genid9163 . _:genid9163 "true"^^ . _:genid9164 . _:genid9164 . _:genid9164 . _:genid9164 "A type of indirect Coombs test evidence that is used in an automatic assertion."^^ . _:genid9164 "ECO:RCT"^^ . . _:genid9165 . _:genid9166 . _:genid9168 _:genid9167 . _:genid9166 _:genid9168 . _:genid9167 . _:genid9167 . _:genid9167 . _:genid9168 . _:genid9165 _:genid9166 . _:genid9165 . . . "IEA"^^ . "A type of direct hemagglutination assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007600"^^ . "direct hemagglutination assay evidence used in automatic assertion"^^ . _:genid9169 . _:genid9169 . _:genid9169 . _:genid9169 . _:genid9169 "true"^^ . _:genid9170 . _:genid9170 . _:genid9170 . _:genid9170 . _:genid9170 "true"^^ . _:genid9171 . _:genid9171 . _:genid9171 . _:genid9171 "A type of direct hemagglutination assay evidence that is used in an automatic assertion."^^ . _:genid9171 "ECO:RCT"^^ . . _:genid9172 . _:genid9173 . _:genid9175 _:genid9174 . _:genid9173 _:genid9175 . _:genid9174 . _:genid9174 . _:genid9174 . _:genid9175 . _:genid9172 _:genid9173 . _:genid9172 . . . "IEA"^^ . "A type of viral hemagglutination inhibition assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007601"^^ . "viral hemagglutination inhibition assay evidence used in automatic assertion"^^ . _:genid9176 . _:genid9176 . _:genid9176 . _:genid9176 . _:genid9176 "true"^^ . _:genid9177 . _:genid9177 . _:genid9177 . _:genid9177 . _:genid9177 "true"^^ . _:genid9178 . _:genid9178 . _:genid9178 . _:genid9178 "A type of viral hemagglutination inhibition assay evidence that is used in an automatic assertion."^^ . _:genid9178 "ECO:RCT"^^ . . _:genid9179 . _:genid9180 . _:genid9182 _:genid9181 . _:genid9180 _:genid9182 . _:genid9181 . _:genid9181 . _:genid9181 . _:genid9182 . _:genid9179 _:genid9180 . _:genid9179 . . . "IEA"^^ . "A type of compement fixation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007602"^^ . "compement fixation assay evidence used in automatic assertion"^^ . _:genid9183 . _:genid9183 . _:genid9183 . _:genid9183 . _:genid9183 "true"^^ . _:genid9184 . _:genid9184 . _:genid9184 . _:genid9184 . _:genid9184 "true"^^ . _:genid9185 . _:genid9185 . _:genid9185 . _:genid9185 "A type of compement fixation assay evidence that is used in an automatic assertion."^^ . _:genid9185 "ECO:RCT"^^ . . _:genid9186 . _:genid9187 . _:genid9189 _:genid9188 . _:genid9187 _:genid9189 . _:genid9188 . _:genid9188 . _:genid9188 . _:genid9189 . _:genid9186 _:genid9187 . _:genid9186 . . . "IEA"^^ . "A type of neutralization test assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007603"^^ . "neutralization test assay evidence used in automatic assertion"^^ . _:genid9190 . _:genid9190 . _:genid9190 . _:genid9190 . _:genid9190 "true"^^ . _:genid9191 . _:genid9191 . _:genid9191 . _:genid9191 . _:genid9191 "true"^^ . _:genid9192 . _:genid9192 . _:genid9192 . _:genid9192 "A type of neutralization test assay evidence that is used in an automatic assertion."^^ . _:genid9192 "ECO:RCT"^^ . . _:genid9193 . _:genid9194 . _:genid9196 _:genid9195 . _:genid9194 _:genid9196 . _:genid9195 . _:genid9195 . _:genid9195 . _:genid9196 . _:genid9193 _:genid9194 . _:genid9193 . . . "IEA"^^ . "A type of copper transport assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007604"^^ . "copper transport assay evidence used in automatic assertion"^^ . _:genid9197 . _:genid9197 . _:genid9197 . _:genid9197 . _:genid9197 "true"^^ . _:genid9198 . _:genid9198 . _:genid9198 . _:genid9198 . _:genid9198 "true"^^ . _:genid9199 . _:genid9199 . _:genid9199 . _:genid9199 "A type of copper transport assay evidence that is used in an automatic assertion."^^ . _:genid9199 "ECO:RCT"^^ . . _:genid9200 . _:genid9201 . _:genid9203 _:genid9202 . _:genid9201 _:genid9203 . _:genid9202 . _:genid9202 . _:genid9202 . _:genid9203 . _:genid9200 _:genid9201 . _:genid9200 . . . "IEA"^^ . "A type of 5-cyano-2,3-ditolyl tetrazolium chloride staining evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007605"^^ . "5-cyano-2,3-ditolyl tetrazolium chloride staining evidence used in automatic assertion"^^ . _:genid9204 . _:genid9204 . _:genid9204 . _:genid9204 . _:genid9204 "true"^^ . _:genid9205 . _:genid9205 . _:genid9205 . _:genid9205 . _:genid9205 "true"^^ . _:genid9206 . _:genid9206 . _:genid9206 . _:genid9206 "A type of 5-cyano-2,3-ditolyl tetrazolium chloride staining evidence that is used in an automatic assertion."^^ . _:genid9206 "ECO:RCT"^^ . . _:genid9207 . _:genid9208 . _:genid9210 _:genid9209 . _:genid9208 _:genid9210 . _:genid9209 . _:genid9209 . _:genid9209 . _:genid9210 . _:genid9207 _:genid9208 . _:genid9207 . . . "IEA"^^ . "A type of plaque assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007606"^^ . "plaque assay evidence used in automatic assertion"^^ . _:genid9211 . _:genid9211 . _:genid9211 . _:genid9211 . _:genid9211 "true"^^ . _:genid9212 . _:genid9212 . _:genid9212 . _:genid9212 . _:genid9212 "true"^^ . _:genid9213 . _:genid9213 . _:genid9213 . _:genid9213 "A type of plaque assay evidence that is used in an automatic assertion."^^ . _:genid9213 "ECO:RCT"^^ . . _:genid9214 . _:genid9215 . _:genid9217 _:genid9216 . _:genid9215 _:genid9217 . _:genid9216 . _:genid9216 . _:genid9216 . _:genid9217 . _:genid9214 _:genid9215 . _:genid9214 . . . "IEA"^^ . "A type of epifluorescence microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007607"^^ . "epifluorescence microscopy evidence used in automatic assertion"^^ . _:genid9218 . _:genid9218 . _:genid9218 . _:genid9218 . _:genid9218 "true"^^ . _:genid9219 . _:genid9219 . _:genid9219 . _:genid9219 . _:genid9219 "true"^^ . _:genid9220 . _:genid9220 . _:genid9220 . _:genid9220 "A type of epifluorescence microscopy evidence that is used in an automatic assertion."^^ . _:genid9220 "ECO:RCT"^^ . . _:genid9221 . _:genid9222 . _:genid9224 _:genid9223 . _:genid9222 _:genid9224 . _:genid9223 . _:genid9223 . _:genid9223 . _:genid9224 . _:genid9221 _:genid9222 . _:genid9221 . . . "IEA"^^ . "A type of transmission electron microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007608"^^ . "transmission electron microscopy evidence used in automatic assertion"^^ . _:genid9225 . _:genid9225 . _:genid9225 . _:genid9225 . _:genid9225 "true"^^ . _:genid9226 . _:genid9226 . _:genid9226 . _:genid9226 . _:genid9226 "true"^^ . _:genid9227 . _:genid9227 . _:genid9227 . _:genid9227 "A type of transmission electron microscopy evidence that is used in an automatic assertion."^^ . _:genid9227 "ECO:RCT"^^ . . _:genid9228 . _:genid9229 . _:genid9231 _:genid9230 . _:genid9229 _:genid9231 . _:genid9230 . _:genid9230 . _:genid9230 . _:genid9231 . _:genid9228 _:genid9229 . _:genid9228 . . . "IEA"^^ . "A type of scanning electron microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007609"^^ . "scanning electron microscopy evidence used in automatic assertion"^^ . _:genid9232 . _:genid9232 . _:genid9232 . _:genid9232 . _:genid9232 "true"^^ . _:genid9233 . _:genid9233 . _:genid9233 . _:genid9233 . _:genid9233 "true"^^ . _:genid9234 . _:genid9234 . _:genid9234 . _:genid9234 "A type of scanning electron microscopy evidence that is used in an automatic assertion."^^ . _:genid9234 "ECO:RCT"^^ . . _:genid9235 . _:genid9236 . _:genid9238 _:genid9237 . _:genid9236 _:genid9238 . _:genid9237 . _:genid9237 . _:genid9237 . _:genid9238 . _:genid9235 _:genid9236 . _:genid9235 . . . "IEA"^^ . "A type of time-lapsed microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007610"^^ . "time-lapsed microscopy evidence used in automatic assertion"^^ . _:genid9239 . _:genid9239 . _:genid9239 . _:genid9239 . _:genid9239 "true"^^ . _:genid9240 . _:genid9240 . _:genid9240 . _:genid9240 . _:genid9240 "true"^^ . _:genid9241 . _:genid9241 . _:genid9241 . _:genid9241 "A type of time-lapsed microscopy evidence that is used in an automatic assertion."^^ . _:genid9241 "ECO:RCT"^^ . . _:genid9242 . _:genid9243 . _:genid9245 _:genid9244 . _:genid9243 _:genid9245 . _:genid9244 . _:genid9244 . _:genid9244 . _:genid9245 . _:genid9242 _:genid9243 . _:genid9242 . . . "IEA"^^ . "A type of phase contrast microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007611"^^ . "phase contrast microscopy evidence used in automatic assertion"^^ . _:genid9246 . _:genid9246 . _:genid9246 . _:genid9246 . _:genid9246 "true"^^ . _:genid9247 . _:genid9247 . _:genid9247 . _:genid9247 . _:genid9247 "true"^^ . _:genid9248 . _:genid9248 . _:genid9248 . _:genid9248 "A type of phase contrast microscopy evidence that is used in an automatic assertion."^^ . _:genid9248 "ECO:RCT"^^ . . _:genid9249 . _:genid9250 . _:genid9252 _:genid9251 . _:genid9250 _:genid9252 . _:genid9251 . _:genid9251 . _:genid9251 . _:genid9252 . _:genid9249 _:genid9250 . _:genid9249 . . . "IEA"^^ . "A type of transmitted light brightfied mircoscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007612"^^ . "transmitted light brightfied mircoscopy evidence used in automatic assertion"^^ . _:genid9253 . _:genid9253 . _:genid9253 . _:genid9253 . _:genid9253 "true"^^ . _:genid9254 . _:genid9254 . _:genid9254 . _:genid9254 . _:genid9254 "true"^^ . _:genid9255 . _:genid9255 . _:genid9255 . _:genid9255 "A type of transmitted light brightfied mircoscopy evidence that is used in an automatic assertion."^^ . _:genid9255 "ECO:RCT"^^ . . _:genid9256 . _:genid9257 . _:genid9259 _:genid9258 . _:genid9257 _:genid9259 . _:genid9258 . _:genid9258 . _:genid9258 . _:genid9259 . _:genid9256 _:genid9257 . _:genid9256 . . . "IEA"^^ . "A type of koehler illumination microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007613"^^ . "koehler illumination microscopy evidence used in automatic assertion"^^ . _:genid9260 . _:genid9260 . _:genid9260 . _:genid9260 . _:genid9260 "true"^^ . _:genid9261 . _:genid9261 . _:genid9261 . _:genid9261 . _:genid9261 "true"^^ . _:genid9262 . _:genid9262 . _:genid9262 . _:genid9262 "A type of koehler illumination microscopy evidence that is used in an automatic assertion."^^ . _:genid9262 "ECO:RCT"^^ . . _:genid9263 . _:genid9264 . _:genid9266 _:genid9265 . _:genid9264 _:genid9266 . _:genid9265 . _:genid9265 . _:genid9265 . _:genid9266 . _:genid9263 _:genid9264 . _:genid9263 . . . "IEA"^^ . "A type of differential interference contrast microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007614"^^ . "differential interference contrast microscopy evidence used in automatic assertion"^^ . _:genid9267 . _:genid9267 . _:genid9267 . _:genid9267 . _:genid9267 "true"^^ . _:genid9268 . _:genid9268 . _:genid9268 . _:genid9268 . _:genid9268 "true"^^ . _:genid9269 . _:genid9269 . _:genid9269 . _:genid9269 "A type of differential interference contrast microscopy evidence that is used in an automatic assertion."^^ . _:genid9269 "ECO:RCT"^^ . . _:genid9270 . _:genid9271 . _:genid9273 _:genid9272 . _:genid9271 _:genid9273 . _:genid9272 . _:genid9272 . _:genid9272 . _:genid9273 . _:genid9270 _:genid9271 . _:genid9270 . . . "IEA"^^ . "A type of extended field laser confocal microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007615"^^ . "extended field laser confocal microscopy evidence used in automatic assertion"^^ . _:genid9274 . _:genid9274 . _:genid9274 . _:genid9274 . _:genid9274 "true"^^ . _:genid9275 . _:genid9275 . _:genid9275 . _:genid9275 . _:genid9275 "true"^^ . _:genid9276 . _:genid9276 . _:genid9276 . _:genid9276 "A type of extended field laser confocal microscopy evidence that is used in an automatic assertion."^^ . _:genid9276 "ECO:RCT"^^ . . _:genid9277 . _:genid9278 . _:genid9280 _:genid9279 . _:genid9278 _:genid9280 . _:genid9279 . _:genid9279 . _:genid9279 . _:genid9280 . _:genid9277 _:genid9278 . _:genid9277 . . . "IEA"^^ . "A type of confocal laser scanning microscopy evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007616"^^ . "confocal laser scanning microscopy evidence used in automatic assertion"^^ . _:genid9281 . _:genid9281 . _:genid9281 . _:genid9281 . _:genid9281 "true"^^ . _:genid9282 . _:genid9282 . _:genid9282 . _:genid9282 . _:genid9282 "true"^^ . _:genid9283 . _:genid9283 . _:genid9283 . _:genid9283 "A type of confocal laser scanning microscopy evidence that is used in an automatic assertion."^^ . _:genid9283 "ECO:RCT"^^ . . _:genid9284 . _:genid9285 . _:genid9287 _:genid9286 . _:genid9285 _:genid9287 . _:genid9286 . _:genid9286 . _:genid9286 . _:genid9287 . _:genid9284 _:genid9285 . _:genid9284 . . . "IEA"^^ . "A type of light scattering evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007617"^^ . "light scattering evidence used in automatic assertion"^^ . _:genid9288 . _:genid9288 . _:genid9288 . _:genid9288 . _:genid9288 "true"^^ . _:genid9289 . _:genid9289 . _:genid9289 . _:genid9289 . _:genid9289 "true"^^ . _:genid9290 . _:genid9290 . _:genid9290 . _:genid9290 "A type of light scattering evidence that is used in an automatic assertion."^^ . _:genid9290 "ECO:RCT"^^ . . _:genid9291 . _:genid9292 . _:genid9294 _:genid9293 . _:genid9292 _:genid9294 . _:genid9293 . _:genid9293 . _:genid9293 . _:genid9294 . _:genid9291 _:genid9292 . _:genid9291 . . . "IEA"^^ . "A type of dynamic light scattering assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007618"^^ . "dynamic light scattering assay evidence used in automatic assertion"^^ . _:genid9295 . _:genid9295 . _:genid9295 . _:genid9295 . _:genid9295 "true"^^ . _:genid9296 . _:genid9296 . _:genid9296 . _:genid9296 . _:genid9296 "true"^^ . _:genid9297 . _:genid9297 . _:genid9297 . _:genid9297 "A type of dynamic light scattering assay evidence that is used in an automatic assertion."^^ . _:genid9297 "ECO:RCT"^^ . . _:genid9298 . _:genid9299 . _:genid9301 _:genid9300 . _:genid9299 _:genid9301 . _:genid9300 . _:genid9300 . _:genid9300 . _:genid9301 . _:genid9298 _:genid9299 . _:genid9298 . . . "IEA"^^ . "A type of static light scattering assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007619"^^ . "static light scattering assay evidence used in automatic assertion"^^ . _:genid9302 . _:genid9302 . _:genid9302 . _:genid9302 . _:genid9302 "true"^^ . _:genid9303 . _:genid9303 . _:genid9303 . _:genid9303 . _:genid9303 "true"^^ . _:genid9304 . _:genid9304 . _:genid9304 . _:genid9304 "A type of static light scattering assay evidence that is used in an automatic assertion."^^ . _:genid9304 "ECO:RCT"^^ . . _:genid9305 . _:genid9306 . _:genid9308 _:genid9307 . _:genid9306 _:genid9308 . _:genid9307 . _:genid9307 . _:genid9307 . _:genid9308 . _:genid9305 _:genid9306 . _:genid9305 . . . "IEA"^^ . "A type of colony papillation assay phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "colony papillation assay evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007620"^^ . "colony papillation assay phenotypic evidence used in automatic assertion"^^ . _:genid9309 . _:genid9309 . _:genid9309 . _:genid9309 . _:genid9309 "true"^^ . _:genid9310 . _:genid9310 . _:genid9310 . _:genid9310 . _:genid9310 "true"^^ . _:genid9311 . _:genid9311 . _:genid9311 . _:genid9311 "A type of colony papillation assay phenotypic evidence that is used in an automatic assertion."^^ . _:genid9311 "ECO:RCT"^^ . . _:genid9312 . _:genid9313 . _:genid9315 _:genid9314 . _:genid9313 _:genid9315 . _:genid9314 . _:genid9314 . _:genid9314 . _:genid9315 . _:genid9312 _:genid9313 . _:genid9312 . . . "IEA"^^ . "A type of crystal violet staining evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007621"^^ . "crystal violet staining evidence used in automatic assertion"^^ . _:genid9316 . _:genid9316 . _:genid9316 . _:genid9316 . _:genid9316 "true"^^ . _:genid9317 . _:genid9317 . _:genid9317 . _:genid9317 . _:genid9317 "true"^^ . _:genid9318 . _:genid9318 . _:genid9318 . _:genid9318 "A type of crystal violet staining evidence that is used in an automatic assertion."^^ . _:genid9318 "ECO:RCT"^^ . . _:genid9319 . _:genid9320 . _:genid9322 _:genid9321 . _:genid9320 _:genid9322 . _:genid9321 . _:genid9321 . _:genid9321 . _:genid9322 . _:genid9319 _:genid9320 . _:genid9319 . . . "IEA"^^ . "A type of flow cell biofilm assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007622"^^ . "flow cell biofilm assay evidence used in automatic assertion"^^ . _:genid9323 . _:genid9323 . _:genid9323 . _:genid9323 . _:genid9323 "true"^^ . _:genid9324 . _:genid9324 . _:genid9324 . _:genid9324 . _:genid9324 "true"^^ . _:genid9325 . _:genid9325 . _:genid9325 . _:genid9325 "A type of flow cell biofilm assay evidence that is used in an automatic assertion."^^ . _:genid9325 "ECO:RCT"^^ . . _:genid9326 . _:genid9327 . _:genid9329 _:genid9328 . _:genid9327 _:genid9329 . _:genid9328 . _:genid9328 . _:genid9328 . _:genid9329 . _:genid9326 _:genid9327 . _:genid9326 . . . "IEA"^^ . "A type of bacterial 2-hybrid assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007623"^^ . "bacterial 2-hybrid assay evidence used in automatic assertion"^^ . _:genid9330 . _:genid9330 . _:genid9330 . _:genid9330 . _:genid9330 "true"^^ . _:genid9331 . _:genid9331 . _:genid9331 . _:genid9331 . _:genid9331 "true"^^ . _:genid9332 . _:genid9332 . _:genid9332 . _:genid9332 "A type of bacterial 2-hybrid assay evidence that is used in an automatic assertion."^^ . _:genid9332 "ECO:RCT"^^ . . _:genid9333 . _:genid9334 . _:genid9336 _:genid9335 . _:genid9334 _:genid9336 . _:genid9335 . _:genid9335 . _:genid9335 . _:genid9336 . _:genid9333 _:genid9334 . _:genid9333 . . . "IEA"^^ . "A type of phenomic profiling assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007624"^^ . "phenomic profiling assay evidence used in automatic assertion"^^ . _:genid9337 . _:genid9337 . _:genid9337 . _:genid9337 . _:genid9337 "true"^^ . _:genid9338 . _:genid9338 . _:genid9338 . _:genid9338 . _:genid9338 "true"^^ . _:genid9339 . _:genid9339 . _:genid9339 . _:genid9339 "A type of phenomic profiling assay evidence that is used in an automatic assertion."^^ . _:genid9339 "ECO:RCT"^^ . . _:genid9340 . _:genid9341 . _:genid9343 _:genid9342 . _:genid9341 _:genid9343 . _:genid9342 . _:genid9342 . _:genid9342 . _:genid9343 . _:genid9340 _:genid9341 . _:genid9340 . . . "IEA"^^ . "A type of colony morphology phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "colony morphology evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007625"^^ . "colony morphology phenotypic evidence used in automatic assertion"^^ . _:genid9344 . _:genid9344 . _:genid9344 . _:genid9344 . _:genid9344 "true"^^ . _:genid9345 . _:genid9345 . _:genid9345 . _:genid9345 . _:genid9345 "true"^^ . _:genid9346 . _:genid9346 . _:genid9346 . _:genid9346 "A type of colony morphology phenotypic evidence that is used in an automatic assertion."^^ . _:genid9346 "ECO:RCT"^^ . . _:genid9347 . _:genid9348 . _:genid9350 _:genid9349 . _:genid9348 _:genid9350 . _:genid9349 . _:genid9349 . _:genid9349 . _:genid9350 . _:genid9347 _:genid9348 . _:genid9347 . . . "IEA"^^ . "A type of colony color phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "colony color evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007626"^^ . "colony color phenotypic evidence used in automatic assertion"^^ . _:genid9351 . _:genid9351 . _:genid9351 . _:genid9351 . _:genid9351 "true"^^ . _:genid9352 . _:genid9352 . _:genid9352 . _:genid9352 . _:genid9352 "true"^^ . _:genid9353 . _:genid9353 . _:genid9353 . _:genid9353 "A type of colony color phenotypic evidence that is used in an automatic assertion."^^ . _:genid9353 "ECO:RCT"^^ . . _:genid9354 . _:genid9355 . _:genid9357 _:genid9356 . _:genid9355 _:genid9357 . _:genid9356 . _:genid9356 . _:genid9356 . _:genid9357 . _:genid9354 _:genid9355 . _:genid9354 . . . "IEA"^^ . "A type of colony size phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "colony size evidence used in automatic assertion"^^ . "eco"^^ . "ECO:0007627"^^ . "colony size phenotypic evidence used in automatic assertion"^^ . _:genid9358 . _:genid9358 . _:genid9358 . _:genid9358 . _:genid9358 "true"^^ . _:genid9359 . _:genid9359 . _:genid9359 . _:genid9359 . _:genid9359 "true"^^ . _:genid9360 . _:genid9360 . _:genid9360 . _:genid9360 "A type of colony size phenotypic evidence that is used in an automatic assertion."^^ . _:genid9360 "ECO:RCT"^^ . . _:genid9361 . _:genid9362 . _:genid9364 _:genid9363 . _:genid9362 _:genid9364 . _:genid9363 . _:genid9363 . _:genid9363 . _:genid9364 . _:genid9361 _:genid9362 . _:genid9361 . . . "IEA"^^ . "A type of zone of inhibition evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007628"^^ . "zone of inhibition evidence used in automatic assertion"^^ . _:genid9365 . _:genid9365 . _:genid9365 . _:genid9365 . _:genid9365 "true"^^ . _:genid9366 . _:genid9366 . _:genid9366 . _:genid9366 . _:genid9366 "true"^^ . _:genid9367 . _:genid9367 . _:genid9367 . _:genid9367 "A type of zone of inhibition evidence that is used in an automatic assertion."^^ . _:genid9367 "ECO:RCT"^^ . . _:genid9368 . _:genid9369 . _:genid9371 _:genid9370 . _:genid9369 _:genid9371 . _:genid9370 . _:genid9370 . _:genid9370 . _:genid9371 . _:genid9368 _:genid9369 . _:genid9368 . . . "IEA"^^ . "A type of Etest evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007629"^^ . "Etest evidence used in automatic assertion"^^ . _:genid9372 . _:genid9372 . _:genid9372 . _:genid9372 . _:genid9372 "true"^^ . _:genid9373 . _:genid9373 . _:genid9373 . _:genid9373 . _:genid9373 "true"^^ . _:genid9374 . _:genid9374 . _:genid9374 . _:genid9374 "A type of Etest evidence that is used in an automatic assertion."^^ . _:genid9374 "ECO:RCT"^^ . . _:genid9375 . _:genid9376 . _:genid9378 _:genid9377 . _:genid9376 _:genid9378 . _:genid9377 . _:genid9377 . _:genid9377 . _:genid9378 . _:genid9375 _:genid9376 . _:genid9375 . . . "IEA"^^ . "A type of ribosome profiling evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "eco"^^ . "ECO:0007630"^^ . "ribosome profiling evidence used in automatic assertion"^^ . _:genid9379 . _:genid9379 . _:genid9379 . _:genid9379 . _:genid9379 "true"^^ . _:genid9380 . _:genid9380 . _:genid9380 . _:genid9380 . _:genid9380 "true"^^ . _:genid9381 . _:genid9381 . _:genid9381 . _:genid9381 "A type of ribosome profiling evidence that is used in an automatic assertion."^^ . _:genid9381 "ECO:RCT"^^ . . _:genid9382 . _:genid9383 . _:genid9385 _:genid9384 . _:genid9383 _:genid9385 . _:genid9384 . _:genid9384 . _:genid9384 . _:genid9385 . _:genid9382 _:genid9383 . _:genid9382 . . . . "A type of evidence based on computational logical inference that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-14T09:47:55Z"^^ . "evidence based on computational logical inference used in manual assertion" . "eco"^^ . "ECO:0007631"^^ . "computational inference used in manual assertion"^^ . _:genid9386 . _:genid9386 . _:genid9386 . _:genid9386 . _:genid9386 "true"^^ . _:genid9387 . _:genid9387 . _:genid9387 . _:genid9387 . _:genid9387 "true"^^ . _:genid9388 . _:genid9388 . _:genid9388 . _:genid9388 . _:genid9388 "true"^^ . _:genid9389 . _:genid9389 . _:genid9389 . _:genid9389 "A type of evidence based on computational logical inference that is used in a manual assertion."^^ . _:genid9389 "ECO:RCT"^^ . . _:genid9390 . _:genid9391 . _:genid9393 _:genid9392 . _:genid9391 _:genid9393 . _:genid9392 . _:genid9392 . _:genid9392 . _:genid9393 . _:genid9390 _:genid9391 . _:genid9390 . . . "IDA"^^ . "A type of transcriptional activation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-05-18T08:34:35Z"^^ . "eco"^^ . "ECO:0007632"^^ . "transcriptional activation assay evidence used in manual assertion"^^ . _:genid9394 . _:genid9394 . _:genid9394 . _:genid9394 . _:genid9394 "true"^^ . _:genid9395 . _:genid9395 . _:genid9395 . _:genid9395 . _:genid9395 "true"^^ . _:genid9396 . _:genid9396 . _:genid9396 . _:genid9396 "A type of transcriptional activation assay evidence that is used in a manual assertion."^^ . _:genid9396 "ECO:RCT"^^ . . _:genid9397 . _:genid9398 . _:genid9400 _:genid9399 . _:genid9398 _:genid9400 . _:genid9399 . _:genid9399 . _:genid9399 . _:genid9400 . _:genid9397 _:genid9398 . _:genid9397 . . . "IEA"^^ . "A type of transcriptional activation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-05-18T08:34:35Z"^^ . "eco"^^ . "ECO:0007633"^^ . "transcriptional activation assay evidence used in automatic assertion"^^ . _:genid9401 . _:genid9401 . _:genid9401 . _:genid9401 . _:genid9401 "true"^^ . _:genid9402 . _:genid9402 . _:genid9402 . _:genid9402 . _:genid9402 "true"^^ . _:genid9403 . _:genid9403 . _:genid9403 . _:genid9403 "A type of transcriptional activation assay evidence that is used in an automatic assertion."^^ . _:genid9403 "ECO:RCT"^^ . . _:genid9404 . _:genid9405 . _:genid9407 _:genid9406 . _:genid9405 _:genid9407 . _:genid9406 . _:genid9406 . _:genid9406 . _:genid9407 . _:genid9404 _:genid9405 . _:genid9404 . . . "EXP"^^ . "A type of experimental phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-06-20T02:12:00Z"^^ . "eco"^^ . "ECO:0007634"^^ . "experimental phenotypic evidence used in manual assertion"^^ . _:genid9408 . _:genid9408 . _:genid9408 . _:genid9408 . _:genid9408 "true"^^ . _:genid9409 . _:genid9409 . _:genid9409 . _:genid9409 . _:genid9409 "true"^^ . _:genid9410 . _:genid9410 . _:genid9410 . _:genid9410 "A type of experimental phenotypic evidence that is used in a manual assertion."^^ . _:genid9410 "ECO:RCT"^^ . . _:genid9411 . _:genid9412 . _:genid9414 _:genid9413 . _:genid9412 _:genid9414 . _:genid9413 . _:genid9413 . _:genid9413 . _:genid9414 . _:genid9411 _:genid9412 . _:genid9411 . . . "IEA"^^ . "A type of experimental phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-06-20T02:12:00Z"^^ . "eco"^^ . "ECO:0007635"^^ . "experimental phenotypic evidence used in automatic assertion"^^ . _:genid9415 . _:genid9415 . _:genid9415 . _:genid9415 . _:genid9415 "true"^^ . _:genid9416 . _:genid9416 . _:genid9416 . _:genid9416 . _:genid9416 "true"^^ . _:genid9417 . _:genid9417 . _:genid9417 . _:genid9417 "A type of experimental phenotypic evidence that is used in an automatic assertion."^^ . _:genid9417 "ECO:RCT"^^ . . . "A type of curator inference from authoritative resource based on information located in a queryable database and is optimized for computers."^^ . "eco"^^ . "ECO:0007636"^^ . "curator inference from database"^^ . _:genid9418 . _:genid9418 . _:genid9418 . _:genid9418 "A type of curator inference from authoritative resource based on information located in a queryable database and is optimized for computers."^^ . _:genid9418 "ECO:RCT"^^ . . . "A type of curator inference from published work where the reference is to an entry in a compendium that provides summarized information on a subject."^^ . "eco"^^ . "ECO:0007637"^^ . "curator inference from encyclopedia"^^ . _:genid9419 . _:genid9419 . _:genid9419 . _:genid9419 "A type of curator inference from published work where the reference is to an entry in a compendium that provides summarized information on a subject."^^ . _:genid9419 "url:https://en.wikipedia.org/wiki/Encyclopedia"^^ . . . "A type of curator inference from encyclopedia where the reference is to a Wikipedia article."^^ . "eco"^^ . "ECO:0007638"^^ . "curator inference from Wikipedia"^^ . _:genid9420 . _:genid9420 . _:genid9420 . _:genid9420 "A type of curator inference from encyclopedia where the reference is to a Wikipedia article."^^ . _:genid9420 "ECO:RCT"^^ . . . "A type of curator inference from encyclopedia where the reference is to an Encyclopedia Britannica article."^^ . "eco"^^ . "ECO:0007639"^^ . "curator inference from Britannica"^^ . _:genid9421 . _:genid9421 . _:genid9421 . _:genid9421 "A type of curator inference from encyclopedia where the reference is to an Encyclopedia Britannica article."^^ . _:genid9421 "ECO:RCT"^^ . . . "A type of curator inference from encyclopedia in which the reference is to an article in the National Library of Medicine's MedLinePlus encyclopedia."^^ . "eco"^^ . "ECO:0007640"^^ . "curator inference from MedlinePlus encyclopedia"^^ . _:genid9422 . _:genid9422 . _:genid9422 . _:genid9422 "A type of curator inference from encyclopedia in which the reference is to an article in the National Library of Medicine's MedLinePlus encyclopedia."^^ . _:genid9422 "ECO:RCT"^^ . . . "A type of curator inference from published work in which the entry comes from a collection of words with definitions, usages, pronounciations, and more."^^ . "eco"^^ . "ECO:0007641"^^ . "curator inference from dictionary"^^ . _:genid9423 . _:genid9423 . _:genid9423 . _:genid9423 "A type of curator inference from published work in which the entry comes from a collection of words with definitions, usages, pronounciations, and more."^^ . _:genid9423 "url:https://en.wikipedia.org/wiki/Dictionary"^^ . . . "A type of curator inference from dictionary in which the reference is to an entry in the Oxford Dictionaries."^^ . "eco"^^ . "ECO:0007642"^^ . "curator inference from Oxford Dictionary"^^ . _:genid9424 . _:genid9424 . _:genid9424 . _:genid9424 "A type of curator inference from dictionary in which the reference is to an entry in the Oxford Dictionaries."^^ . _:genid9424 "ECO:RCT"^^ . . . "A type of curator inference from dictionary in which the reference is to an entry in the Merriam-Webster Dictionary."^^ . "eco"^^ . "ECO:0007643"^^ . "curator inference from Merriam-Webster Dictionary"^^ . _:genid9425 . _:genid9425 . _:genid9425 . _:genid9425 "A type of curator inference from dictionary in which the reference is to an entry in the Merriam-Webster Dictionary."^^ . _:genid9425 "ECO:RCT"^^ . . . "A type of curator inference from dictionary in which the reference is to an entry in the National Library of Medicine's MedLinePlus dictionary."^^ . "eco"^^ . "ECO:0007644"^^ . "curator inference from MedlinePlus dictionary"^^ . _:genid9426 . _:genid9426 . _:genid9426 . _:genid9426 "A type of curator inference from dictionary in which the reference is to an entry in the National Library of Medicine's MedLinePlus dictionary."^^ . _:genid9426 "ECO:RCT"^^ . . . "A type of curator inference from published work reporting on research findings."^^ . "eco"^^ . "ECO:0007645"^^ . "curator inference from journal publication"^^ . _:genid9427 . _:genid9427 . _:genid9427 . _:genid9427 "A type of curator inference from published work reporting on research findings."^^ . _:genid9427 "url:https://en.wikipedia.org/wiki/Scientific_journal"^^ . . . "A type of curator inference from published work based on a book, which may be a reference to a URL (for ebooks) or a DOI."^^ . "eco"^^ . "ECO:0007646"^^ . "curator inference from book"^^ . _:genid9428 . _:genid9428 . _:genid9428 . _:genid9428 "A type of curator inference from published work based on a book, which may be a reference to a URL (for ebooks) or a DOI."^^ . _:genid9428 "ECO:RCT"^^ . . . "A type of curator inference that is from what is generally considered an authoritative source on the topic, including model organism databases, newspaper articles, books, journal publications, etc."^^ . "eco"^^ . "ECO:0007647"^^ . "curator inference from authoritative source"^^ . _:genid9429 . _:genid9429 . _:genid9429 . _:genid9429 "A type of curator inference that is from what is generally considered an authoritative source on the topic, including model organism databases, newspaper articles, books, journal publications, etc."^^ . _:genid9429 "ECO:RCT"^^ . . _:genid9430 . _:genid9431 . _:genid9433 _:genid9432 . _:genid9431 _:genid9433 . _:genid9432 . _:genid9432 . _:genid9432 . _:genid9433 . _:genid9430 _:genid9431 . _:genid9430 . . . "A type of manually integrated combinatorial evidence in which two or more distinct types of computational evidence are integrated manually."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007648"^^ . "manually integrated combinatorial computational evidence"^^ . _:genid9434 . _:genid9434 . _:genid9434 . _:genid9434 . _:genid9434 "true"^^ . _:genid9435 . _:genid9435 . _:genid9435 . _:genid9435 . _:genid9435 "true"^^ . _:genid9436 . _:genid9436 . _:genid9436 . _:genid9436 "A type of manually integrated combinatorial evidence in which two or more distinct types of computational evidence are integrated manually."^^ . _:genid9436 "ECO:RCT"^^ . . _:genid9437 . _:genid9438 . _:genid9440 _:genid9439 . _:genid9438 _:genid9440 . _:genid9439 . _:genid9439 . _:genid9439 . _:genid9440 . _:genid9437 _:genid9438 . _:genid9437 . . . . "A type of manually integrated combinatorial computational evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007649"^^ . "manually integrated combinatorial computational evidence used in manual assertion"^^ . _:genid9441 . _:genid9441 . _:genid9441 . _:genid9441 . _:genid9441 "true"^^ . _:genid9442 . _:genid9442 . _:genid9442 . _:genid9442 . _:genid9442 "true"^^ . _:genid9443 . _:genid9443 . _:genid9443 . _:genid9443 . _:genid9443 "true"^^ . _:genid9444 . _:genid9444 . _:genid9444 . _:genid9444 "A type of manually integrated combinatorial computational evidence that is used in a manual assertion."^^ . _:genid9444 "ECO:RCT"^^ . . _:genid9445 . _:genid9446 . _:genid9448 _:genid9447 . _:genid9446 _:genid9448 . _:genid9447 . _:genid9447 . _:genid9447 . _:genid9448 . _:genid9445 _:genid9446 . _:genid9445 . . . . "IEA"^^ . "A type of manually integrated combinatorial computational evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007650"^^ . "manually integrated combinatorial computational evidence used in automatic assertion"^^ . _:genid9449 . _:genid9449 . _:genid9449 . _:genid9449 . _:genid9449 "true"^^ . _:genid9450 . _:genid9450 . _:genid9450 . _:genid9450 . _:genid9450 "true"^^ . _:genid9451 . _:genid9451 . _:genid9451 . _:genid9451 . _:genid9451 "true"^^ . _:genid9452 . _:genid9452 . _:genid9452 . _:genid9452 "A type of manually integrated combinatorial computational evidence that is used in an automatic assertion."^^ . _:genid9452 "ECO:RCT"^^ . . _:genid9453 . _:genid9454 . _:genid9456 _:genid9455 . _:genid9454 _:genid9456 . _:genid9455 . _:genid9455 . _:genid9455 . _:genid9456 . _:genid9453 _:genid9454 . _:genid9453 . . . "A type of automatically integrated combinatorial evidence in which two or more distinct types of computational evidence are integrated automatically."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007651"^^ . "automatically integrated combinatorial computational evidence"^^ . _:genid9457 . _:genid9457 . _:genid9457 . _:genid9457 . _:genid9457 "true"^^ . _:genid9458 . _:genid9458 . _:genid9458 . _:genid9458 . _:genid9458 "true"^^ . _:genid9459 . _:genid9459 . _:genid9459 . _:genid9459 "A type of automatically integrated combinatorial evidence in which two or more distinct types of computational evidence are integrated automatically."^^ . _:genid9459 "ECO:RCT"^^ . . _:genid9460 . _:genid9461 . _:genid9463 _:genid9462 . _:genid9461 _:genid9463 . _:genid9462 . _:genid9462 . _:genid9462 . _:genid9463 . _:genid9460 _:genid9461 . _:genid9460 . . . . "RCA"^^ . "A type of automatically integrated combinatorial computational evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007652"^^ . "automatically integrated combinatorial computational evidence used in manual assertion"^^ . _:genid9464 . _:genid9464 . _:genid9464 . _:genid9464 . _:genid9464 "true"^^ . _:genid9465 . _:genid9465 . _:genid9465 . _:genid9465 . _:genid9465 "true"^^ . _:genid9466 . _:genid9466 . _:genid9466 . _:genid9466 . _:genid9466 "true"^^ . _:genid9467 . _:genid9467 . _:genid9467 . _:genid9467 "A type of automatically integrated combinatorial computational evidence that is used in a manual assertion."^^ . _:genid9467 "ECO:RCT"^^ . . _:genid9468 . _:genid9469 . _:genid9471 _:genid9470 . _:genid9469 _:genid9471 . _:genid9470 . _:genid9470 . _:genid9470 . _:genid9471 . _:genid9468 _:genid9469 . _:genid9468 . . . . "IEA"^^ . "A type of automatically integrated combinatorial computational evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007653"^^ . "automatically integrated combinatorial computational evidence used in automatic assertion"^^ . _:genid9472 . _:genid9472 . _:genid9472 . _:genid9472 . _:genid9472 "true"^^ . _:genid9473 . _:genid9473 . _:genid9473 . _:genid9473 . _:genid9473 "true"^^ . _:genid9474 . _:genid9474 . _:genid9474 . _:genid9474 . _:genid9474 "true"^^ . _:genid9475 . _:genid9475 . _:genid9475 . _:genid9475 "A type of automatically integrated combinatorial computational evidence that is used in an automatic assertion."^^ . _:genid9475 "ECO:RCT"^^ . . _:genid9476 . _:genid9477 . _:genid9479 _:genid9478 . _:genid9477 _:genid9479 . _:genid9478 . _:genid9478 . _:genid9478 . _:genid9479 . _:genid9476 _:genid9477 . _:genid9476 . . "A type of combinatorial evidence in which two or more distinct types of experimental evidence are integrated."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007654"^^ . "combinatorial experimental evidence"^^ . _:genid9480 . _:genid9480 . _:genid9480 . _:genid9480 . _:genid9480 "true"^^ . _:genid9481 . _:genid9481 . _:genid9481 . _:genid9481 "A type of combinatorial evidence in which two or more distinct types of experimental evidence are integrated."^^ . _:genid9481 "ECO:RCT"^^ . . _:genid9482 . _:genid9483 . _:genid9485 _:genid9484 . _:genid9483 _:genid9485 . _:genid9484 . _:genid9484 . _:genid9484 . _:genid9485 . _:genid9482 _:genid9483 . _:genid9482 . . . "A type of manually integrated combinatorial evidence in which two or more distinct types of experimental evidence are integrated manually."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007655"^^ . "manually integrated combinatorial experimental evidence"^^ . _:genid9486 . _:genid9486 . _:genid9486 . _:genid9486 . _:genid9486 "true"^^ . _:genid9487 . _:genid9487 . _:genid9487 . _:genid9487 . _:genid9487 "true"^^ . _:genid9488 . _:genid9488 . _:genid9488 . _:genid9488 "A type of manually integrated combinatorial evidence in which two or more distinct types of experimental evidence are integrated manually."^^ . _:genid9488 "ECO:RCT"^^ . . _:genid9489 . _:genid9490 . _:genid9492 _:genid9491 . _:genid9490 _:genid9492 . _:genid9491 . _:genid9491 . _:genid9491 . _:genid9492 . _:genid9489 _:genid9490 . _:genid9489 . . . "A type of manually integrated combinatorial experimental evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007656"^^ . "manually integrated combinatorial experimental evidence used in manual assertion"^^ . _:genid9493 . _:genid9493 . _:genid9493 . _:genid9493 . _:genid9493 "true"^^ . _:genid9494 . _:genid9494 . _:genid9494 . _:genid9494 . _:genid9494 "true"^^ . _:genid9495 . _:genid9495 . _:genid9495 . _:genid9495 "A type of manually integrated combinatorial experimental evidence that is used in a manual assertion."^^ . _:genid9495 "ECO:RCT"^^ . . _:genid9496 . _:genid9497 . _:genid9499 _:genid9498 . _:genid9497 _:genid9499 . _:genid9498 . _:genid9498 . _:genid9498 . _:genid9499 . _:genid9496 _:genid9497 . _:genid9496 . . . . "IEA"^^ . "A type of manually integrated combinatorial experimental evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007657"^^ . "manually integrated combinatorial experimental evidence used in automatic assertion"^^ . _:genid9500 . _:genid9500 . _:genid9500 . _:genid9500 . _:genid9500 "true"^^ . _:genid9501 . _:genid9501 . _:genid9501 . _:genid9501 . _:genid9501 "true"^^ . _:genid9502 . _:genid9502 . _:genid9502 . _:genid9502 . _:genid9502 "true"^^ . _:genid9503 . _:genid9503 . _:genid9503 . _:genid9503 "A type of manually integrated combinatorial experimental evidence that is used in an automatic assertion."^^ . _:genid9503 "ECO:RCT"^^ . . _:genid9504 . _:genid9505 . _:genid9507 _:genid9506 . _:genid9505 _:genid9507 . _:genid9506 . _:genid9506 . _:genid9506 . _:genid9507 . _:genid9504 _:genid9505 . _:genid9504 . . . "A type of automatically integrated combinatorial evidence in which two or more distinct types of experimental evidence are integrated automatically."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007658"^^ . "automatically integrated combinatorial experimental evidence"^^ . _:genid9508 . _:genid9508 . _:genid9508 . _:genid9508 . _:genid9508 "true"^^ . _:genid9509 . _:genid9509 . _:genid9509 . _:genid9509 . _:genid9509 "true"^^ . _:genid9510 . _:genid9510 . _:genid9510 . _:genid9510 "A type of automatically integrated combinatorial evidence in which two or more distinct types of experimental evidence are integrated automatically."^^ . _:genid9510 "ECO:RCT"^^ . . _:genid9511 . _:genid9512 . _:genid9514 _:genid9513 . _:genid9512 _:genid9514 . _:genid9513 . _:genid9513 . _:genid9513 . _:genid9514 . _:genid9511 _:genid9512 . _:genid9511 . . . "RCA"^^ . "A type of automatically integrated combinatorial experimental evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007659"^^ . "automatically integrated combinatorial experimental evidence used in manual assertion"^^ . _:genid9515 . _:genid9515 . _:genid9515 . _:genid9515 . _:genid9515 "true"^^ . _:genid9516 . _:genid9516 . _:genid9516 . _:genid9516 . _:genid9516 "true"^^ . _:genid9517 . _:genid9517 . _:genid9517 . _:genid9517 "A type of automatically integrated combinatorial experimental evidence that is used in a manual assertion."^^ . _:genid9517 "ECO:RCT"^^ . . _:genid9518 . _:genid9519 . _:genid9521 _:genid9520 . _:genid9519 _:genid9521 . _:genid9520 . _:genid9520 . _:genid9520 . _:genid9521 . _:genid9518 _:genid9519 . _:genid9518 . . . . "IEA"^^ . "A type of automatically integrated combinatorial experimental evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007660"^^ . "automatically integrated combinatorial experimental evidence used in automatic assertion"^^ . _:genid9522 . _:genid9522 . _:genid9522 . _:genid9522 . _:genid9522 "true"^^ . _:genid9523 . _:genid9523 . _:genid9523 . _:genid9523 . _:genid9523 "true"^^ . _:genid9524 . _:genid9524 . _:genid9524 . _:genid9524 . _:genid9524 "true"^^ . _:genid9525 . _:genid9525 . _:genid9525 . _:genid9525 "A type of automatically integrated combinatorial experimental evidence that is used in an automatic assertion."^^ . _:genid9525 "ECO:RCT"^^ . . _:genid9526 . _:genid9527 . _:genid9529 _:genid9528 . _:genid9527 _:genid9529 . _:genid9528 . _:genid9528 . _:genid9528 . _:genid9531 _:genid9530 . _:genid9529 _:genid9531 . _:genid9530 . _:genid9530 . _:genid9530 . _:genid9531 . _:genid9526 _:genid9527 . _:genid9526 . . "A type of combinatorial evidence in which at least one line of experimental evidence and at least one line of computational evidence have been integrated."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007661"^^ . "combinatorial computational and experimental evidence"^^ . _:genid9532 . _:genid9532 . _:genid9532 . _:genid9532 . _:genid9532 "true"^^ . _:genid9533 . _:genid9533 . _:genid9533 . _:genid9533 "A type of combinatorial evidence in which at least one line of experimental evidence and at least one line of computational evidence have been integrated."^^ . _:genid9533 "ECO:RCT"^^ . . _:genid9534 . _:genid9535 . _:genid9537 _:genid9536 . _:genid9535 _:genid9537 . _:genid9536 . _:genid9536 . _:genid9536 . _:genid9539 _:genid9538 . _:genid9537 _:genid9539 . _:genid9538 . _:genid9538 . _:genid9538 . _:genid9539 . _:genid9534 _:genid9535 . _:genid9534 . . . "A type of manually integrated combinatorial evidence in which at least one line of experimental evidence and at least one line of computational evidence have been integrated manually."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007662"^^ . "manually integrated combinatorial computational and experimental evidence"^^ . _:genid9540 . _:genid9540 . _:genid9540 . _:genid9540 . _:genid9540 "true"^^ . _:genid9541 . _:genid9541 . _:genid9541 . _:genid9541 . _:genid9541 "true"^^ . _:genid9542 . _:genid9542 . _:genid9542 . _:genid9542 "A type of manually integrated combinatorial evidence in which at least one line of experimental evidence and at least one line of computational evidence have been integrated manually."^^ . _:genid9542 "ECO:RCT"^^ . . _:genid9543 . _:genid9544 . _:genid9546 _:genid9545 . _:genid9544 _:genid9546 . _:genid9545 . _:genid9545 . _:genid9545 . _:genid9546 . _:genid9543 _:genid9544 . _:genid9543 . . . "A type of manually integrated combinatorial computational and experimental evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007663"^^ . "manually integrated combinatorial computational and experimental evidence used in manual assertion"^^ . _:genid9547 . _:genid9547 . _:genid9547 . _:genid9547 . _:genid9547 "true"^^ . _:genid9548 . _:genid9548 . _:genid9548 . _:genid9548 . _:genid9548 "true"^^ . _:genid9549 . _:genid9549 . _:genid9549 . _:genid9549 "A type of manually integrated combinatorial computational and experimental evidence that is used in a manual assertion."^^ . _:genid9549 "ECO:RCT"^^ . . _:genid9550 . _:genid9551 . _:genid9553 _:genid9552 . _:genid9551 _:genid9553 . _:genid9552 . _:genid9552 . _:genid9552 . _:genid9553 . _:genid9550 _:genid9551 . _:genid9550 . . . . "IEA"^^ . "A type of manually integrated combinatorial computational and experimental evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007664"^^ . "manually integrated combinatorial computational and experimental evidence used in automatic assertion"^^ . _:genid9554 . _:genid9554 . _:genid9554 . _:genid9554 . _:genid9554 "true"^^ . _:genid9555 . _:genid9555 . _:genid9555 . _:genid9555 . _:genid9555 "true"^^ . _:genid9556 . _:genid9556 . _:genid9556 . _:genid9556 . _:genid9556 "true"^^ . _:genid9557 . _:genid9557 . _:genid9557 . _:genid9557 "A type of manually integrated combinatorial computational and experimental evidence that is used in an automatic assertion."^^ . _:genid9557 "ECO:RCT"^^ . . _:genid9558 . _:genid9559 . _:genid9561 _:genid9560 . _:genid9559 _:genid9561 . _:genid9560 . _:genid9560 . _:genid9560 . _:genid9563 _:genid9562 . _:genid9561 _:genid9563 . _:genid9562 . _:genid9562 . _:genid9562 . _:genid9563 . _:genid9558 _:genid9559 . _:genid9558 . . . "A type of automatically integrated combinatorial evidence in which at least one line of experimental evidence and at least one line of computational evidence have been integrated automatically."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007665"^^ . "automatically integrated combinatorial computational and experimental evidence"^^ . _:genid9564 . _:genid9564 . _:genid9564 . _:genid9564 . _:genid9564 "true"^^ . _:genid9565 . _:genid9565 . _:genid9565 . _:genid9565 . _:genid9565 "true"^^ . _:genid9566 . _:genid9566 . _:genid9566 . _:genid9566 "A type of automatically integrated combinatorial evidence in which at least one line of experimental evidence and at least one line of computational evidence have been integrated automatically."^^ . _:genid9566 "ECO:RCT"^^ . . _:genid9567 . _:genid9568 . _:genid9570 _:genid9569 . _:genid9568 _:genid9570 . _:genid9569 . _:genid9569 . _:genid9569 . _:genid9570 . _:genid9567 _:genid9568 . _:genid9567 . . . "RCA"^^ . "A type of automatically integrated combinatorial computational and experimental evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007666"^^ . "automatically integrated combinatorial computational and experimental evidence used in manual assertion"^^ . _:genid9571 . _:genid9571 . _:genid9571 . _:genid9571 . _:genid9571 "true"^^ . _:genid9572 . _:genid9572 . _:genid9572 . _:genid9572 . _:genid9572 "true"^^ . _:genid9573 . _:genid9573 . _:genid9573 . _:genid9573 "A type of automatically integrated combinatorial computational and experimental evidence that is used in a manual assertion."^^ . _:genid9573 "ECO:RCT"^^ . . _:genid9574 . _:genid9575 . _:genid9577 _:genid9576 . _:genid9575 _:genid9577 . _:genid9576 . _:genid9576 . _:genid9576 . _:genid9577 . _:genid9574 _:genid9575 . _:genid9574 . . . . "IEA"^^ . "A type of automatically integrated combinatorial computational and experimental evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007667"^^ . "automatically integrated combinatorial computational and experimental evidence used in automatic assertion"^^ . _:genid9578 . _:genid9578 . _:genid9578 . _:genid9578 . _:genid9578 "true"^^ . _:genid9579 . _:genid9579 . _:genid9579 . _:genid9579 . _:genid9579 "true"^^ . _:genid9580 . _:genid9580 . _:genid9580 . _:genid9580 . _:genid9580 "true"^^ . _:genid9581 . _:genid9581 . _:genid9581 . _:genid9581 "A type of automatically integrated combinatorial computational and experimental evidence that is used in an automatic assertion."^^ . _:genid9581 "ECO:RCT"^^ . . _:genid9582 . _:genid9583 . _:genid9585 _:genid9584 . _:genid9583 _:genid9585 . _:genid9584 . _:genid9584 . _:genid9584 . _:genid9585 . _:genid9582 _:genid9583 . _:genid9582 . . . "A type of computational evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007668"^^ . "computational evidence used in manual assertion"^^ . _:genid9586 . _:genid9586 . _:genid9586 . _:genid9586 . _:genid9586 "true"^^ . _:genid9587 . _:genid9587 . _:genid9587 . _:genid9587 . _:genid9587 "true"^^ . _:genid9588 . _:genid9588 . _:genid9588 . _:genid9588 "A type of computational evidence that is used in a manual assertion."^^ . _:genid9588 "ECO:RCT"^^ . . _:genid9589 . _:genid9590 . _:genid9592 _:genid9591 . _:genid9590 _:genid9592 . _:genid9591 . _:genid9591 . _:genid9591 . _:genid9592 . _:genid9589 _:genid9590 . _:genid9589 . . . "IEA"^^ . "A type of computational evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007669"^^ . "computational evidence used in automatic assertion"^^ . _:genid9593 . _:genid9593 . _:genid9593 . _:genid9593 . _:genid9593 "true"^^ . _:genid9594 . _:genid9594 . _:genid9594 . _:genid9594 . _:genid9594 "true"^^ . _:genid9595 . _:genid9595 . _:genid9595 . _:genid9595 "A type of computational evidence that is used in an automatic assertion."^^ . _:genid9595 "ECO:RCT"^^ . . . "A type of evidence in which data are produced, and/or generated, and/or analyzed on a computer."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "in silico evidence"^^ . "eco"^^ . "ECO:0007672"^^ . "computational evidence"^^ . _:genid9596 . _:genid9596 . _:genid9596 . _:genid9596 "A type of evidence in which data are produced, and/or generated, and/or analyzed on a computer."^^ . _:genid9596 "ECO:RCT"^^ . . . "A type of combinatorial evidence in which at least two distinct types of evidence have been integrated automatically."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007673"^^ . "automatically integrated combinatorial evidence"^^ . _:genid9597 . _:genid9597 . _:genid9597 . _:genid9597 "A type of combinatorial evidence in which at least two distinct types of evidence have been integrated automatically."^^ . _:genid9597 "ECO:RCT"^^ . . . "A type of combinatorial evidence in which at least two distinct types of evidence have been integrated manually."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "ECO:0007674"^^ . "manually integrated combinatorial evidence"^^ . _:genid9598 . _:genid9598 . _:genid9598 . _:genid9598 "A type of combinatorial evidence in which at least two distinct types of evidence have been integrated manually."^^ . _:genid9598 "ECO:RCT"^^ . . _:genid9599 . _:genid9600 . _:genid9602 _:genid9601 . _:genid9600 _:genid9602 . _:genid9601 . _:genid9601 . _:genid9601 . _:genid9602 . _:genid9599 _:genid9600 . _:genid9599 . . . "A type of manually integrated combinatorial evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "ECO:0007675"^^ . "manually integrated combinatorial evidence used in manual assertion"^^ . _:genid9603 . _:genid9603 . _:genid9603 . _:genid9603 . _:genid9603 "true"^^ . _:genid9604 . _:genid9604 . _:genid9604 . _:genid9604 . _:genid9604 "true"^^ . _:genid9605 . _:genid9605 . _:genid9605 . _:genid9605 "A type of manually integrated combinatorial evidence that is used in a manual assertion."^^ . _:genid9605 "ECO:RCT"^^ . . _:genid9606 . _:genid9607 . _:genid9609 _:genid9608 . _:genid9607 _:genid9609 . _:genid9608 . _:genid9608 . _:genid9608 . _:genid9609 . _:genid9606 _:genid9607 . _:genid9606 . . . "IEA"^^ . "A type of manually integrated combinatorial evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "ECO:0007676"^^ . "manually integrated combinatorial evidence used in automatic assertion"^^ . _:genid9610 . _:genid9610 . _:genid9610 . _:genid9610 . _:genid9610 "true"^^ . _:genid9611 . _:genid9611 . _:genid9611 . _:genid9611 . _:genid9611 "true"^^ . _:genid9612 . _:genid9612 . _:genid9612 . _:genid9612 "A type of manually integrated combinatorial evidence that is used in an automatic assertion."^^ . _:genid9612 "ECO:RCT"^^ . . _:genid9613 . _:genid9614 . _:genid9616 _:genid9615 . _:genid9614 _:genid9616 . _:genid9615 . _:genid9615 . _:genid9615 . _:genid9616 . _:genid9613 _:genid9614 . _:genid9613 . . "A type of combinatorial evidence in which at least two distinct types of computational evidence have been integrated."^^ . "rctauber"^^ . "2018-12-04T19:31:00Z"^^ . "eco"^^ . "ECO:0007677"^^ . "combinatorial computational evidence"^^ . _:genid9617 . _:genid9617 . _:genid9617 . _:genid9617 . _:genid9617 "true"^^ . _:genid9618 . _:genid9618 . _:genid9618 . _:genid9618 "A type of combinatorial evidence in which at least two distinct types of computational evidence have been integrated."^^ . _:genid9618 "ECO:RCT"^^ . . _:genid9619 . _:genid9620 . _:genid9622 _:genid9621 . _:genid9620 _:genid9622 . _:genid9621 . _:genid9621 . _:genid9621 . _:genid9622 . _:genid9619 _:genid9620 . _:genid9619 . . . "A type of combinatorial computational evidence that is used in a manual assertion."^^ . "ECO:0007678"^^ . "combinatorial computational evidence used in manual assertion"^^ . _:genid9623 . _:genid9623 . _:genid9623 . _:genid9623 . _:genid9623 "true"^^ . _:genid9624 . _:genid9624 . _:genid9624 . _:genid9624 . _:genid9624 "true"^^ . _:genid9625 . _:genid9625 . _:genid9625 . _:genid9625 "A type of combinatorial computational evidence that is used in a manual assertion."^^ . _:genid9625 "ECO:RCT"^^ . . _:genid9626 . _:genid9627 . _:genid9629 _:genid9628 . _:genid9627 _:genid9629 . _:genid9628 . _:genid9628 . _:genid9628 . _:genid9629 . _:genid9626 _:genid9627 . _:genid9626 . . . "IEA"^^ . "A type of combinatorial computational evidence that is used in an automatic assertion."^^ . "ECO:0007679"^^ . "combinatorial computational evidence used in automatic assertion"^^ . _:genid9630 . _:genid9630 . _:genid9630 . _:genid9630 . _:genid9630 "true"^^ . _:genid9631 . _:genid9631 . _:genid9631 . _:genid9631 . _:genid9631 "true"^^ . _:genid9632 . _:genid9632 . _:genid9632 . _:genid9632 "A type of combinatorial computational evidence that is used in an automatic assertion."^^ . _:genid9632 "ECO:RCT"^^ . . _:genid9633 . _:genid9634 . _:genid9636 _:genid9635 . _:genid9634 _:genid9636 . _:genid9635 . _:genid9635 . _:genid9635 . _:genid9636 . _:genid9633 _:genid9634 . _:genid9633 . . . "EXP"^^ . "A type of chromatography evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-01-21T06:28:00Z"^^ . "eco"^^ . "ECO:0007680"^^ . "chromatography evidence used in manual assertion"^^ . _:genid9637 . _:genid9637 . _:genid9637 . _:genid9637 . _:genid9637 "true"^^ . _:genid9638 . _:genid9638 . _:genid9638 . _:genid9638 . _:genid9638 "true"^^ . _:genid9639 . _:genid9639 . _:genid9639 . _:genid9639 "A type of chromatography evidence that is used in a manual assertion."^^ . _:genid9639 "ECO:RCT"^^ . . _:genid9640 . _:genid9641 . _:genid9643 _:genid9642 . _:genid9641 _:genid9643 . _:genid9642 . _:genid9642 . _:genid9642 . _:genid9643 . _:genid9640 _:genid9641 . _:genid9640 . . . "IEA"^^ . "A type of chromatography evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-01-21T06:28:00Z"^^ . "eco"^^ . "ECO:0007681"^^ . "chromatography evidence used in automatic assertion"^^ . _:genid9644 . _:genid9644 . _:genid9644 . _:genid9644 . _:genid9644 "true"^^ . _:genid9645 . _:genid9645 . _:genid9645 . _:genid9645 . _:genid9645 "true"^^ . _:genid9646 . _:genid9646 . _:genid9646 . _:genid9646 "A type of chromatography evidence that is used in an automatic assertion."^^ . _:genid9646 "ECO:RCT"^^ . . . . "IEP"^^ . "A type of reporter gene assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007682"^^ . "reporter gene assay evidence used in manual assertion"^^ . _:genid9647 . _:genid9647 . _:genid9647 . _:genid9647 . _:genid9647 "true"^^ . . . . "IDA"^^ . "A type of protein separation evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007684"^^ . "protein separation evidence used in manual assertion"^^ . _:genid9648 . _:genid9648 . _:genid9648 . _:genid9648 . _:genid9648 "true"^^ . . . . "IDA"^^ . "A type of substance quantification evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007685"^^ . "substance quantification evidence used in manual assertion"^^ . _:genid9649 . _:genid9649 . _:genid9649 . _:genid9649 . _:genid9649 "true"^^ . . . . "IDA"^^ . "A type of voltage clamp recording evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007686"^^ . "voltage clamp recording evidence used in manual assertion"^^ . _:genid9650 . _:genid9650 . _:genid9650 . _:genid9650 . _:genid9650 "true"^^ . . . . "IDA"^^ . "A type of protein kinase assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007687"^^ . "protein kinase assay evidence used in manual assertion"^^ . _:genid9651 . _:genid9651 . _:genid9651 . _:genid9651 . _:genid9651 "true"^^ . . . . "IDA"^^ . "A type of gel electrophoresis evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007688"^^ . "gel electrophoresis evidence used in manual assertion"^^ . _:genid9652 . _:genid9652 . _:genid9652 . _:genid9652 . _:genid9652 "true"^^ . . . . "IDA"^^ . "A type of sodium dodecyl sulfate polyacrylamide gel electrophoresis evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007689"^^ . "sodium dodecyl sulfate polyacrylamide gel electrophoresis evidence used in manual assertion"^^ . _:genid9653 . _:genid9653 . _:genid9653 . _:genid9653 . _:genid9653 "true"^^ . . . . "IDA"^^ . "A type of ex vivo assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007690"^^ . "ex vivo assay evidence used in manual assertion"^^ . _:genid9654 . _:genid9654 . _:genid9654 . _:genid9654 . _:genid9654 "true"^^ . . . . "IDA"^^ . "A type of cleavage assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007691"^^ . "cleavage assay evidence used in manual assertion"^^ . _:genid9655 . _:genid9655 . _:genid9655 . _:genid9655 . _:genid9655 "true"^^ . . . . "IDA"^^ . "A type of deacetylation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007692"^^ . "deacetylation assay evidence used in manual assertion"^^ . _:genid9656 . _:genid9656 . _:genid9656 . _:genid9656 . _:genid9656 "true"^^ . . . . "IDA"^^ . "A type of transcription assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007693"^^ . "transcription assay evidence used in manual assertion"^^ . _:genid9657 . _:genid9657 . _:genid9657 . _:genid9657 . _:genid9657 "true"^^ . . . . "IDA"^^ . "A type of phosphatase assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007694"^^ . "phosphatase assay evidence used in manual assertion"^^ . _:genid9658 . _:genid9658 . _:genid9658 . _:genid9658 . _:genid9658 "true"^^ . . . . "IDA"^^ . "A type of cell-based assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007695"^^ . "cell-based assay evidence used in manual assertion"^^ . _:genid9659 . _:genid9659 . _:genid9659 . _:genid9659 . _:genid9659 "true"^^ . . . . "IDA"^^ . "A type of cell proliferation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007696"^^ . "cell proliferation assay evidence used in manual assertion"^^ . _:genid9660 . _:genid9660 . _:genid9660 . _:genid9660 . _:genid9660 "true"^^ . . . . "IDA"^^ . "A type of DNA synthesis cell proliferation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007697"^^ . "DNA synthesis cell proliferation assay evidence used in manual assertion"^^ . _:genid9661 . _:genid9661 . _:genid9661 . _:genid9661 . _:genid9661 "true"^^ . . . . "IDA"^^ . "A type of apoptotic assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007698"^^ . "apoptotic assay evidence used in manual assertion"^^ . _:genid9662 . _:genid9662 . _:genid9662 . _:genid9662 . _:genid9662 "true"^^ . . . . "IDA"^^ . "A type of cell growth assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007699"^^ . "cell growth assay evidence used in manual assertion"^^ . _:genid9663 . _:genid9663 . _:genid9663 . _:genid9663 . _:genid9663 "true"^^ . . . . "IDA"^^ . "A type of disk diffusion test evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007700"^^ . "disk diffusion test evidence used in manual assertion"^^ . _:genid9664 . _:genid9664 . _:genid9664 . _:genid9664 . _:genid9664 "true"^^ . . . . "IDA"^^ . "A type of chemotaxis assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007701"^^ . "chemotaxis assay evidence used in manual assertion"^^ . _:genid9665 . _:genid9665 . _:genid9665 . _:genid9665 . _:genid9665 "true"^^ . . . . "IDA"^^ . "A type of cytotoxicity assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007702"^^ . "cytotoxicity assay evidence used in manual assertion"^^ . _:genid9666 . _:genid9666 . _:genid9666 . _:genid9666 . _:genid9666 "true"^^ . . . . "IDA"^^ . "A type of cell viability assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007703"^^ . "cell viability assay evidence used in manual assertion"^^ . _:genid9667 . _:genid9667 . _:genid9667 . _:genid9667 . _:genid9667 "true"^^ . . . . "IDA"^^ . "A type of methylation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007704"^^ . "methylation assay evidence used in manual assertion"^^ . _:genid9668 . _:genid9668 . _:genid9668 . _:genid9668 . _:genid9668 "true"^^ . . "A type of protein assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007705"^^ . "protein assay evidence used in manual assertion"^^ . "true"^^ . . . . "IPI"^^ . "A type of chromatin immunoprecipitation evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007706"^^ . "chromatin immunoprecipitation evidence used in manual assertion"^^ . _:genid9669 . _:genid9669 . _:genid9669 . _:genid9669 . _:genid9669 "true"^^ . . _:genid9670 . _:genid9671 . _:genid9673 _:genid9672 . _:genid9671 _:genid9673 . _:genid9672 . _:genid9672 . _:genid9672 . _:genid9673 . _:genid9670 _:genid9671 . _:genid9670 . . . "IDA"^^ . "A type of protein inhibition evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007707"^^ . "protein inhibition evidence used in manual assertion"^^ . _:genid9674 . _:genid9674 . _:genid9674 . _:genid9674 . _:genid9674 "true"^^ . _:genid9675 . _:genid9675 . _:genid9675 . _:genid9675 . _:genid9675 "true"^^ . . . . "IDA"^^ . "A type of sumoylation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007708"^^ . "sumoylation assay evidence used in manual assertion"^^ . _:genid9676 . _:genid9676 . _:genid9676 . _:genid9676 . _:genid9676 "true"^^ . . . . "IDA"^^ . "A type of transport assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007709"^^ . "transport assay evidence used in manual assertion"^^ . _:genid9677 . _:genid9677 . _:genid9677 . _:genid9677 . _:genid9677 "true"^^ . . . . "IDA"^^ . "A type of defarnesylation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007710"^^ . "defarnesylation assay evidence used in manual assertion"^^ . _:genid9678 . _:genid9678 . _:genid9678 . _:genid9678 . _:genid9678 "true"^^ . . . . "IDA"^^ . "A type of deubiquitination assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007711"^^ . "deubiquitination assay evidence used in manual assertion"^^ . _:genid9679 . _:genid9679 . _:genid9679 . _:genid9679 . _:genid9679 "true"^^ . . . . "IDA"^^ . "A type of palmitoylation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007712"^^ . "palmitoylation assay evidence used in manual assertion"^^ . _:genid9680 . _:genid9680 . _:genid9680 . _:genid9680 . _:genid9680 "true"^^ . . . . "IDA"^^ . "A type of acetylation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007713"^^ . "acetylation assay evidence used in manual assertion"^^ . _:genid9681 . _:genid9681 . _:genid9681 . _:genid9681 . _:genid9681 "true"^^ . . . . "IDA"^^ . "A type of demethylation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007714"^^ . "demethylation assay evidence used in manual assertion"^^ . _:genid9682 . _:genid9682 . _:genid9682 . _:genid9682 . _:genid9682 "true"^^ . . . . "IDA"^^ . "A type of polyADP-ribosylation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007715"^^ . "polyADP-ribosylation assay evidence used in manual assertion"^^ . _:genid9683 . _:genid9683 . _:genid9683 . _:genid9683 . _:genid9683 "true"^^ . . . . "IDA"^^ . "A type of staining evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007716"^^ . "staining evidence used in manual assertion"^^ . _:genid9684 . _:genid9684 . _:genid9684 . _:genid9684 . _:genid9684 "true"^^ . . . . "IDA"^^ . "A type of translation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007717"^^ . "translation assay evidence used in manual assertion"^^ . _:genid9685 . _:genid9685 . _:genid9685 . _:genid9685 . _:genid9685 "true"^^ . . . . "IDA"^^ . "A type of ubiquitination assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007718"^^ . "ubiquitination assay evidence used in manual assertion"^^ . _:genid9686 . _:genid9686 . _:genid9686 . _:genid9686 . _:genid9686 "true"^^ . . . . "IDA"^^ . "A type of immunodetection assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007719"^^ . "immunodetection assay evidence used in manual assertion"^^ . _:genid9687 . _:genid9687 . _:genid9687 . _:genid9687 . _:genid9687 "true"^^ . . . . "IDA"^^ . "A type of desumoylation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007720"^^ . "desumoylation assay evidence used in manual assertion"^^ . _:genid9688 . _:genid9688 . _:genid9688 . _:genid9688 . _:genid9688 "true"^^ . . . . "IDA"^^ . "A type of farnesylation assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007721"^^ . "farnesylation assay evidence used in manual assertion"^^ . _:genid9689 . _:genid9689 . _:genid9689 . _:genid9689 . _:genid9689 "true"^^ . . . . "IDA"^^ . "A type of reconstitution assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007722"^^ . "reconstitution assay evidence used in manual assertion"^^ . _:genid9690 . _:genid9690 . _:genid9690 . _:genid9690 . _:genid9690 "true"^^ . . . . "IDA"^^ . "A type of in vitro transcription reconstitution assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007723"^^ . "in vitro transcription reconstitution assay evidence used in manual assertion"^^ . _:genid9691 . _:genid9691 . _:genid9691 . _:genid9691 . _:genid9691 "true"^^ . . . . "IDA"^^ . "A type of localization evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007724"^^ . "localization evidence used in manual assertion"^^ . _:genid9692 . _:genid9692 . _:genid9692 . _:genid9692 . _:genid9692 "true"^^ . . . . "IDA"^^ . "A type of protein localization evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007725"^^ . "protein localization evidence used in manual assertion"^^ . _:genid9693 . _:genid9693 . _:genid9693 . _:genid9693 . _:genid9693 "true"^^ . . . . "IDA"^^ . "A type of fusion protein localization evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007726"^^ . "fusion protein localization evidence used in manual assertion"^^ . _:genid9694 . _:genid9694 . _:genid9694 . _:genid9694 . _:genid9694 "true"^^ . . . . "IDA"^^ . "A type of nucleic acid localization evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007727"^^ . "nucleic acid localization evidence used in manual assertion"^^ . _:genid9695 . _:genid9695 . _:genid9695 . _:genid9695 . _:genid9695 "true"^^ . . . . "EXP"^^ . "A type of anatomical perturbation phenotypic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007728"^^ . "anatomical perturbation phenotypic evidence used in manual assertion"^^ . _:genid9696 . _:genid9696 . _:genid9696 . _:genid9696 . _:genid9696 "true"^^ . . . . "EXP"^^ . "A type of cleavage arrested development evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007730"^^ . "cleavage arrested development evidence used in manual assertion"^^ . _:genid9697 . _:genid9697 . _:genid9697 . _:genid9697 . _:genid9697 "true"^^ . . . . "EXP"^^ . "A type of spectrometry evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007731"^^ . "spectrometry evidence used in manual assertion"^^ . _:genid9698 . _:genid9698 . _:genid9698 . _:genid9698 . _:genid9698 "true"^^ . . . . "EXP"^^ . "A type of sequencing assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007732"^^ . "sequencing assay evidence used in manual assertion"^^ . _:genid9699 . _:genid9699 . _:genid9699 . _:genid9699 . _:genid9699 "true"^^ . . . . "EXP"^^ . "A type of nucleotide sequencing assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007733"^^ . "nucleotide sequencing assay evidence used in manual assertion"^^ . _:genid9700 . _:genid9700 . _:genid9700 . _:genid9700 . _:genid9700 "true"^^ . . . . "EXP"^^ . "A type of high throughput nucleotide sequencing assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007734"^^ . "high throughput nucleotide sequencing assay evidence used in manual assertion"^^ . _:genid9701 . _:genid9701 . _:genid9701 . _:genid9701 . _:genid9701 "true"^^ . . . . "EXP"^^ . "A type of structure determination evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007735"^^ . "structure determination evidence used in manual assertion"^^ . _:genid9702 . _:genid9702 . _:genid9702 . _:genid9702 . _:genid9702 "true"^^ . . . . "EXP"^^ . "A type of molecule detection assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007736"^^ . "molecule detection assay evidence used in manual assertion"^^ . _:genid9703 . _:genid9703 . _:genid9703 . _:genid9703 . _:genid9703 "true"^^ . . . . "EXP"^^ . "A type of DNA detection assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007737"^^ . "DNA detection assay evidence used in manual assertion"^^ . _:genid9704 . _:genid9704 . _:genid9704 . _:genid9704 . _:genid9704 "true"^^ . . . . "EXP"^^ . "A type of protein detection assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007738"^^ . "protein detection assay evidence used in manual assertion"^^ . _:genid9705 . _:genid9705 . _:genid9705 . _:genid9705 . _:genid9705 "true"^^ . . . . "EXP"^^ . "A type of RNA detection assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007739"^^ . "RNA detection assay evidence used in manual assertion"^^ . _:genid9706 . _:genid9706 . _:genid9706 . _:genid9706 . _:genid9706 "true"^^ . . . . "EXP"^^ . "A type of small molecule detection assay evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007740"^^ . "small molecule detection assay evidence used in manual assertion"^^ . _:genid9707 . _:genid9707 . _:genid9707 . _:genid9707 . _:genid9707 "true"^^ . . . . "EXP"^^ . "A type of chromosome conformation-based evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007741"^^ . "chromosome conformation-based evidence used in manual assertion"^^ . _:genid9708 . _:genid9708 . _:genid9708 . _:genid9708 . _:genid9708 "true"^^ . . . . "EXP"^^ . "A type of 3C evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007742"^^ . "3C evidence used in manual assertion"^^ . _:genid9709 . _:genid9709 . _:genid9709 . _:genid9709 . _:genid9709 "true"^^ . . . . "A type of combinatorial computational and experimental evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007744"^^ . "combinatorial computational and experimental evidence used in manual assertion"^^ . _:genid9710 . _:genid9710 . _:genid9710 . _:genid9710 . _:genid9710 "true"^^ . . . . "A type of combinatorial experimental evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007745"^^ . "combinatorial experimental evidence used in manual assertion"^^ . _:genid9711 . _:genid9711 . _:genid9711 . _:genid9711 . _:genid9711 "true"^^ . . . . "A type of biological system reconstruction evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007746"^^ . "biological system reconstruction evidence used in manual assertion"^^ . _:genid9712 . _:genid9712 . _:genid9712 . _:genid9712 . _:genid9712 "true"^^ . . . . "A type of biological system reconstruction evidence by experimental evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007747"^^ . "biological system reconstruction evidence by experimental evidence used in manual assertion"^^ . _:genid9713 . _:genid9713 . _:genid9713 . _:genid9713 . _:genid9713 "true"^^ . . . . "A type of phenotypic similarity evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007748"^^ . "phenotypic similarity evidence used in manual assertion"^^ . _:genid9714 . _:genid9714 . _:genid9714 . _:genid9714 . _:genid9714 "true"^^ . . . . "ISA"^^ . "A type of transcript splice pattern evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007749"^^ . "transcript splice pattern evidence used in manual assertion"^^ . _:genid9715 . _:genid9715 . _:genid9715 . _:genid9715 . _:genid9715 "true"^^ . . . . "A type of phylogenetic evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007750"^^ . "phylogenetic evidence used in manual assertion"^^ . _:genid9716 . _:genid9716 . _:genid9716 . _:genid9716 . _:genid9716 "true"^^ . . _:genid9717 . _:genid9718 . _:genid9720 _:genid9719 . _:genid9718 _:genid9720 . _:genid9719 . _:genid9719 . _:genid9719 . _:genid9720 . _:genid9717 _:genid9718 . _:genid9717 . . . "A type of inferential evidence that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007751"^^ . "inferential evidence used in manual assertion"^^ . _:genid9721 . _:genid9721 . _:genid9721 . _:genid9721 . _:genid9721 "true"^^ . _:genid9722 . _:genid9722 . _:genid9722 . _:genid9722 . _:genid9722 "true"^^ . . _:genid9723 . _:genid9724 . _:genid9726 _:genid9725 . _:genid9724 _:genid9726 . _:genid9725 . _:genid9725 . _:genid9725 . _:genid9726 . _:genid9723 _:genid9724 . _:genid9723 . . . "IC"^^ . "A type of curator inference from authoritative source that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007752"^^ . "curator inference from authoritative source used in manual assertion"^^ . _:genid9727 . _:genid9727 . _:genid9727 . _:genid9727 . _:genid9727 "true"^^ . _:genid9728 . _:genid9728 . _:genid9728 . _:genid9728 . _:genid9728 "true"^^ . . _:genid9729 . _:genid9730 . _:genid9732 _:genid9731 . _:genid9730 _:genid9732 . _:genid9731 . _:genid9731 . _:genid9731 . _:genid9732 . _:genid9729 _:genid9730 . _:genid9729 . . . "IC"^^ . "A type of curator inference from encyclopedia that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007753"^^ . "curator inference from encyclopedia used in manual assertion"^^ . _:genid9733 . _:genid9733 . _:genid9733 . _:genid9733 . _:genid9733 "true"^^ . _:genid9734 . _:genid9734 . _:genid9734 . _:genid9734 . _:genid9734 "true"^^ . . _:genid9735 . _:genid9736 . _:genid9738 _:genid9737 . _:genid9736 _:genid9738 . _:genid9737 . _:genid9737 . _:genid9737 . _:genid9738 . _:genid9735 _:genid9736 . _:genid9735 . . . "IC"^^ . "A type of curator inference from Wikipedia that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007754"^^ . "curator inference from Wikipedia used in manual assertion"^^ . _:genid9739 . _:genid9739 . _:genid9739 . _:genid9739 . _:genid9739 "true"^^ . _:genid9740 . _:genid9740 . _:genid9740 . _:genid9740 . _:genid9740 "true"^^ . . _:genid9741 . _:genid9742 . _:genid9744 _:genid9743 . _:genid9742 _:genid9744 . _:genid9743 . _:genid9743 . _:genid9743 . _:genid9744 . _:genid9741 _:genid9742 . _:genid9741 . . . "IC"^^ . "A type of curator inference from MedlinePlus encyclopedia that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007755"^^ . "curator inference from MedlinePlus encyclopedia used in manual assertion"^^ . _:genid9745 . _:genid9745 . _:genid9745 . _:genid9745 . _:genid9745 "true"^^ . _:genid9746 . _:genid9746 . _:genid9746 . _:genid9746 . _:genid9746 "true"^^ . . . . "IC"^^ . "A type of curator inference from Britannica that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007756"^^ . "curator inference from Britannica used in manual assertion"^^ . _:genid9747 . _:genid9747 . _:genid9747 . _:genid9747 . _:genid9747 "true"^^ . . _:genid9748 . _:genid9749 . _:genid9751 _:genid9750 . _:genid9749 _:genid9751 . _:genid9750 . _:genid9750 . _:genid9750 . _:genid9751 . _:genid9748 _:genid9749 . _:genid9748 . . . "IC"^^ . "A type of curator inference from book that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007757"^^ . "curator inference from book used in manual assertion"^^ . _:genid9752 . _:genid9752 . _:genid9752 . _:genid9752 . _:genid9752 "true"^^ . _:genid9753 . _:genid9753 . _:genid9753 . _:genid9753 . _:genid9753 "true"^^ . . _:genid9754 . _:genid9755 . _:genid9757 _:genid9756 . _:genid9755 _:genid9757 . _:genid9756 . _:genid9756 . _:genid9756 . _:genid9757 . _:genid9754 _:genid9755 . _:genid9754 . . . "IC"^^ . "A type of curator inference from journal publication that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007758"^^ . "curator inference from journal publication used in manual assertion"^^ . _:genid9758 . _:genid9758 . _:genid9758 . _:genid9758 . _:genid9758 "true"^^ . _:genid9759 . _:genid9759 . _:genid9759 . _:genid9759 . _:genid9759 "true"^^ . . _:genid9760 . _:genid9761 . _:genid9763 _:genid9762 . _:genid9761 _:genid9763 . _:genid9762 . _:genid9762 . _:genid9762 . _:genid9763 . _:genid9760 _:genid9761 . _:genid9760 . . . "IC"^^ . "A type of curator inference from database that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007759"^^ . "curator inference from database used in manual assertion"^^ . _:genid9764 . _:genid9764 . _:genid9764 . _:genid9764 . _:genid9764 "true"^^ . _:genid9765 . _:genid9765 . _:genid9765 . _:genid9765 . _:genid9765 "true"^^ . . _:genid9766 . _:genid9767 . _:genid9769 _:genid9768 . _:genid9767 _:genid9769 . _:genid9768 . _:genid9768 . _:genid9768 . _:genid9769 . _:genid9766 _:genid9767 . _:genid9766 . . . "IC"^^ . "A type of curator inference from dictionary that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007760"^^ . "curator inference from dictionary used in manual assertion"^^ . _:genid9770 . _:genid9770 . _:genid9770 . _:genid9770 . _:genid9770 "true"^^ . _:genid9771 . _:genid9771 . _:genid9771 . _:genid9771 . _:genid9771 "true"^^ . . _:genid9772 . _:genid9773 . _:genid9775 _:genid9774 . _:genid9773 _:genid9775 . _:genid9774 . _:genid9774 . _:genid9774 . _:genid9775 . _:genid9772 _:genid9773 . _:genid9772 . . . "IC"^^ . "A type of curator inference from MedlinePlus dictionary that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007761"^^ . "curator inference from MedlinePlus dictionary used in manual assertion"^^ . _:genid9776 . _:genid9776 . _:genid9776 . _:genid9776 . _:genid9776 "true"^^ . _:genid9777 . _:genid9777 . _:genid9777 . _:genid9777 . _:genid9777 "true"^^ . . _:genid9778 . _:genid9779 . _:genid9781 _:genid9780 . _:genid9779 _:genid9781 . _:genid9780 . _:genid9780 . _:genid9780 . _:genid9781 . _:genid9778 _:genid9779 . _:genid9778 . . . "IC"^^ . "A type of curator inference from Oxford Dictionary that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007762"^^ . "curator inference from Oxford Dictionary used in manual assertion"^^ . _:genid9782 . _:genid9782 . _:genid9782 . _:genid9782 . _:genid9782 "true"^^ . _:genid9783 . _:genid9783 . _:genid9783 . _:genid9783 . _:genid9783 "true"^^ . . _:genid9784 . _:genid9785 . _:genid9787 _:genid9786 . _:genid9785 _:genid9787 . _:genid9786 . _:genid9786 . _:genid9786 . _:genid9787 . _:genid9784 _:genid9785 . _:genid9784 . . . "IC"^^ . "A type of curator inference from Merriam-Webster Dictionary that is used in a manual assertion."^^ . "rctauber"^^ . "2019-03-20T12:27:00Z"^^ . "eco"^^ . "ECO:0007763"^^ . "curator inference from Merriam-Webster Dictionary used in manual assertion"^^ . _:genid9788 . _:genid9788 . _:genid9788 . _:genid9788 . _:genid9788 "true"^^ . _:genid9789 . _:genid9789 . _:genid9789 . _:genid9789 . _:genid9789 "true"^^ . . _:genid9790 . _:genid9791 . _:genid9793 _:genid9792 . _:genid9791 _:genid9793 . _:genid9792 . _:genid9792 . _:genid9792 . _:genid9793 . _:genid9790 _:genid9791 . _:genid9790 . . . "IEA"^^ . "A type of reporter gene assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007765"^^ . "reporter gene assay evidence used in automatic assertion"^^ . _:genid9794 . _:genid9794 . _:genid9794 . _:genid9794 . _:genid9794 "true"^^ . _:genid9795 . _:genid9795 . _:genid9795 . _:genid9795 . _:genid9795 "true"^^ . . _:genid9796 . _:genid9797 . _:genid9799 _:genid9798 . _:genid9797 _:genid9799 . _:genid9798 . _:genid9798 . _:genid9798 . _:genid9799 . _:genid9796 _:genid9797 . _:genid9796 . . . "IEA"^^ . "A type of voltage clamp recording evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007766"^^ . "voltage clamp recording evidence used in automatic assertion"^^ . _:genid9800 . _:genid9800 . _:genid9800 . _:genid9800 . _:genid9800 "true"^^ . _:genid9801 . _:genid9801 . _:genid9801 . _:genid9801 . _:genid9801 "true"^^ . . _:genid9802 . _:genid9803 . _:genid9805 _:genid9804 . _:genid9803 _:genid9805 . _:genid9804 . _:genid9804 . _:genid9804 . _:genid9805 . _:genid9802 _:genid9803 . _:genid9802 . . . "IEA"^^ . "A type of protein kinase assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007767"^^ . "protein kinase assay evidence used in automatic assertion"^^ . _:genid9806 . _:genid9806 . _:genid9806 . _:genid9806 . _:genid9806 "true"^^ . _:genid9807 . _:genid9807 . _:genid9807 . _:genid9807 . _:genid9807 "true"^^ . . _:genid9808 . _:genid9809 . _:genid9811 _:genid9810 . _:genid9809 _:genid9811 . _:genid9810 . _:genid9810 . _:genid9810 . _:genid9811 . _:genid9808 _:genid9809 . _:genid9808 . . . "IEA"^^ . "A type of transcription assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007768"^^ . "transcription assay evidence used in automatic assertion"^^ . _:genid9812 . _:genid9812 . _:genid9812 . _:genid9812 . _:genid9812 "true"^^ . _:genid9813 . _:genid9813 . _:genid9813 . _:genid9813 . _:genid9813 "true"^^ . . _:genid9814 . _:genid9815 . _:genid9817 _:genid9816 . _:genid9815 _:genid9817 . _:genid9816 . _:genid9816 . _:genid9816 . _:genid9817 . _:genid9814 _:genid9815 . _:genid9814 . . . "IEA"^^ . "A type of gel electrophoresis evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007769"^^ . "gel electrophoresis evidence used in automatic assertion"^^ . _:genid9818 . _:genid9818 . _:genid9818 . _:genid9818 . _:genid9818 "true"^^ . _:genid9819 . _:genid9819 . _:genid9819 . _:genid9819 . _:genid9819 "true"^^ . . _:genid9820 . _:genid9821 . _:genid9823 _:genid9822 . _:genid9821 _:genid9823 . _:genid9822 . _:genid9822 . _:genid9822 . _:genid9823 . _:genid9820 _:genid9821 . _:genid9820 . . . "IEA"^^ . "A type of sodium dodecyl sulfate polyacrylamide gel electrophoresis evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007770"^^ . "sodium dodecyl sulfate polyacrylamide gel electrophoresis evidence used in automatic assertion"^^ . _:genid9824 . _:genid9824 . _:genid9824 . _:genid9824 . _:genid9824 "true"^^ . _:genid9825 . _:genid9825 . _:genid9825 . _:genid9825 . _:genid9825 "true"^^ . . _:genid9826 . _:genid9827 . _:genid9829 _:genid9828 . _:genid9827 _:genid9829 . _:genid9828 . _:genid9828 . _:genid9828 . _:genid9829 . _:genid9826 _:genid9827 . _:genid9826 . . . "IEA"^^ . "A type of deacetylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007771"^^ . "deacetylation assay evidence used in automatic assertion"^^ . _:genid9830 . _:genid9830 . _:genid9830 . _:genid9830 . _:genid9830 "true"^^ . _:genid9831 . _:genid9831 . _:genid9831 . _:genid9831 . _:genid9831 "true"^^ . . _:genid9832 . _:genid9833 . _:genid9835 _:genid9834 . _:genid9833 _:genid9835 . _:genid9834 . _:genid9834 . _:genid9834 . _:genid9835 . _:genid9832 _:genid9833 . _:genid9832 . . . "IEA"^^ . "A type of phosphatase assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007772"^^ . "phosphatase assay evidence used in automatic assertion"^^ . _:genid9836 . _:genid9836 . _:genid9836 . _:genid9836 . _:genid9836 "true"^^ . _:genid9837 . _:genid9837 . _:genid9837 . _:genid9837 . _:genid9837 "true"^^ . . _:genid9838 . _:genid9839 . _:genid9841 _:genid9840 . _:genid9839 _:genid9841 . _:genid9840 . _:genid9840 . _:genid9840 . _:genid9841 . _:genid9838 _:genid9839 . _:genid9838 . . . "IEA"^^ . "A type of cell-based assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007773"^^ . "cell-based assay evidence used in automatic assertion"^^ . _:genid9842 . _:genid9842 . _:genid9842 . _:genid9842 . _:genid9842 "true"^^ . _:genid9843 . _:genid9843 . _:genid9843 . _:genid9843 . _:genid9843 "true"^^ . . _:genid9844 . _:genid9845 . _:genid9847 _:genid9846 . _:genid9845 _:genid9847 . _:genid9846 . _:genid9846 . _:genid9846 . _:genid9847 . _:genid9844 _:genid9845 . _:genid9844 . . . "IEA"^^ . "A type of cell viability assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007774"^^ . "cell viability assay evidence used in automatic assertion"^^ . _:genid9848 . _:genid9848 . _:genid9848 . _:genid9848 . _:genid9848 "true"^^ . _:genid9849 . _:genid9849 . _:genid9849 . _:genid9849 . _:genid9849 "true"^^ . . _:genid9850 . _:genid9851 . _:genid9853 _:genid9852 . _:genid9851 _:genid9853 . _:genid9852 . _:genid9852 . _:genid9852 . _:genid9853 . _:genid9850 _:genid9851 . _:genid9850 . . . "IEA"^^ . "A type of cell proliferation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007775"^^ . "cell proliferation assay evidence used in automatic assertion"^^ . _:genid9854 . _:genid9854 . _:genid9854 . _:genid9854 . _:genid9854 "true"^^ . _:genid9855 . _:genid9855 . _:genid9855 . _:genid9855 . _:genid9855 "true"^^ . . _:genid9856 . _:genid9857 . _:genid9859 _:genid9858 . _:genid9857 _:genid9859 . _:genid9858 . _:genid9858 . _:genid9858 . _:genid9859 . _:genid9856 _:genid9857 . _:genid9856 . . . "IEA"^^ . "A type of DNA synthesis cell proliferation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007776"^^ . "DNA synthesis cell proliferation assay evidence used in automatic assertion"^^ . _:genid9860 . _:genid9860 . _:genid9860 . _:genid9860 . _:genid9860 "true"^^ . _:genid9861 . _:genid9861 . _:genid9861 . _:genid9861 . _:genid9861 "true"^^ . . _:genid9862 . _:genid9863 . _:genid9865 _:genid9864 . _:genid9863 _:genid9865 . _:genid9864 . _:genid9864 . _:genid9864 . _:genid9865 . _:genid9862 _:genid9863 . _:genid9862 . . . "IEA"^^ . "A type of apoptotic assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007777"^^ . "apoptotic assay evidence used in automatic assertion"^^ . _:genid9866 . _:genid9866 . _:genid9866 . _:genid9866 . _:genid9866 "true"^^ . _:genid9867 . _:genid9867 . _:genid9867 . _:genid9867 . _:genid9867 "true"^^ . . _:genid9868 . _:genid9869 . _:genid9871 _:genid9870 . _:genid9869 _:genid9871 . _:genid9870 . _:genid9870 . _:genid9870 . _:genid9871 . _:genid9868 _:genid9869 . _:genid9868 . . . "IEA"^^ . "A type of cell growth assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007778"^^ . "cell growth assay evidence used in automatic assertion"^^ . _:genid9872 . _:genid9872 . _:genid9872 . _:genid9872 . _:genid9872 "true"^^ . _:genid9873 . _:genid9873 . _:genid9873 . _:genid9873 . _:genid9873 "true"^^ . . _:genid9874 . _:genid9875 . _:genid9877 _:genid9876 . _:genid9875 _:genid9877 . _:genid9876 . _:genid9876 . _:genid9876 . _:genid9877 . _:genid9874 _:genid9875 . _:genid9874 . . . "IEA"^^ . "A type of disk diffusion test evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007779"^^ . "disk diffusion test evidence used in automatic assertion"^^ . _:genid9878 . _:genid9878 . _:genid9878 . _:genid9878 . _:genid9878 "true"^^ . _:genid9879 . _:genid9879 . _:genid9879 . _:genid9879 . _:genid9879 "true"^^ . . _:genid9880 . _:genid9881 . _:genid9883 _:genid9882 . _:genid9881 _:genid9883 . _:genid9882 . _:genid9882 . _:genid9882 . _:genid9883 . _:genid9880 _:genid9881 . _:genid9880 . . . "IEA"^^ . "A type of chemotaxis assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007780"^^ . "chemotaxis assay evidence used in automatic assertion"^^ . _:genid9884 . _:genid9884 . _:genid9884 . _:genid9884 . _:genid9884 "true"^^ . _:genid9885 . _:genid9885 . _:genid9885 . _:genid9885 . _:genid9885 "true"^^ . . _:genid9886 . _:genid9887 . _:genid9889 _:genid9888 . _:genid9887 _:genid9889 . _:genid9888 . _:genid9888 . _:genid9888 . _:genid9889 . _:genid9886 _:genid9887 . _:genid9886 . . . "IEA"^^ . "A type of cytotoxicity assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007781"^^ . "cytotoxicity assay evidence used in automatic assertion"^^ . _:genid9890 . _:genid9890 . _:genid9890 . _:genid9890 . _:genid9890 "true"^^ . _:genid9891 . _:genid9891 . _:genid9891 . _:genid9891 . _:genid9891 "true"^^ . . _:genid9892 . _:genid9893 . _:genid9895 _:genid9894 . _:genid9893 _:genid9895 . _:genid9894 . _:genid9894 . _:genid9894 . _:genid9895 . _:genid9892 _:genid9893 . _:genid9892 . . . "IEA"^^ . "A type of cleavage assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007782"^^ . "cleavage assay evidence used in automatic assertion"^^ . _:genid9896 . _:genid9896 . _:genid9896 . _:genid9896 . _:genid9896 "true"^^ . _:genid9897 . _:genid9897 . _:genid9897 . _:genid9897 . _:genid9897 "true"^^ . . _:genid9898 . _:genid9899 . _:genid9901 _:genid9900 . _:genid9899 _:genid9901 . _:genid9900 . _:genid9900 . _:genid9900 . _:genid9901 . _:genid9898 _:genid9899 . _:genid9898 . . . "IEA"^^ . "A type of methylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007783"^^ . "methylation assay evidence used in automatic assertion"^^ . _:genid9902 . _:genid9902 . _:genid9902 . _:genid9902 . _:genid9902 "true"^^ . _:genid9903 . _:genid9903 . _:genid9903 . _:genid9903 . _:genid9903 "true"^^ . . "A type of protein assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007784"^^ . "protein assay evidence used in automatic assertion"^^ . "true"^^ . . _:genid9904 . _:genid9905 . _:genid9907 _:genid9906 . _:genid9905 _:genid9907 . _:genid9906 . _:genid9906 . _:genid9906 . _:genid9907 . _:genid9904 _:genid9905 . _:genid9904 . . . "IEA"^^ . "A type of protein inhibition evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007785"^^ . "protein inhibition evidence used in automatic assertion"^^ . _:genid9908 . _:genid9908 . _:genid9908 . _:genid9908 . _:genid9908 "true"^^ . _:genid9909 . _:genid9909 . _:genid9909 . _:genid9909 . _:genid9909 "true"^^ . . _:genid9910 . _:genid9911 . _:genid9913 _:genid9912 . _:genid9911 _:genid9913 . _:genid9912 . _:genid9912 . _:genid9912 . _:genid9913 . _:genid9910 _:genid9911 . _:genid9910 . . . "IEA"^^ . "A type of chromatin immunoprecipitation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007786"^^ . "chromatin immunoprecipitation evidence used in automatic assertion"^^ . _:genid9914 . _:genid9914 . _:genid9914 . _:genid9914 . _:genid9914 "true"^^ . _:genid9915 . _:genid9915 . _:genid9915 . _:genid9915 . _:genid9915 "true"^^ . . _:genid9916 . _:genid9917 . _:genid9919 _:genid9918 . _:genid9917 _:genid9919 . _:genid9918 . _:genid9918 . _:genid9918 . _:genid9919 . _:genid9916 _:genid9917 . _:genid9916 . . . "IEA"^^ . "A type of protein separation evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007787"^^ . "protein separation evidence used in automatic assertion"^^ . _:genid9920 . _:genid9920 . _:genid9920 . _:genid9920 . _:genid9920 "true"^^ . _:genid9921 . _:genid9921 . _:genid9921 . _:genid9921 . _:genid9921 "true"^^ . . _:genid9922 . _:genid9923 . _:genid9925 _:genid9924 . _:genid9923 _:genid9925 . _:genid9924 . _:genid9924 . _:genid9924 . _:genid9925 . _:genid9922 _:genid9923 . _:genid9922 . . . "IEA"^^ . "A type of sumoylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007788"^^ . "sumoylation assay evidence used in automatic assertion"^^ . _:genid9926 . _:genid9926 . _:genid9926 . _:genid9926 . _:genid9926 "true"^^ . _:genid9927 . _:genid9927 . _:genid9927 . _:genid9927 . _:genid9927 "true"^^ . . _:genid9928 . _:genid9929 . _:genid9931 _:genid9930 . _:genid9929 _:genid9931 . _:genid9930 . _:genid9930 . _:genid9930 . _:genid9931 . _:genid9928 _:genid9929 . _:genid9928 . . . "IEA"^^ . "A type of transport assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007789"^^ . "transport assay evidence used in automatic assertion"^^ . _:genid9932 . _:genid9932 . _:genid9932 . _:genid9932 . _:genid9932 "true"^^ . _:genid9933 . _:genid9933 . _:genid9933 . _:genid9933 . _:genid9933 "true"^^ . . _:genid9934 . _:genid9935 . _:genid9937 _:genid9936 . _:genid9935 _:genid9937 . _:genid9936 . _:genid9936 . _:genid9936 . _:genid9937 . _:genid9934 _:genid9935 . _:genid9934 . . . "IEA"^^ . "A type of defarnesylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007790"^^ . "defarnesylation assay evidence used in automatic assertion"^^ . _:genid9938 . _:genid9938 . _:genid9938 . _:genid9938 . _:genid9938 "true"^^ . _:genid9939 . _:genid9939 . _:genid9939 . _:genid9939 . _:genid9939 "true"^^ . . _:genid9940 . _:genid9941 . _:genid9943 _:genid9942 . _:genid9941 _:genid9943 . _:genid9942 . _:genid9942 . _:genid9942 . _:genid9943 . _:genid9940 _:genid9941 . _:genid9940 . . . "IEA"^^ . "A type of deubiquitination assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007791"^^ . "deubiquitination assay evidence used in automatic assertion"^^ . _:genid9944 . _:genid9944 . _:genid9944 . _:genid9944 . _:genid9944 "true"^^ . _:genid9945 . _:genid9945 . _:genid9945 . _:genid9945 . _:genid9945 "true"^^ . . _:genid9946 . _:genid9947 . _:genid9949 _:genid9948 . _:genid9947 _:genid9949 . _:genid9948 . _:genid9948 . _:genid9948 . _:genid9949 . _:genid9946 _:genid9947 . _:genid9946 . . . "IEA"^^ . "A type of palmitoylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007792"^^ . "palmitoylation assay evidence used in automatic assertion"^^ . _:genid9950 . _:genid9950 . _:genid9950 . _:genid9950 . _:genid9950 "true"^^ . _:genid9951 . _:genid9951 . _:genid9951 . _:genid9951 . _:genid9951 "true"^^ . . _:genid9952 . _:genid9953 . _:genid9955 _:genid9954 . _:genid9953 _:genid9955 . _:genid9954 . _:genid9954 . _:genid9954 . _:genid9955 . _:genid9952 _:genid9953 . _:genid9952 . . . "IEA"^^ . "A type of ex vivo assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007793"^^ . "ex vivo assay evidence used in automatic assertion"^^ . _:genid9956 . _:genid9956 . _:genid9956 . _:genid9956 . _:genid9956 "true"^^ . _:genid9957 . _:genid9957 . _:genid9957 . _:genid9957 . _:genid9957 "true"^^ . . _:genid9958 . _:genid9959 . _:genid9961 _:genid9960 . _:genid9959 _:genid9961 . _:genid9960 . _:genid9960 . _:genid9960 . _:genid9961 . _:genid9958 _:genid9959 . _:genid9958 . . . "IEA"^^ . "A type of acetylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007794"^^ . "acetylation assay evidence used in automatic assertion"^^ . _:genid9962 . _:genid9962 . _:genid9962 . _:genid9962 . _:genid9962 "true"^^ . _:genid9963 . _:genid9963 . _:genid9963 . _:genid9963 . _:genid9963 "true"^^ . . _:genid9964 . _:genid9965 . _:genid9967 _:genid9966 . _:genid9965 _:genid9967 . _:genid9966 . _:genid9966 . _:genid9966 . _:genid9967 . _:genid9964 _:genid9965 . _:genid9964 . . . "IEA"^^ . "A type of demethylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007795"^^ . "demethylation assay evidence used in automatic assertion"^^ . _:genid9968 . _:genid9968 . _:genid9968 . _:genid9968 . _:genid9968 "true"^^ . _:genid9969 . _:genid9969 . _:genid9969 . _:genid9969 . _:genid9969 "true"^^ . . _:genid9970 . _:genid9971 . _:genid9973 _:genid9972 . _:genid9971 _:genid9973 . _:genid9972 . _:genid9972 . _:genid9972 . _:genid9973 . _:genid9970 _:genid9971 . _:genid9970 . . . "IEA"^^ . "A type of immunodetection assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007796"^^ . "immunodetection assay evidence used in automatic assertion"^^ . _:genid9974 . _:genid9974 . _:genid9974 . _:genid9974 . _:genid9974 "true"^^ . _:genid9975 . _:genid9975 . _:genid9975 . _:genid9975 . _:genid9975 "true"^^ . . _:genid9976 . _:genid9977 . _:genid9979 _:genid9978 . _:genid9977 _:genid9979 . _:genid9978 . _:genid9978 . _:genid9978 . _:genid9979 . _:genid9976 _:genid9977 . _:genid9976 . . . "IEA"^^ . "A type of polyADP-ribosylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007797"^^ . "polyADP-ribosylation assay evidence used in automatic assertion"^^ . _:genid9980 . _:genid9980 . _:genid9980 . _:genid9980 . _:genid9980 "true"^^ . _:genid9981 . _:genid9981 . _:genid9981 . _:genid9981 . _:genid9981 "true"^^ . . _:genid9982 . _:genid9983 . _:genid9985 _:genid9984 . _:genid9983 _:genid9985 . _:genid9984 . _:genid9984 . _:genid9984 . _:genid9985 . _:genid9982 _:genid9983 . _:genid9982 . . . "IEA"^^ . "A type of staining evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007798"^^ . "staining evidence used in automatic assertion"^^ . _:genid9986 . _:genid9986 . _:genid9986 . _:genid9986 . _:genid9986 "true"^^ . _:genid9987 . _:genid9987 . _:genid9987 . _:genid9987 . _:genid9987 "true"^^ . . _:genid9988 . _:genid9989 . _:genid9991 _:genid9990 . _:genid9989 _:genid9991 . _:genid9990 . _:genid9990 . _:genid9990 . _:genid9991 . _:genid9988 _:genid9989 . _:genid9988 . . . "IEA"^^ . "A type of translation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007799"^^ . "translation assay evidence used in automatic assertion"^^ . _:genid9992 . _:genid9992 . _:genid9992 . _:genid9992 . _:genid9992 "true"^^ . _:genid9993 . _:genid9993 . _:genid9993 . _:genid9993 . _:genid9993 "true"^^ . . _:genid9994 . _:genid9995 . _:genid9997 _:genid9996 . _:genid9995 _:genid9997 . _:genid9996 . _:genid9996 . _:genid9996 . _:genid9997 . _:genid9994 _:genid9995 . _:genid9994 . . . "IEA"^^ . "A type of farnesylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007800"^^ . "farnesylation assay evidence used in automatic assertion"^^ . _:genid9998 . _:genid9998 . _:genid9998 . _:genid9998 . _:genid9998 "true"^^ . _:genid9999 . _:genid9999 . _:genid9999 . _:genid9999 . _:genid9999 "true"^^ . . _:genid10000 . _:genid10001 . _:genid10003 _:genid10002 . _:genid10001 _:genid10003 . _:genid10002 . _:genid10002 . _:genid10002 . _:genid10003 . _:genid10000 _:genid10001 . _:genid10000 . . . "IEA"^^ . "A type of ubiquitination assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007801"^^ . "ubiquitination assay evidence used in automatic assertion"^^ . _:genid10004 . _:genid10004 . _:genid10004 . _:genid10004 . _:genid10004 "true"^^ . _:genid10005 . _:genid10005 . _:genid10005 . _:genid10005 . _:genid10005 "true"^^ . . _:genid10006 . _:genid10007 . _:genid10009 _:genid10008 . _:genid10007 _:genid10009 . _:genid10008 . _:genid10008 . _:genid10008 . _:genid10009 . _:genid10006 _:genid10007 . _:genid10006 . . . "IEA"^^ . "A type of desumoylation assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007802"^^ . "desumoylation assay evidence used in automatic assertion"^^ . _:genid10010 . _:genid10010 . _:genid10010 . _:genid10010 . _:genid10010 "true"^^ . _:genid10011 . _:genid10011 . _:genid10011 . _:genid10011 . _:genid10011 "true"^^ . . _:genid10012 . _:genid10013 . _:genid10015 _:genid10014 . _:genid10013 _:genid10015 . _:genid10014 . _:genid10014 . _:genid10014 . _:genid10015 . _:genid10012 _:genid10013 . _:genid10012 . . . "IEA"^^ . "A type of reconstitution assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007803"^^ . "reconstitution assay evidence used in automatic assertion"^^ . _:genid10016 . _:genid10016 . _:genid10016 . _:genid10016 . _:genid10016 "true"^^ . _:genid10017 . _:genid10017 . _:genid10017 . _:genid10017 . _:genid10017 "true"^^ . . _:genid10018 . _:genid10019 . _:genid10021 _:genid10020 . _:genid10019 _:genid10021 . _:genid10020 . _:genid10020 . _:genid10020 . _:genid10021 . _:genid10018 _:genid10019 . _:genid10018 . . . "IEA"^^ . "A type of in vitro transcription reconstitution assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007804"^^ . "in vitro transcription reconstitution assay evidence used in automatic assertion"^^ . _:genid10022 . _:genid10022 . _:genid10022 . _:genid10022 . _:genid10022 "true"^^ . _:genid10023 . _:genid10023 . _:genid10023 . _:genid10023 . _:genid10023 "true"^^ . . _:genid10024 . _:genid10025 . _:genid10027 _:genid10026 . _:genid10025 _:genid10027 . _:genid10026 . _:genid10026 . _:genid10026 . _:genid10027 . _:genid10024 _:genid10025 . _:genid10024 . . . "IEA"^^ . "A type of substance quantification evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007805"^^ . "substance quantification evidence used in automatic assertion"^^ . _:genid10028 . _:genid10028 . _:genid10028 . _:genid10028 . _:genid10028 "true"^^ . _:genid10029 . _:genid10029 . _:genid10029 . _:genid10029 . _:genid10029 "true"^^ . . _:genid10030 . _:genid10031 . _:genid10033 _:genid10032 . _:genid10031 _:genid10033 . _:genid10032 . _:genid10032 . _:genid10032 . _:genid10033 . _:genid10030 _:genid10031 . _:genid10030 . . . "IEA"^^ . "A type of localization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007806"^^ . "localization evidence used in automatic assertion"^^ . _:genid10034 . _:genid10034 . _:genid10034 . _:genid10034 . _:genid10034 "true"^^ . _:genid10035 . _:genid10035 . _:genid10035 . _:genid10035 . _:genid10035 "true"^^ . . _:genid10036 . _:genid10037 . _:genid10039 _:genid10038 . _:genid10037 _:genid10039 . _:genid10038 . _:genid10038 . _:genid10038 . _:genid10039 . _:genid10036 _:genid10037 . _:genid10036 . . . "IEA"^^ . "A type of protein localization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007807"^^ . "protein localization evidence used in automatic assertion"^^ . _:genid10040 . _:genid10040 . _:genid10040 . _:genid10040 . _:genid10040 "true"^^ . _:genid10041 . _:genid10041 . _:genid10041 . _:genid10041 . _:genid10041 "true"^^ . . _:genid10042 . _:genid10043 . _:genid10045 _:genid10044 . _:genid10043 _:genid10045 . _:genid10044 . _:genid10044 . _:genid10044 . _:genid10045 . _:genid10042 _:genid10043 . _:genid10042 . . . "IEA"^^ . "A type of fusion protein localization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007808"^^ . "fusion protein localization evidence used in automatic assertion"^^ . _:genid10046 . _:genid10046 . _:genid10046 . _:genid10046 . _:genid10046 "true"^^ . _:genid10047 . _:genid10047 . _:genid10047 . _:genid10047 . _:genid10047 "true"^^ . . _:genid10048 . _:genid10049 . _:genid10051 _:genid10050 . _:genid10049 _:genid10051 . _:genid10050 . _:genid10050 . _:genid10050 . _:genid10051 . _:genid10048 _:genid10049 . _:genid10048 . . . "IEA"^^ . "A type of nucleic acid localization evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007809"^^ . "nucleic acid localization evidence used in automatic assertion"^^ . _:genid10052 . _:genid10052 . _:genid10052 . _:genid10052 . _:genid10052 "true"^^ . _:genid10053 . _:genid10053 . _:genid10053 . _:genid10053 . _:genid10053 "true"^^ . . _:genid10054 . _:genid10055 . _:genid10057 _:genid10056 . _:genid10055 _:genid10057 . _:genid10056 . _:genid10056 . _:genid10056 . _:genid10057 . _:genid10054 _:genid10055 . _:genid10054 . . . "IEA"^^ . "A type of anatomical perturbation phenotypic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007810"^^ . "anatomical perturbation phenotypic evidence used in automatic assertion"^^ . _:genid10058 . _:genid10058 . _:genid10058 . _:genid10058 . _:genid10058 "true"^^ . _:genid10059 . _:genid10059 . _:genid10059 . _:genid10059 . _:genid10059 "true"^^ . . _:genid10060 . _:genid10061 . _:genid10063 _:genid10062 . _:genid10061 _:genid10063 . _:genid10062 . _:genid10062 . _:genid10062 . _:genid10063 . _:genid10060 _:genid10061 . _:genid10060 . . . "IEA"^^ . "A type of cleavage arrested development evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007811"^^ . "cleavage arrested development evidence used in automatic assertion"^^ . _:genid10064 . _:genid10064 . _:genid10064 . _:genid10064 . _:genid10064 "true"^^ . _:genid10065 . _:genid10065 . _:genid10065 . _:genid10065 . _:genid10065 "true"^^ . . _:genid10066 . _:genid10067 . _:genid10069 _:genid10068 . _:genid10067 _:genid10069 . _:genid10068 . _:genid10068 . _:genid10068 . _:genid10069 . _:genid10066 _:genid10067 . _:genid10066 . . . "IEA"^^ . "A type of sequencing assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007812"^^ . "sequencing assay evidence used in automatic assertion"^^ . _:genid10070 . _:genid10070 . _:genid10070 . _:genid10070 . _:genid10070 "true"^^ . _:genid10071 . _:genid10071 . _:genid10071 . _:genid10071 . _:genid10071 "true"^^ . . _:genid10072 . _:genid10073 . _:genid10075 _:genid10074 . _:genid10073 _:genid10075 . _:genid10074 . _:genid10074 . _:genid10074 . _:genid10075 . _:genid10072 _:genid10073 . _:genid10072 . . . "IEA"^^ . "A type of nucleotide sequencing assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007813"^^ . "nucleotide sequencing assay evidence used in automatic assertion"^^ . _:genid10076 . _:genid10076 . _:genid10076 . _:genid10076 . _:genid10076 "true"^^ . _:genid10077 . _:genid10077 . _:genid10077 . _:genid10077 . _:genid10077 "true"^^ . . _:genid10078 . _:genid10079 . _:genid10081 _:genid10080 . _:genid10079 _:genid10081 . _:genid10080 . _:genid10080 . _:genid10080 . _:genid10081 . _:genid10078 _:genid10079 . _:genid10078 . . . "IEA"^^ . "A type of high throughput nucleotide sequencing assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007814"^^ . "high throughput nucleotide sequencing assay evidence used in automatic assertion"^^ . _:genid10082 . _:genid10082 . _:genid10082 . _:genid10082 . _:genid10082 "true"^^ . _:genid10083 . _:genid10083 . _:genid10083 . _:genid10083 . _:genid10083 "true"^^ . . _:genid10084 . _:genid10085 . _:genid10087 _:genid10086 . _:genid10085 _:genid10087 . _:genid10086 . _:genid10086 . _:genid10086 . _:genid10087 . _:genid10084 _:genid10085 . _:genid10084 . . . "IEA"^^ . "A type of structure determination evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007815"^^ . "structure determination evidence used in automatic assertion"^^ . _:genid10088 . _:genid10088 . _:genid10088 . _:genid10088 . _:genid10088 "true"^^ . _:genid10089 . _:genid10089 . _:genid10089 . _:genid10089 . _:genid10089 "true"^^ . . _:genid10090 . _:genid10091 . _:genid10093 _:genid10092 . _:genid10091 _:genid10093 . _:genid10092 . _:genid10092 . _:genid10092 . _:genid10093 . _:genid10090 _:genid10091 . _:genid10090 . . . "IEA"^^ . "A type of molecule detection assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007816"^^ . "molecule detection assay evidence used in automatic assertion"^^ . _:genid10094 . _:genid10094 . _:genid10094 . _:genid10094 . _:genid10094 "true"^^ . _:genid10095 . _:genid10095 . _:genid10095 . _:genid10095 . _:genid10095 "true"^^ . . _:genid10096 . _:genid10097 . _:genid10099 _:genid10098 . _:genid10097 _:genid10099 . _:genid10098 . _:genid10098 . _:genid10098 . _:genid10099 . _:genid10096 _:genid10097 . _:genid10096 . . . "IEA"^^ . "A type of DNA detection assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007817"^^ . "DNA detection assay evidence used in automatic assertion"^^ . _:genid10100 . _:genid10100 . _:genid10100 . _:genid10100 . _:genid10100 "true"^^ . _:genid10101 . _:genid10101 . _:genid10101 . _:genid10101 . _:genid10101 "true"^^ . . _:genid10102 . _:genid10103 . _:genid10105 _:genid10104 . _:genid10103 _:genid10105 . _:genid10104 . _:genid10104 . _:genid10104 . _:genid10105 . _:genid10102 _:genid10103 . _:genid10102 . . . "IEA"^^ . "A type of RNA detection assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007818"^^ . "RNA detection assay evidence used in automatic assertion"^^ . _:genid10106 . _:genid10106 . _:genid10106 . _:genid10106 . _:genid10106 "true"^^ . _:genid10107 . _:genid10107 . _:genid10107 . _:genid10107 . _:genid10107 "true"^^ . . _:genid10108 . _:genid10109 . _:genid10111 _:genid10110 . _:genid10109 _:genid10111 . _:genid10110 . _:genid10110 . _:genid10110 . _:genid10111 . _:genid10108 _:genid10109 . _:genid10108 . . . "IEA"^^ . "A type of protein detection assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007819"^^ . "protein detection assay evidence used in automatic assertion"^^ . _:genid10112 . _:genid10112 . _:genid10112 . _:genid10112 . _:genid10112 "true"^^ . _:genid10113 . _:genid10113 . _:genid10113 . _:genid10113 . _:genid10113 "true"^^ . . _:genid10114 . _:genid10115 . _:genid10117 _:genid10116 . _:genid10115 _:genid10117 . _:genid10116 . _:genid10116 . _:genid10116 . _:genid10117 . _:genid10114 _:genid10115 . _:genid10114 . . . "IEA"^^ . "A type of small molecule detection assay evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007820"^^ . "small molecule detection assay evidence used in automatic assertion"^^ . _:genid10118 . _:genid10118 . _:genid10118 . _:genid10118 . _:genid10118 "true"^^ . _:genid10119 . _:genid10119 . _:genid10119 . _:genid10119 . _:genid10119 "true"^^ . . _:genid10120 . _:genid10121 . _:genid10123 _:genid10122 . _:genid10121 _:genid10123 . _:genid10122 . _:genid10122 . _:genid10122 . _:genid10123 . _:genid10120 _:genid10121 . _:genid10120 . . . "IEA"^^ . "A type of spectrometry evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007821"^^ . "spectrometry evidence used in automatic assertion"^^ . _:genid10124 . _:genid10124 . _:genid10124 . _:genid10124 . _:genid10124 "true"^^ . _:genid10125 . _:genid10125 . _:genid10125 . _:genid10125 . _:genid10125 "true"^^ . . _:genid10126 . _:genid10127 . _:genid10129 _:genid10128 . _:genid10127 _:genid10129 . _:genid10128 . _:genid10128 . _:genid10128 . _:genid10129 . _:genid10126 _:genid10127 . _:genid10126 . . . "IEA"^^ . "A type of chromosome conformation-based evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007822"^^ . "chromosome conformation-based evidence used in automatic assertion"^^ . _:genid10130 . _:genid10130 . _:genid10130 . _:genid10130 . _:genid10130 "true"^^ . _:genid10131 . _:genid10131 . _:genid10131 . _:genid10131 . _:genid10131 "true"^^ . . _:genid10132 . _:genid10133 . _:genid10135 _:genid10134 . _:genid10133 _:genid10135 . _:genid10134 . _:genid10134 . _:genid10134 . _:genid10135 . _:genid10132 _:genid10133 . _:genid10132 . . . "IEA"^^ . "A type of 3C evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007823"^^ . "3C evidence used in automatic assertion"^^ . _:genid10136 . _:genid10136 . _:genid10136 . _:genid10136 . _:genid10136 "true"^^ . _:genid10137 . _:genid10137 . _:genid10137 . _:genid10137 . _:genid10137 "true"^^ . . _:genid10138 . _:genid10139 . _:genid10141 _:genid10140 . _:genid10139 _:genid10141 . _:genid10140 . _:genid10140 . _:genid10140 . _:genid10141 . _:genid10138 _:genid10139 . _:genid10138 . . . "IEA"^^ . "A type of phenotypic similarity evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007824"^^ . "phenotypic similarity evidence used in automatic assertion"^^ . _:genid10142 . _:genid10142 . _:genid10142 . _:genid10142 . _:genid10142 "true"^^ . _:genid10143 . _:genid10143 . _:genid10143 . _:genid10143 . _:genid10143 "true"^^ . . _:genid10144 . _:genid10145 . _:genid10147 _:genid10146 . _:genid10145 _:genid10147 . _:genid10146 . _:genid10146 . _:genid10146 . _:genid10147 . _:genid10144 _:genid10145 . _:genid10144 . . . "IEA"^^ . "A type of transcript splice pattern evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007825"^^ . "transcript splice pattern evidence used in automatic assertion"^^ . _:genid10148 . _:genid10148 . _:genid10148 . _:genid10148 . _:genid10148 "true"^^ . _:genid10149 . _:genid10149 . _:genid10149 . _:genid10149 . _:genid10149 "true"^^ . . _:genid10150 . _:genid10151 . _:genid10153 _:genid10152 . _:genid10151 _:genid10153 . _:genid10152 . _:genid10152 . _:genid10152 . _:genid10153 . _:genid10150 _:genid10151 . _:genid10150 . . . "IEA"^^ . "A type of phylogenetic evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007826"^^ . "phylogenetic evidence used in automatic assertion"^^ . _:genid10154 . _:genid10154 . _:genid10154 . _:genid10154 . _:genid10154 "true"^^ . _:genid10155 . _:genid10155 . _:genid10155 . _:genid10155 . _:genid10155 "true"^^ . . _:genid10156 . _:genid10157 . _:genid10159 _:genid10158 . _:genid10157 _:genid10159 . _:genid10158 . _:genid10158 . _:genid10158 . _:genid10159 . _:genid10156 _:genid10157 . _:genid10156 . . . "IEA"^^ . "A type of biological system reconstruction evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007827"^^ . "biological system reconstruction evidence used in automatic assertion"^^ . _:genid10160 . _:genid10160 . _:genid10160 . _:genid10160 . _:genid10160 "true"^^ . _:genid10161 . _:genid10161 . _:genid10161 . _:genid10161 . _:genid10161 "true"^^ . . _:genid10162 . _:genid10163 . _:genid10165 _:genid10164 . _:genid10163 _:genid10165 . _:genid10164 . _:genid10164 . _:genid10164 . _:genid10165 . _:genid10162 _:genid10163 . _:genid10162 . . . "IEA"^^ . "A type of biological system reconstruction evidence by experimental evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007828"^^ . "biological system reconstruction evidence by experimental evidence used in automatic assertion"^^ . _:genid10166 . _:genid10166 . _:genid10166 . _:genid10166 . _:genid10166 "true"^^ . _:genid10167 . _:genid10167 . _:genid10167 . _:genid10167 . _:genid10167 "true"^^ . . _:genid10168 . _:genid10169 . _:genid10171 _:genid10170 . _:genid10169 _:genid10171 . _:genid10170 . _:genid10170 . _:genid10170 . _:genid10171 . _:genid10168 _:genid10169 . _:genid10168 . . . "IEA"^^ . "A type of combinatorial computational and experimental evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007829"^^ . "combinatorial computational and experimental evidence used in automatic assertion"^^ . _:genid10172 . _:genid10172 . _:genid10172 . _:genid10172 . _:genid10172 "true"^^ . _:genid10173 . _:genid10173 . _:genid10173 . _:genid10173 . _:genid10173 "true"^^ . . _:genid10174 . _:genid10175 . _:genid10177 _:genid10176 . _:genid10175 _:genid10177 . _:genid10176 . _:genid10176 . _:genid10176 . _:genid10177 . _:genid10174 _:genid10175 . _:genid10174 . . . "IEA"^^ . "A type of combinatorial experimental evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007830"^^ . "combinatorial experimental evidence used in automatic assertion"^^ . _:genid10178 . _:genid10178 . _:genid10178 . _:genid10178 . _:genid10178 "true"^^ . _:genid10179 . _:genid10179 . _:genid10179 . _:genid10179 . _:genid10179 "true"^^ . . _:genid10180 . _:genid10181 . _:genid10183 _:genid10182 . _:genid10181 _:genid10183 . _:genid10182 . _:genid10182 . _:genid10182 . _:genid10183 . _:genid10180 _:genid10181 . _:genid10180 . . . "IEA"^^ . "A type of inferential evidence that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007832"^^ . "inferential evidence used in automatic assertion"^^ . _:genid10184 . _:genid10184 . _:genid10184 . _:genid10184 . _:genid10184 "true"^^ . _:genid10185 . _:genid10185 . _:genid10185 . _:genid10185 . _:genid10185 "true"^^ . . _:genid10186 . _:genid10187 . _:genid10189 _:genid10188 . _:genid10187 _:genid10189 . _:genid10188 . _:genid10188 . _:genid10188 . _:genid10189 . _:genid10186 _:genid10187 . _:genid10186 . . . "IEA"^^ . "A type of curator inference from authoritative source that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007833"^^ . "curator inference from authoritative source used in automatic assertion"^^ . _:genid10190 . _:genid10190 . _:genid10190 . _:genid10190 . _:genid10190 "true"^^ . _:genid10191 . _:genid10191 . _:genid10191 . _:genid10191 . _:genid10191 "true"^^ . . _:genid10192 . _:genid10193 . _:genid10195 _:genid10194 . _:genid10193 _:genid10195 . _:genid10194 . _:genid10194 . _:genid10194 . _:genid10195 . _:genid10192 _:genid10193 . _:genid10192 . . . "IEA"^^ . "A type of curator inference from encyclopedia that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007834"^^ . "curator inference from encyclopedia used in automatic assertion"^^ . _:genid10196 . _:genid10196 . _:genid10196 . _:genid10196 . _:genid10196 "true"^^ . _:genid10197 . _:genid10197 . _:genid10197 . _:genid10197 . _:genid10197 "true"^^ . . _:genid10198 . _:genid10199 . _:genid10201 _:genid10200 . _:genid10199 _:genid10201 . _:genid10200 . _:genid10200 . _:genid10200 . _:genid10201 . _:genid10198 _:genid10199 . _:genid10198 . . . "IEA"^^ . "A type of curator inference from Wikipedia that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007835"^^ . "curator inference from Wikipedia used in automatic assertion"^^ . _:genid10202 . _:genid10202 . _:genid10202 . _:genid10202 . _:genid10202 "true"^^ . _:genid10203 . _:genid10203 . _:genid10203 . _:genid10203 . _:genid10203 "true"^^ . . _:genid10204 . _:genid10205 . _:genid10207 _:genid10206 . _:genid10205 _:genid10207 . _:genid10206 . _:genid10206 . _:genid10206 . _:genid10207 . _:genid10204 _:genid10205 . _:genid10204 . . . "IEA"^^ . "A type of curator inference from Britannica that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007836"^^ . "curator inference from Britannica used in automatic assertion"^^ . _:genid10208 . _:genid10208 . _:genid10208 . _:genid10208 . _:genid10208 "true"^^ . _:genid10209 . _:genid10209 . _:genid10209 . _:genid10209 . _:genid10209 "true"^^ . . _:genid10210 . _:genid10211 . _:genid10213 _:genid10212 . _:genid10211 _:genid10213 . _:genid10212 . _:genid10212 . _:genid10212 . _:genid10213 . _:genid10210 _:genid10211 . _:genid10210 . . . "IEA"^^ . "A type of curator inference from MedlinePlus encyclopedia that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007837"^^ . "curator inference from MedlinePlus encyclopedia used in automatic assertion"^^ . _:genid10214 . _:genid10214 . _:genid10214 . _:genid10214 . _:genid10214 "true"^^ . _:genid10215 . _:genid10215 . _:genid10215 . _:genid10215 . _:genid10215 "true"^^ . . _:genid10216 . _:genid10217 . _:genid10219 _:genid10218 . _:genid10217 _:genid10219 . _:genid10218 . _:genid10218 . _:genid10218 . _:genid10219 . _:genid10216 _:genid10217 . _:genid10216 . . . "IEA"^^ . "A type of curator inference from book that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007838"^^ . "curator inference from book used in automatic assertion"^^ . _:genid10220 . _:genid10220 . _:genid10220 . _:genid10220 . _:genid10220 "true"^^ . _:genid10221 . _:genid10221 . _:genid10221 . _:genid10221 . _:genid10221 "true"^^ . . _:genid10222 . _:genid10223 . _:genid10225 _:genid10224 . _:genid10223 _:genid10225 . _:genid10224 . _:genid10224 . _:genid10224 . _:genid10225 . _:genid10222 _:genid10223 . _:genid10222 . . . "IEA"^^ . "A type of curator inference from dictionary that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007839"^^ . "curator inference from dictionary used in automatic assertion"^^ . _:genid10226 . _:genid10226 . _:genid10226 . _:genid10226 . _:genid10226 "true"^^ . _:genid10227 . _:genid10227 . _:genid10227 . _:genid10227 . _:genid10227 "true"^^ . . _:genid10228 . _:genid10229 . _:genid10231 _:genid10230 . _:genid10229 _:genid10231 . _:genid10230 . _:genid10230 . _:genid10230 . _:genid10231 . _:genid10228 _:genid10229 . _:genid10228 . . . "IEA"^^ . "A type of curator inference from MedlinePlus dictionary that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007840"^^ . "curator inference from MedlinePlus dictionary used in automatic assertion"^^ . _:genid10232 . _:genid10232 . _:genid10232 . _:genid10232 . _:genid10232 "true"^^ . _:genid10233 . _:genid10233 . _:genid10233 . _:genid10233 . _:genid10233 "true"^^ . . _:genid10234 . _:genid10235 . _:genid10237 _:genid10236 . _:genid10235 _:genid10237 . _:genid10236 . _:genid10236 . _:genid10236 . _:genid10237 . _:genid10234 _:genid10235 . _:genid10234 . . . "IEA"^^ . "A type of curator inference from Merriam-Webster Dictionary that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007841"^^ . "curator inference from Merriam-Webster Dictionary used in automatic assertion"^^ . _:genid10238 . _:genid10238 . _:genid10238 . _:genid10238 . _:genid10238 "true"^^ . _:genid10239 . _:genid10239 . _:genid10239 . _:genid10239 . _:genid10239 "true"^^ . . _:genid10240 . _:genid10241 . _:genid10243 _:genid10242 . _:genid10241 _:genid10243 . _:genid10242 . _:genid10242 . _:genid10242 . _:genid10243 . _:genid10240 _:genid10241 . _:genid10240 . . . "IEA"^^ . "A type of curator inference from Oxford Dictionary that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007842"^^ . "curator inference from Oxford Dictionary used in automatic assertion"^^ . _:genid10244 . _:genid10244 . _:genid10244 . _:genid10244 . _:genid10244 "true"^^ . _:genid10245 . _:genid10245 . _:genid10245 . _:genid10245 . _:genid10245 "true"^^ . . _:genid10246 . _:genid10247 . _:genid10249 _:genid10248 . _:genid10247 _:genid10249 . _:genid10248 . _:genid10248 . _:genid10248 . _:genid10249 . _:genid10246 _:genid10247 . _:genid10246 . . . "IEA"^^ . "A type of curator inference from journal publication that is used in an automatic assertion."^^ . "rctauber"^^ . "2019-03-20T13:02:00Z"^^ . "eco"^^ . "ECO:0007843"^^ . "curator inference from journal publication used in automatic assertion"^^ . _:genid10250 . _:genid10250 . _:genid10250 . _:genid10250 . _:genid10250 "true"^^ . _:genid10251 . _:genid10251 . _:genid10251 . _:genid10251 . _:genid10251 "true"^^ . . . "A type of radioisotope assay evidence in which radioisotopic labeling is used to quantify a substance after a biochemical process or extraction from a biological sample."^^ . "dosumis"^^ . "rcjackson"^^ . "2019-06-12T10:46:00Z"^^ . "eco"^^ . "ECO:0007844"^^ . "radioisotope quantification assay evidence"^^ . . _:genid10252 . _:genid10253 . _:genid10255 _:genid10254 . _:genid10253 _:genid10255 . _:genid10254 . _:genid10254 . _:genid10254 . _:genid10255 . _:genid10252 _:genid10253 . _:genid10252 . . . "IEA"^^ . "A type of radioisotope quantification assay evidence that is used in an automatic assertion."^^ . "rcjackson"^^ . "2019-06-12T10:46:00Z"^^ . "eco"^^ . "ECO:0007845"^^ . "radioisotope quantification assay evidence used in automatic assertion"^^ . _:genid10256 . _:genid10256 . _:genid10256 . _:genid10256 . _:genid10256 "true"^^ . . _:genid10257 . _:genid10258 . _:genid10260 _:genid10259 . _:genid10258 _:genid10260 . _:genid10259 . _:genid10259 . _:genid10259 . _:genid10260 . _:genid10257 _:genid10258 . _:genid10257 . . . "IDA"^^ . "A type of radioisotope quantification assay evidence that is used in a manual assertion."^^ . "rcjackson"^^ . "2019-06-12T10:46:00Z"^^ . "eco"^^ . "ECO:0007846"^^ . "radioisotope quantification assay evidence used in manual assertion"^^ . _:genid10261 . _:genid10261 . _:genid10261 . _:genid10261 . _:genid10261 "true"^^ . . . "A type of fluorescence evidence in which fluorescent labeling is used to quantify a substance after a biochemical process or extraction from a biological sample."^^ . "rcjackson"^^ . "2019-06-12T10:46:00Z"^^ . "eco"^^ . "ECO:0007847"^^ . "fluorescence quantification assay evidence"^^ . . _:genid10262 . _:genid10263 . _:genid10265 _:genid10264 . _:genid10263 _:genid10265 . _:genid10264 . _:genid10264 . _:genid10264 . _:genid10265 . _:genid10262 _:genid10263 . _:genid10262 . . . "IEA"^^ . "A type of fluorescence quantification assay evidence that is used in an automatic assertion."^^ . "rcjackson"^^ . "2019-06-12T10:46:00Z"^^ . "eco"^^ . "ECO:0007848"^^ . "fluorescence quantification assay evidence used in automatic assertion"^^ . _:genid10266 . _:genid10266 . _:genid10266 . _:genid10266 . _:genid10266 "true"^^ . . _:genid10267 . _:genid10268 . _:genid10270 _:genid10269 . _:genid10268 _:genid10270 . _:genid10269 . _:genid10269 . _:genid10269 . _:genid10270 . _:genid10267 _:genid10268 . _:genid10267 . . . "IDA"^^ . "A type of fluorescence quantification assay evidence that is used in a manual assertion."^^ . "rcjackson"^^ . "2019-06-12T10:46:00Z"^^ . "eco"^^ . "ECO:0007849"^^ . "fluorescence quantification assay evidence used in manual assertion"^^ . _:genid10271 . _:genid10271 . _:genid10271 . _:genid10271 . _:genid10271 "true"^^ . . . "A type of inferential evidence in which sequence features are inferred based on visual inspection of the sequence." . "beckyjackson" . "2019-11-22T06:51:00Z" . "eco" . "ECO:0007850" . "This type of inference may be made by either a curator or an author." . "inference of sequence features from visual inspection"^^ . _:genid10272 . _:genid10272 . _:genid10272 . _:genid10272 "A type of inferential evidence in which sequence features are inferred based on visual inspection of the sequence." . _:genid10272 "ECO:RCJ"^^ . . . . _:genid10273 . _:genid10273 . _:genid10273 . _:genid10273 . "GO:0000737"^^ . "DNA catabolic process, endonucleolytic"^^ . . . "The ordered and organized complex of DNA, protein, and sometimes RNA, that forms the chromosome."^^ . "chromatin"^^ . . . . "Interacting selectively and non-covalently with the regulatory region composed of the transcription start site and binding sites for the basal transcription machinery. Binding may occur as a sequence specific interaction or as an interaction observed only once a factor has been recruited to the DNA by other factors."^^ . "GO:0001047"^^ . "core promoter binding"^^ . . . "GO:0001067"^^ . "regulatory region nucleic acid binding"^^ . . . "The cellular synthesis of RNA on a template of RNA."^^ . "transcription, RNA-templated"^^ . . . "A process in which membrane potential cycles through a depolarizing spike, triggered in response to depolarization above some threshold, followed by repolarization. This cycle is driven by the flow of ions through various voltage gated channels with different thresholds and ion specificities."^^ . "GO:0001508"^^ . "action potential"^^ . . _:genid10274 . _:genid10275 . _:genid10277 _:genid10276 . _:genid10275 _:genid10277 . _:genid10276 . _:genid10276 . _:genid10276 . _:genid10277 . _:genid10274 _:genid10275 . _:genid10274 . . . _:genid10278 . _:genid10278 . _:genid10278 . _:genid10278 . "GO:0001558"^^ . "regulation of cell growth"^^ . . . "GO:0001816"^^ . "cytokine production"^^ . . _:genid10279 . _:genid10280 . _:genid10282 _:genid10281 . _:genid10280 _:genid10282 . _:genid10281 . _:genid10281 . _:genid10281 . _:genid10282 . _:genid10279 _:genid10280 . _:genid10279 . . _:genid10283 . _:genid10283 . _:genid10283 . _:genid10283 . "GO:0001817"^^ . "regulation of cytokine production"^^ . . _:genid10284 . _:genid10285 . _:genid10287 _:genid10286 . _:genid10285 _:genid10287 . _:genid10286 . _:genid10286 . _:genid10286 . _:genid10287 . _:genid10284 _:genid10285 . _:genid10284 . . . _:genid10288 . _:genid10288 . _:genid10288 . _:genid10288 . "GO:0001818"^^ . "negative regulation of cytokine production"^^ . . _:genid10289 . _:genid10290 . _:genid10292 _:genid10291 . _:genid10290 _:genid10292 . _:genid10291 . _:genid10291 . _:genid10291 . _:genid10292 . _:genid10289 _:genid10290 . _:genid10289 . . . _:genid10293 . _:genid10293 . _:genid10293 . _:genid10293 . "GO:0001819"^^ . "positive regulation of cytokine production"^^ . . . . . . "GO:0001882"^^ . "nucleoside binding"^^ . . . "Any process in an organism that results in the killing of its own cells or those of another organism, including in some cases the death of the other organism. Killing here refers to the induction of death in one cell by another cell, not cell-autonomous death due to internal or other environmental conditions."^^ . "GO:0001906"^^ . "cell killing"^^ . . . . "GO:0002790"^^ . "peptide secretion"^^ . . _:genid10294 . _:genid10295 . _:genid10297 _:genid10296 . _:genid10295 _:genid10297 . _:genid10296 . _:genid10296 . _:genid10296 . _:genid10297 . _:genid10294 _:genid10295 . _:genid10294 . . . _:genid10298 . _:genid10298 . _:genid10298 . _:genid10298 . "GO:0002791"^^ . "regulation of peptide secretion"^^ . . _:genid10299 . _:genid10300 . _:genid10302 _:genid10301 . _:genid10300 _:genid10302 . _:genid10301 . _:genid10301 . _:genid10301 . _:genid10302 . _:genid10299 _:genid10300 . _:genid10299 . . . _:genid10303 . _:genid10303 . _:genid10303 . _:genid10303 . "GO:0002792"^^ . "negative regulation of peptide secretion"^^ . . _:genid10304 . _:genid10305 . _:genid10307 _:genid10306 . _:genid10305 _:genid10307 . _:genid10306 . _:genid10306 . _:genid10306 . _:genid10307 . _:genid10304 _:genid10305 . _:genid10304 . . . _:genid10308 . _:genid10308 . _:genid10308 . _:genid10308 . "GO:0002793"^^ . "positive regulation of peptide secretion"^^ . . _:genid10309 . _:genid10310 . _:genid10312 _:genid10311 . _:genid10310 _:genid10312 . _:genid10311 . _:genid10311 . _:genid10311 . _:genid10312 . _:genid10309 _:genid10310 . _:genid10309 . . _:genid10313 . _:genid10313 . _:genid10313 . _:genid10313 . "GO:0002831"^^ . "regulation of response to biotic stimulus"^^ . . _:genid10314 . _:genid10315 . _:genid10317 _:genid10316 . _:genid10315 _:genid10317 . _:genid10316 . _:genid10316 . _:genid10316 . _:genid10317 . _:genid10314 _:genid10315 . _:genid10314 . . . _:genid10318 . _:genid10318 . _:genid10318 . _:genid10318 . "GO:0002832"^^ . "negative regulation of response to biotic stimulus"^^ . . _:genid10319 . _:genid10320 . _:genid10322 _:genid10321 . _:genid10320 _:genid10322 . _:genid10321 . _:genid10321 . _:genid10321 . _:genid10322 . _:genid10319 _:genid10320 . _:genid10319 . . . _:genid10323 . _:genid10323 . _:genid10323 . _:genid10323 . "GO:0002833"^^ . "positive regulation of response to biotic stimulus"^^ . . . "A molecular process that can be carried out by the action of a single macromolecular machine, usually via direct physical interactions with other molecular entities. Function in this sense denotes an action, or activity, that a gene product (or a complex) performs. These actions are described from two distinct but related perspectives: (1) biochemical activity, and (2) role as a component in a larger system/process."^^ . "GO:0003674"^^ . "GO:molecular_function"^^ . "molecular_function"^^ . . . . "GO:0003676"^^ . "nucleic acid binding"^^ . . . "GO:0003677"^^ . "DNA binding"^^ . . . "GO:0003823"^^ . "antigen binding"^^ . . . "Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic."^^ . "GO:0003824"^^ . "catalytic activity"^^ . . . "Catalysis of the reaction: deoxynucleoside triphosphate + DNA(n) = diphosphate + DNA(n+1). Catalyzes RNA-template-directed extension of the 3'- end of a DNA strand by one deoxynucleotide at a time."^^ . "RNA-directed DNA polymerase activity"^^ . . . _:genid10324 . _:genid10324 . _:genid10324 . _:genid10324 . "GO:0004518"^^ . "nuclease activity"^^ . . . "GO:0004519"^^ . "endonuclease activity"^^ . . . . "GO:0004520"^^ . "endodeoxyribonuclease activity"^^ . . . . _:genid10325 . _:genid10325 . _:genid10325 . _:genid10325 . "GO:0004536"^^ . "deoxyribonuclease activity"^^ . . . "GO:0005215"^^ . "transporter activity"^^ . . . . . . "Enables the facilitated diffusion of an ion (by an energy-independent process) by passage through a transmembrane aqueous pore or channel without evidence for a carrier-mediated mechanism. May be either selective (it enables passage of a specific ion only) or non-selective (it enables passage of two or more ions of same charge but different size)."^^ . "GO:0005216"^^ . "ion channel activity"^^ . . . "GO:0005488"^^ . "binding"^^ . . . "GO:0005515"^^ . "protein binding"^^ . . . "A location, relative to cellular compartments and structures, occupied by a macromolecular machine when it carries out a molecular function. There are two ways in which the gene ontology describes locations of gene products: (1) relative to cellular structures (e.g., cytoplasmic side of plasma membrane) or compartments (e.g., mitochondrion), and (2) the stable macromolecular complexes of which they are parts (e.g., the ribosome)."^^ . "GO:0005575"^^ . "cellular_component"^^ . . . "GO:0005622"^^ . "intracellular"^^ . . . "A structure composed of a very long molecule of DNA and associated proteins (e.g. histones) that carries hereditary information."^^ . "chromosome"^^ . . . . . . . "GO:0006139"^^ . "nucleobase-containing compound metabolic process"^^ . . . . "GO:0006259"^^ . "DNA metabolic process"^^ . . . _:genid10326 . _:genid10326 . _:genid10326 . _:genid10326 . "GO:0006260"^^ . "DNA replication"^^ . . _:genid10327 . _:genid10328 . _:genid10330 _:genid10329 . _:genid10328 _:genid10330 . _:genid10329 . _:genid10329 . _:genid10329 . _:genid10330 . _:genid10327 _:genid10328 . _:genid10327 . . _:genid10331 . _:genid10331 . _:genid10331 . _:genid10331 . "GO:0006275"^^ . "regulation of DNA replication"^^ . . . "GO:0006276"^^ . "plasmid maintenance"^^ . . . . "GO:0006304"^^ . "DNA modification"^^ . . . "GO:0006305"^^ . "DNA alkylation"^^ . . . . . "The covalent transfer of a methyl group to either N-6 of adenine or C-5 or N-4 of cytosine."^^ . "GO:0006306"^^ . "DNA methylation"^^ . . . . . _:genid10332 . _:genid10332 . _:genid10332 . _:genid10332 . "GO:0006308"^^ . "DNA catabolic process"^^ . . _:genid10333 . _:genid10334 . _:genid10336 _:genid10335 . _:genid10334 _:genid10336 . _:genid10335 . _:genid10335 . _:genid10335 . _:genid10336 . _:genid10333 _:genid10334 . _:genid10333 . . _:genid10337 . _:genid10337 . _:genid10337 . _:genid10337 . "GO:0006309"^^ . "apoptotic DNA fragmentation"^^ . . . . _:genid10338 . _:genid10338 . _:genid10338 . _:genid10338 . "GO:0006351"^^ . "transcription, DNA-templated"^^ . . _:genid10339 . _:genid10340 . _:genid10342 _:genid10341 . _:genid10340 _:genid10342 . _:genid10341 . _:genid10341 . _:genid10341 . _:genid10342 . _:genid10339 _:genid10340 . _:genid10339 . . . . _:genid10343 . _:genid10343 . _:genid10343 . _:genid10343 . "GO:0006355"^^ . "regulation of transcription, DNA-templated"^^ . . . . . _:genid10344 . _:genid10344 . _:genid10344 . _:genid10344 . _:genid10345 . _:genid10345 . _:genid10345 . _:genid10345 . "GO:0006412"^^ . "translation"^^ . . . _:genid10346 . _:genid10346 . _:genid10346 . _:genid10346 . "GO:0006414"^^ . "translational elongation"^^ . . _:genid10347 . _:genid10348 . _:genid10350 _:genid10349 . _:genid10348 _:genid10350 . _:genid10349 . _:genid10349 . _:genid10349 . _:genid10350 . _:genid10347 _:genid10348 . _:genid10347 . . . . . _:genid10351 . _:genid10351 . _:genid10351 . _:genid10351 . "GO:0006417"^^ . "regulation of translation"^^ . . _:genid10352 . _:genid10353 . _:genid10355 _:genid10354 . _:genid10353 _:genid10355 . _:genid10354 . _:genid10354 . _:genid10354 . _:genid10355 . _:genid10352 _:genid10353 . _:genid10352 . . _:genid10356 . _:genid10356 . _:genid10356 . _:genid10356 . "GO:0006448"^^ . "regulation of translational elongation"^^ . . . . "GO:0006518"^^ . "peptide metabolic process"^^ . . . "GO:0006725"^^ . "cellular aromatic compound metabolic process"^^ . . . "GO:0006807"^^ . "nitrogen compound metabolic process"^^ . . . "GO:0006810"^^ . "transport"^^ . . . "GO:0006811"^^ . "ion transport"^^ . . . "GO:0006820"^^ . "anion transport"^^ . . . _:genid10357 . _:genid10357 . _:genid10357 . _:genid10357 . "GO:0006869"^^ . "lipid transport"^^ . . . "GO:0006915"^^ . "apoptotic process"^^ . . _:genid10358 . _:genid10359 . _:genid10361 _:genid10360 . _:genid10359 _:genid10361 . _:genid10360 . _:genid10360 . _:genid10360 . _:genid10361 . _:genid10358 _:genid10359 . _:genid10358 . . _:genid10362 . _:genid10362 . _:genid10362 . _:genid10362 . "GO:0006921"^^ . "cellular component disassembly involved in execution phase of apoptosis"^^ . . . "GO:0006928"^^ . "movement of cell or subcellular component"^^ . . . _:genid10363 . _:genid10363 . _:genid10363 . _:genid10363 . "GO:0006935"^^ . "chemotaxis"^^ . . . "GO:0006950"^^ . "response to stress"^^ . . . "Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism."^^ . "GO:0006974"^^ . "cellular response to DNA damage stimulus"^^ . . . "GO:0006996"^^ . "organelle organization"^^ . . . "GO:0006997"^^ . "nucleus organization"^^ . . . "GO:0007000"^^ . "nucleolus organization"^^ . . . "GO:0007568"^^ . "aging"^^ . . . . "GO:0007569"^^ . "cell aging"^^ . . . _:genid10364 . _:genid10364 . _:genid10364 . _:genid10364 . "GO:0007576"^^ . "nucleolar fragmentation"^^ . . . "GO:0008104"^^ . "protein localization"^^ . . . . "A biological process represents a specific objective that the organism is genetically programmed to achieve. Biological processes are often described by their outcome or ending state, e.g., the biological process of cell division results in the creation of two daughter cells (a divided cell) from a single parent cell. A biological process is accomplished by a particular set of molecular functions carried out by specific gene products (or macromolecular complexes), often in a highly regulated manner and in a particular temporal sequence."^^ . "GO:0008150"^^ . "biological_process"^^ . . . "GO:0008152"^^ . "metabolic process"^^ . . _:genid10365 . _:genid10366 . _:genid10368 _:genid10367 . _:genid10366 _:genid10368 . _:genid10367 . _:genid10367 . _:genid10367 . _:genid10368 . _:genid10365 _:genid10366 . _:genid10365 . . . _:genid10369 . _:genid10369 . _:genid10369 . _:genid10369 . "GO:0008156"^^ . "negative regulation of DNA replication"^^ . . . "GO:0008219"^^ . "cell death"^^ . . . "The multiplication or reproduction of cells, resulting in the expansion of a cell population."^^ . "GO:0008283"^^ . "cell population proliferation"^^ . . _:genid10370 . _:genid10371 . _:genid10373 _:genid10372 . _:genid10371 _:genid10373 . _:genid10372 . _:genid10372 . _:genid10372 . _:genid10373 . _:genid10370 _:genid10371 . _:genid10370 . . . _:genid10374 . _:genid10374 . _:genid10374 . _:genid10374 . "GO:0008284"^^ . "positive regulation of cell population proliferation"^^ . . _:genid10375 . _:genid10376 . _:genid10378 _:genid10377 . _:genid10376 _:genid10378 . _:genid10377 . _:genid10377 . _:genid10377 . _:genid10378 . _:genid10375 _:genid10376 . _:genid10375 . . . _:genid10379 . _:genid10379 . _:genid10379 . _:genid10379 . "GO:0008285"^^ . "negative regulation of cell population proliferation"^^ . . . "GO:0008289"^^ . "lipid binding"^^ . . . "GO:0009056"^^ . "catabolic process"^^ . . . . "GO:0009057"^^ . "macromolecule catabolic process"^^ . . . "GO:0009058"^^ . "biosynthetic process"^^ . . . . "GO:0009059"^^ . "macromolecule biosynthetic process"^^ . . . . "GO:0009300"^^ . "antisense RNA transcription"^^ . . . . . . "GO:0009306"^^ . "protein secretion"^^ . . . "GO:0009605"^^ . "response to external stimulus"^^ . . . "GO:0009607"^^ . "response to biotic stimulus"^^ . . . "GO:0009611"^^ . "response to wounding"^^ . . . "GO:0009636"^^ . "response to toxic substance"^^ . . . _:genid10380 . _:genid10380 . _:genid10380 . _:genid10380 . "GO:0009653"^^ . "anatomical structure morphogenesis"^^ . . . "GO:0009719"^^ . "response to endogenous stimulus"^^ . . _:genid10381 . _:genid10382 . _:genid10384 _:genid10383 . _:genid10382 _:genid10384 . _:genid10383 . _:genid10383 . _:genid10383 . _:genid10384 . _:genid10381 _:genid10382 . _:genid10381 . . _:genid10385 . _:genid10385 . _:genid10385 . _:genid10385 . "GO:0009889"^^ . "regulation of biosynthetic process"^^ . . _:genid10386 . _:genid10387 . _:genid10389 _:genid10388 . _:genid10387 _:genid10389 . _:genid10388 . _:genid10388 . _:genid10388 . _:genid10389 . _:genid10386 _:genid10387 . _:genid10386 . . . _:genid10390 . _:genid10390 . _:genid10390 . _:genid10390 . "GO:0009890"^^ . "negative regulation of biosynthetic process"^^ . . _:genid10391 . _:genid10392 . _:genid10394 _:genid10393 . _:genid10392 _:genid10394 . _:genid10393 . _:genid10393 . _:genid10393 . _:genid10394 . _:genid10391 _:genid10392 . _:genid10391 . . . _:genid10395 . _:genid10395 . _:genid10395 . _:genid10395 . "GO:0009891"^^ . "positive regulation of biosynthetic process"^^ . . _:genid10396 . _:genid10397 . _:genid10399 _:genid10398 . _:genid10397 _:genid10399 . _:genid10398 . _:genid10398 . _:genid10398 . _:genid10399 . _:genid10396 _:genid10397 . _:genid10396 . . . _:genid10400 . _:genid10400 . _:genid10400 . _:genid10400 . "GO:0009892"^^ . "negative regulation of metabolic process"^^ . . _:genid10401 . _:genid10402 . _:genid10404 _:genid10403 . _:genid10402 _:genid10404 . _:genid10403 . _:genid10403 . _:genid10403 . _:genid10404 . _:genid10401 _:genid10402 . _:genid10401 . . . _:genid10405 . _:genid10405 . _:genid10405 . _:genid10405 . "GO:0009893"^^ . "positive regulation of metabolic process"^^ . . _:genid10406 . _:genid10407 . _:genid10409 _:genid10408 . _:genid10407 _:genid10409 . _:genid10408 . _:genid10408 . _:genid10408 . _:genid10409 . _:genid10406 _:genid10407 . _:genid10406 . . _:genid10410 . _:genid10410 . _:genid10410 . _:genid10410 . "GO:0009894"^^ . "regulation of catabolic process"^^ . . _:genid10411 . _:genid10412 . _:genid10414 _:genid10413 . _:genid10412 _:genid10414 . _:genid10413 . _:genid10413 . _:genid10413 . _:genid10414 . _:genid10411 _:genid10412 . _:genid10411 . . . _:genid10415 . _:genid10415 . _:genid10415 . _:genid10415 . "GO:0009895"^^ . "negative regulation of catabolic process"^^ . . _:genid10416 . _:genid10417 . _:genid10419 _:genid10418 . _:genid10417 _:genid10419 . _:genid10418 . _:genid10418 . _:genid10418 . _:genid10419 . _:genid10416 _:genid10417 . _:genid10416 . . . _:genid10420 . _:genid10420 . _:genid10420 . _:genid10420 . "GO:0009896"^^ . "positive regulation of catabolic process"^^ . . . "Any process that is carried out at the cellular level, but not necessarily restricted to a single cell. For example, cell communication occurs among more than one cell, but occurs at the cellular level."^^ . "GO:0009987"^^ . "cellular process"^^ . . . "GO:0010033"^^ . "response to organic substance"^^ . . . "GO:0010046"^^ . "response to mycotoxin"^^ . . . . "GO:0010243"^^ . "response to organonitrogen compound"^^ . . . "The process in which a gene's sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form."^^ . "GO:0010467"^^ . "gene expression"^^ . . _:genid10421 . _:genid10422 . _:genid10424 _:genid10423 . _:genid10422 _:genid10424 . _:genid10423 . _:genid10423 . _:genid10423 . _:genid10424 . _:genid10421 _:genid10422 . _:genid10421 . . _:genid10425 . _:genid10425 . _:genid10425 . _:genid10425 . "GO:0010468"^^ . "regulation of gene expression"^^ . . _:genid10426 . _:genid10427 . _:genid10429 _:genid10428 . _:genid10427 _:genid10429 . _:genid10428 . _:genid10428 . _:genid10428 . _:genid10429 . _:genid10426 _:genid10427 . _:genid10426 . . . _:genid10430 . _:genid10430 . _:genid10430 . _:genid10430 . "GO:0010556"^^ . "regulation of macromolecule biosynthetic process"^^ . . _:genid10431 . _:genid10432 . _:genid10434 _:genid10433 . _:genid10432 _:genid10434 . _:genid10433 . _:genid10433 . _:genid10433 . _:genid10434 . _:genid10431 _:genid10432 . _:genid10431 . . . . _:genid10435 . _:genid10435 . _:genid10435 . _:genid10435 . "GO:0010557"^^ . "positive regulation of macromolecule biosynthetic process"^^ . . _:genid10436 . _:genid10437 . _:genid10439 _:genid10438 . _:genid10437 _:genid10439 . _:genid10438 . _:genid10438 . _:genid10438 . _:genid10439 . _:genid10436 _:genid10437 . _:genid10436 . . . . _:genid10440 . _:genid10440 . _:genid10440 . _:genid10440 . "GO:0010558"^^ . "negative regulation of macromolecule biosynthetic process"^^ . . _:genid10441 . _:genid10442 . _:genid10444 _:genid10443 . _:genid10442 _:genid10444 . _:genid10443 . _:genid10443 . _:genid10443 . _:genid10444 . _:genid10441 _:genid10442 . _:genid10441 . . . _:genid10445 . _:genid10445 . _:genid10445 . _:genid10445 . "GO:0010604"^^ . "positive regulation of macromolecule metabolic process"^^ . . _:genid10446 . _:genid10447 . _:genid10449 _:genid10448 . _:genid10447 _:genid10449 . _:genid10448 . _:genid10448 . _:genid10448 . _:genid10449 . _:genid10446 _:genid10447 . _:genid10446 . . . _:genid10450 . _:genid10450 . _:genid10450 . _:genid10450 . "GO:0010605"^^ . "negative regulation of macromolecule metabolic process"^^ . . . "GO:0010608"^^ . "posttranscriptional regulation of gene expression"^^ . . _:genid10451 . _:genid10452 . _:genid10454 _:genid10453 . _:genid10452 _:genid10454 . _:genid10453 . _:genid10453 . _:genid10453 . _:genid10454 . _:genid10451 _:genid10452 . _:genid10451 . . . _:genid10455 . _:genid10455 . _:genid10455 . _:genid10455 . "GO:0010628"^^ . "positive regulation of gene expression"^^ . . _:genid10456 . _:genid10457 . _:genid10459 _:genid10458 . _:genid10457 _:genid10459 . _:genid10458 . _:genid10458 . _:genid10458 . _:genid10459 . _:genid10456 _:genid10457 . _:genid10456 . . . _:genid10460 . _:genid10460 . _:genid10460 . _:genid10460 . "GO:0010629"^^ . "negative regulation of gene expression"^^ . . _:genid10461 . _:genid10462 . _:genid10464 _:genid10463 . _:genid10462 _:genid10464 . _:genid10463 . _:genid10463 . _:genid10463 . _:genid10464 . _:genid10461 _:genid10462 . _:genid10461 . . . _:genid10465 . _:genid10465 . _:genid10465 . _:genid10465 . "GO:0010638"^^ . "positive regulation of organelle organization"^^ . . _:genid10466 . _:genid10467 . _:genid10469 _:genid10468 . _:genid10467 _:genid10469 . _:genid10468 . _:genid10468 . _:genid10468 . _:genid10469 . _:genid10466 _:genid10467 . _:genid10466 . . . _:genid10470 . _:genid10470 . _:genid10470 . _:genid10470 . "GO:0010639"^^ . "negative regulation of organelle organization"^^ . . . "GO:0010876"^^ . "lipid localization"^^ . . _:genid10471 . _:genid10472 . _:genid10474 _:genid10473 . _:genid10472 _:genid10474 . _:genid10473 . _:genid10473 . _:genid10473 . _:genid10474 . _:genid10471 _:genid10472 . _:genid10471 . . . _:genid10475 . _:genid10475 . _:genid10475 . _:genid10475 . "GO:0010927"^^ . "cellular component assembly involved in morphogenesis"^^ . . _:genid10476 . _:genid10477 . _:genid10479 _:genid10478 . _:genid10477 _:genid10479 . _:genid10478 . _:genid10478 . _:genid10478 . _:genid10479 . _:genid10476 _:genid10477 . _:genid10476 . . _:genid10480 . _:genid10480 . _:genid10480 . _:genid10480 . "GO:0010941"^^ . "regulation of cell death"^^ . . _:genid10481 . _:genid10482 . _:genid10484 _:genid10483 . _:genid10482 _:genid10484 . _:genid10483 . _:genid10483 . _:genid10483 . _:genid10484 . _:genid10481 _:genid10482 . _:genid10481 . . . _:genid10485 . _:genid10485 . _:genid10485 . _:genid10485 . "GO:0010942"^^ . "positive regulation of cell death"^^ . . . "GO:0012501"^^ . "programmed cell death"^^ . . . "GO:0014070"^^ . "response to organic cyclic compound"^^ . . . . "GO:0015031"^^ . "protein transport"^^ . . . _:genid10486 . _:genid10486 . _:genid10486 . _:genid10486 . "GO:0015075"^^ . "ion transmembrane transporter activity"^^ . . . "GO:0015267"^^ . "channel activity"^^ . . . "GO:0015318"^^ . "inorganic molecular entity transmembrane transporter activity"^^ . . . . "GO:0015711"^^ . "organic anion transport"^^ . . . "GO:0015718"^^ . "monocarboxylic acid transport"^^ . . . . "GO:0015833"^^ . "peptide transport"^^ . . . "GO:0015849"^^ . "organic acid transport"^^ . . . . "GO:0015908"^^ . "fatty acid transport"^^ . . . "GO:0015909"^^ . "long-chain fatty acid transport"^^ . . . . "GO:0016043"^^ . "cellular component organization"^^ . . . . "GO:0016049"^^ . "cell growth"^^ . . . "GO:0016070"^^ . "RNA metabolic process"^^ . . . "GO:0016246"^^ . "RNA interference"^^ . . . . . "GO:0016441"^^ . "posttranscriptional gene silencing"^^ . . . . "GO:0016458"^^ . "gene silencing"^^ . . . "GO:0016477"^^ . "cell migration"^^ . . . "GO:0016787"^^ . "hydrolase activity"^^ . . . "GO:0016788"^^ . "hydrolase activity, acting on ester bonds"^^ . . _:genid10487 . _:genid10488 . _:genid10490 _:genid10489 . _:genid10488 _:genid10490 . _:genid10489 . _:genid10489 . _:genid10489 . _:genid10490 . _:genid10487 _:genid10488 . _:genid10487 . . . . . . _:genid10491 . _:genid10491 . _:genid10491 . _:genid10491 . "GO:0017148"^^ . "negative regulation of translation"^^ . . . . "GO:0018130"^^ . "heterocycle biosynthetic process"^^ . . _:genid10492 . _:genid10493 . _:genid10495 _:genid10494 . _:genid10493 _:genid10495 . _:genid10494 . _:genid10494 . _:genid10494 . _:genid10495 . _:genid10492 _:genid10493 . _:genid10492 . . . . _:genid10496 . _:genid10496 . _:genid10496 . _:genid10496 . "GO:0019219"^^ . "regulation of nucleobase-containing compound metabolic process"^^ . . _:genid10497 . _:genid10498 . _:genid10500 _:genid10499 . _:genid10498 _:genid10500 . _:genid10499 . _:genid10499 . _:genid10499 . _:genid10500 . _:genid10497 _:genid10498 . _:genid10497 . . _:genid10501 . _:genid10501 . _:genid10501 . _:genid10501 . "GO:0019222"^^ . "regulation of metabolic process"^^ . . . . "GO:0019438"^^ . "aromatic compound biosynthetic process"^^ . . . . "GO:0019439"^^ . "aromatic compound catabolic process"^^ . . . . . "GO:0019538"^^ . "protein metabolic process"^^ . . . "A protein complex that in its canonical form is composed of two identical immunoglobulin heavy chains and two identical immunoglobulin light chains, held together by disulfide bonds and sometimes complexed with additional proteins. An immunoglobulin complex may be embedded in the plasma membrane or present in the extracellular space, in mucosal areas or other tissues, or circulating in the blood or lymph."^^ . "immunoglobulin complex"^^ . . . "An immunoglobulin complex that is present in the plasma membrane of B cells and that in its canonical form is composed of two identical immunoglobulin heavy chains and two identical immunoglobulin light chains and a signaling subunit, a heterodimer of the Ig-alpha and Ig-beta proteins."^^ . "B cell receptor complex"^^ . . . . "Interacting selectively and non-covalently with a specific domain of a protein."^^ . "GO:0019904"^^ . "protein domain specific binding"^^ . . . "GO:0022411"^^ . "cellular component disassembly"^^ . . _:genid10502 . _:genid10503 . _:genid10505 _:genid10504 . _:genid10503 _:genid10505 . _:genid10504 . _:genid10504 . _:genid10504 . _:genid10505 . _:genid10502 _:genid10503 . _:genid10502 . . _:genid10506 . _:genid10506 . _:genid10506 . _:genid10506 . "GO:0022603"^^ . "regulation of anatomical structure morphogenesis"^^ . . . _:genid10507 . _:genid10507 . _:genid10507 . _:genid10507 . "GO:0022607"^^ . "cellular component assembly"^^ . . . "GO:0022803"^^ . "passive transmembrane transporter activity"^^ . . . _:genid10508 . _:genid10508 . _:genid10508 . _:genid10508 . "GO:0022857"^^ . "transmembrane transporter activity"^^ . . _:genid10509 . _:genid10510 . _:genid10512 _:genid10511 . _:genid10510 _:genid10512 . _:genid10511 . _:genid10511 . _:genid10511 . _:genid10512 . _:genid10509 _:genid10510 . _:genid10509 . . . _:genid10513 . _:genid10513 . _:genid10513 . _:genid10513 . "GO:0022898"^^ . "regulation of transmembrane transporter activity"^^ . . . "GO:0030030"^^ . "cell projection organization"^^ . . . . "GO:0030031"^^ . "cell projection assembly"^^ . . . "Assembly of actin filaments by the addition of actin monomers to a filament."^^ . "actin filament polymerization"^^ . . . "The process whose specific outcome is the progression of the myeloid and lymphoid derived organ/tissue systems of the blood and other parts of the body over time, from formation to the mature structure. The site of hemopoiesis is variable during development, but occurs primarily in bone marrow or kidney in many adult vertebrates."^^ . "hemopoiesis"^^ . . . "GO:0030262"^^ . "apoptotic nuclear changes"^^ . . _:genid10514 . _:genid10515 . _:genid10517 _:genid10516 . _:genid10515 _:genid10517 . _:genid10516 . _:genid10516 . _:genid10516 . _:genid10517 . _:genid10514 _:genid10515 . _:genid10514 . . . . _:genid10518 . _:genid10518 . _:genid10518 . _:genid10518 . "GO:0030307"^^ . "positive regulation of cell growth"^^ . . _:genid10519 . _:genid10520 . _:genid10522 _:genid10521 . _:genid10520 _:genid10522 . _:genid10521 . _:genid10521 . _:genid10521 . _:genid10522 . _:genid10519 _:genid10520 . _:genid10519 . . . . _:genid10523 . _:genid10523 . _:genid10523 . _:genid10523 . "GO:0030308"^^ . "negative regulation of cell growth"^^ . . _:genid10524 . _:genid10525 . _:genid10527 _:genid10526 . _:genid10525 _:genid10527 . _:genid10526 . _:genid10526 . _:genid10526 . _:genid10527 . _:genid10524 _:genid10525 . _:genid10524 . . _:genid10528 . _:genid10528 . _:genid10528 . _:genid10528 . "GO:0030334"^^ . "regulation of cell migration"^^ . . _:genid10529 . _:genid10530 . _:genid10532 _:genid10531 . _:genid10530 _:genid10532 . _:genid10531 . _:genid10531 . _:genid10531 . _:genid10532 . _:genid10529 _:genid10530 . _:genid10529 . . . _:genid10533 . _:genid10533 . _:genid10533 . _:genid10533 . "GO:0030335"^^ . "positive regulation of cell migration"^^ . . _:genid10534 . _:genid10535 . _:genid10537 _:genid10536 . _:genid10535 _:genid10537 . _:genid10536 . _:genid10536 . _:genid10536 . _:genid10537 . _:genid10534 _:genid10535 . _:genid10534 . . . _:genid10538 . _:genid10538 . _:genid10538 . _:genid10538 . "GO:0030336"^^ . "negative regulation of cell migration"^^ . . . "GO:0031047"^^ . "gene silencing by RNA"^^ . . _:genid10539 . _:genid10540 . _:genid10542 _:genid10541 . _:genid10540 _:genid10542 . _:genid10541 . _:genid10541 . _:genid10541 . _:genid10542 . _:genid10539 _:genid10540 . _:genid10539 . . . _:genid10543 . _:genid10543 . _:genid10543 . _:genid10543 . "GO:0031323"^^ . "regulation of cellular metabolic process"^^ . . _:genid10544 . _:genid10545 . _:genid10547 _:genid10546 . _:genid10545 _:genid10547 . _:genid10546 . _:genid10546 . _:genid10546 . _:genid10547 . _:genid10544 _:genid10545 . _:genid10544 . . . . _:genid10548 . _:genid10548 . _:genid10548 . _:genid10548 . "GO:0031324"^^ . "negative regulation of cellular metabolic process"^^ . . _:genid10549 . _:genid10550 . _:genid10552 _:genid10551 . _:genid10550 _:genid10552 . _:genid10551 . _:genid10551 . _:genid10551 . _:genid10552 . _:genid10549 _:genid10550 . _:genid10549 . . . . _:genid10553 . _:genid10553 . _:genid10553 . _:genid10553 . "GO:0031325"^^ . "positive regulation of cellular metabolic process"^^ . . _:genid10554 . _:genid10555 . _:genid10557 _:genid10556 . _:genid10555 _:genid10557 . _:genid10556 . _:genid10556 . _:genid10556 . _:genid10557 . _:genid10554 _:genid10555 . _:genid10554 . . . _:genid10558 . _:genid10558 . _:genid10558 . _:genid10558 . "GO:0031326"^^ . "regulation of cellular biosynthetic process"^^ . . _:genid10559 . _:genid10560 . _:genid10562 _:genid10561 . _:genid10560 _:genid10562 . _:genid10561 . _:genid10561 . _:genid10561 . _:genid10562 . _:genid10559 _:genid10560 . _:genid10559 . . . . _:genid10563 . _:genid10563 . _:genid10563 . _:genid10563 . "GO:0031327"^^ . "negative regulation of cellular biosynthetic process"^^ . . _:genid10564 . _:genid10565 . _:genid10567 _:genid10566 . _:genid10565 _:genid10567 . _:genid10566 . _:genid10566 . _:genid10566 . _:genid10567 . _:genid10564 _:genid10565 . _:genid10564 . . . . _:genid10568 . _:genid10568 . _:genid10568 . _:genid10568 . "GO:0031328"^^ . "positive regulation of cellular biosynthetic process"^^ . . _:genid10569 . _:genid10570 . _:genid10572 _:genid10571 . _:genid10570 _:genid10572 . _:genid10571 . _:genid10571 . _:genid10571 . _:genid10572 . _:genid10569 _:genid10570 . _:genid10569 . . . _:genid10573 . _:genid10573 . _:genid10573 . _:genid10573 . "GO:0031329"^^ . "regulation of cellular catabolic process"^^ . . _:genid10574 . _:genid10575 . _:genid10577 _:genid10576 . _:genid10575 _:genid10577 . _:genid10576 . _:genid10576 . _:genid10576 . _:genid10577 . _:genid10574 _:genid10575 . _:genid10574 . . . . _:genid10578 . _:genid10578 . _:genid10578 . _:genid10578 . "GO:0031330"^^ . "negative regulation of cellular catabolic process"^^ . . _:genid10579 . _:genid10580 . _:genid10582 _:genid10581 . _:genid10580 _:genid10582 . _:genid10581 . _:genid10581 . _:genid10581 . _:genid10582 . _:genid10579 _:genid10580 . _:genid10579 . . . . _:genid10583 . _:genid10583 . _:genid10583 . _:genid10583 . "GO:0031331"^^ . "positive regulation of cellular catabolic process"^^ . . _:genid10584 . _:genid10585 . _:genid10587 _:genid10586 . _:genid10585 _:genid10587 . _:genid10586 . _:genid10586 . _:genid10586 . _:genid10587 . _:genid10584 _:genid10585 . _:genid10584 . . _:genid10588 . _:genid10588 . _:genid10588 . _:genid10588 . "GO:0031341"^^ . "regulation of cell killing"^^ . . _:genid10589 . _:genid10590 . _:genid10592 _:genid10591 . _:genid10590 _:genid10592 . _:genid10591 . _:genid10591 . _:genid10591 . _:genid10592 . _:genid10589 _:genid10590 . _:genid10589 . . . _:genid10593 . _:genid10593 . _:genid10593 . _:genid10593 . "GO:0031342"^^ . "negative regulation of cell killing"^^ . . _:genid10594 . _:genid10595 . _:genid10597 _:genid10596 . _:genid10595 _:genid10597 . _:genid10596 . _:genid10596 . _:genid10596 . _:genid10597 . _:genid10594 _:genid10595 . _:genid10594 . . . _:genid10598 . _:genid10598 . _:genid10598 . _:genid10598 . "GO:0031343"^^ . "positive regulation of cell killing"^^ . . _:genid10599 . _:genid10600 . _:genid10602 _:genid10601 . _:genid10600 _:genid10602 . _:genid10601 . _:genid10601 . _:genid10601 . _:genid10602 . _:genid10599 _:genid10600 . _:genid10599 . . _:genid10603 . _:genid10603 . _:genid10603 . _:genid10603 . "GO:0031344"^^ . "regulation of cell projection organization"^^ . . _:genid10604 . _:genid10605 . _:genid10607 _:genid10606 . _:genid10605 _:genid10607 . _:genid10606 . _:genid10606 . _:genid10606 . _:genid10607 . _:genid10604 _:genid10605 . _:genid10604 . . . _:genid10608 . _:genid10608 . _:genid10608 . _:genid10608 . "GO:0031345"^^ . "negative regulation of cell projection organization"^^ . . _:genid10609 . _:genid10610 . _:genid10612 _:genid10611 . _:genid10610 _:genid10612 . _:genid10611 . _:genid10611 . _:genid10611 . _:genid10612 . _:genid10609 _:genid10610 . _:genid10609 . . . _:genid10613 . _:genid10613 . _:genid10613 . _:genid10613 . "GO:0031346"^^ . "positive regulation of cell projection organization"^^ . . . "GO:0032060"^^ . "bleb assembly"^^ . . _:genid10614 . _:genid10615 . _:genid10617 _:genid10616 . _:genid10615 _:genid10617 . _:genid10616 . _:genid10616 . _:genid10616 . _:genid10617 . _:genid10614 _:genid10615 . _:genid10614 . . . . _:genid10618 . _:genid10618 . _:genid10618 . _:genid10618 . "GO:0032069"^^ . "regulation of nuclease activity"^^ . . _:genid10619 . _:genid10620 . _:genid10622 _:genid10621 . _:genid10620 _:genid10622 . _:genid10621 . _:genid10621 . _:genid10621 . _:genid10622 . _:genid10619 _:genid10620 . _:genid10619 . . . _:genid10623 . _:genid10623 . _:genid10623 . _:genid10623 . "GO:0032070"^^ . "regulation of deoxyribonuclease activity"^^ . . _:genid10624 . _:genid10625 . _:genid10627 _:genid10626 . _:genid10625 _:genid10627 . _:genid10626 . _:genid10626 . _:genid10626 . _:genid10627 . _:genid10624 _:genid10625 . _:genid10624 . . _:genid10628 . _:genid10628 . _:genid10628 . _:genid10628 . "GO:0032071"^^ . "regulation of endodeoxyribonuclease activity"^^ . . _:genid10629 . _:genid10630 . _:genid10632 _:genid10631 . _:genid10630 _:genid10632 . _:genid10631 . _:genid10631 . _:genid10631 . _:genid10632 . _:genid10629 _:genid10630 . _:genid10629 . . . . . _:genid10633 . _:genid10633 . _:genid10633 . _:genid10633 . "GO:0032074"^^ . "negative regulation of nuclease activity"^^ . . _:genid10634 . _:genid10635 . _:genid10637 _:genid10636 . _:genid10635 _:genid10637 . _:genid10636 . _:genid10636 . _:genid10636 . _:genid10637 . _:genid10634 _:genid10635 . _:genid10634 . . . . . _:genid10638 . _:genid10638 . _:genid10638 . _:genid10638 . "GO:0032075"^^ . "positive regulation of nuclease activity"^^ . . _:genid10639 . _:genid10640 . _:genid10642 _:genid10641 . _:genid10640 _:genid10642 . _:genid10641 . _:genid10641 . _:genid10641 . _:genid10642 . _:genid10639 _:genid10640 . _:genid10639 . . . . _:genid10643 . _:genid10643 . _:genid10643 . _:genid10643 . "GO:0032076"^^ . "negative regulation of deoxyribonuclease activity"^^ . . _:genid10644 . _:genid10645 . _:genid10647 _:genid10646 . _:genid10645 _:genid10647 . _:genid10646 . _:genid10646 . _:genid10646 . _:genid10647 . _:genid10644 _:genid10645 . _:genid10644 . . . . _:genid10648 . _:genid10648 . _:genid10648 . _:genid10648 . "GO:0032077"^^ . "positive regulation of deoxyribonuclease activity"^^ . . _:genid10649 . _:genid10650 . _:genid10652 _:genid10651 . _:genid10650 _:genid10652 . _:genid10651 . _:genid10651 . _:genid10651 . _:genid10652 . _:genid10649 _:genid10650 . _:genid10649 . . . _:genid10653 . _:genid10653 . _:genid10653 . _:genid10653 . "GO:0032078"^^ . "negative regulation of endodeoxyribonuclease activity"^^ . . _:genid10654 . _:genid10655 . _:genid10657 _:genid10656 . _:genid10655 _:genid10657 . _:genid10656 . _:genid10656 . _:genid10656 . _:genid10657 . _:genid10654 _:genid10655 . _:genid10654 . . . _:genid10658 . _:genid10658 . _:genid10658 . _:genid10658 . "GO:0032079"^^ . "positive regulation of endodeoxyribonuclease activity"^^ . . _:genid10659 . _:genid10660 . _:genid10662 _:genid10661 . _:genid10660 _:genid10662 . _:genid10661 . _:genid10661 . _:genid10661 . _:genid10662 . _:genid10659 _:genid10660 . _:genid10659 . . . _:genid10663 . _:genid10663 . _:genid10663 . _:genid10663 . "GO:0032091"^^ . "negative regulation of protein binding"^^ . . _:genid10664 . _:genid10665 . _:genid10667 _:genid10666 . _:genid10665 _:genid10667 . _:genid10666 . _:genid10666 . _:genid10666 . _:genid10667 . _:genid10664 _:genid10665 . _:genid10664 . . . _:genid10668 . _:genid10668 . _:genid10668 . _:genid10668 . "GO:0032092"^^ . "positive regulation of protein binding"^^ . . _:genid10669 . _:genid10670 . _:genid10672 _:genid10671 . _:genid10670 _:genid10672 . _:genid10671 . _:genid10671 . _:genid10671 . _:genid10672 . _:genid10669 _:genid10670 . _:genid10669 . . _:genid10673 . _:genid10673 . _:genid10673 . _:genid10673 . "GO:0032101"^^ . "regulation of response to external stimulus"^^ . . _:genid10674 . _:genid10675 . _:genid10677 _:genid10676 . _:genid10675 _:genid10677 . _:genid10676 . _:genid10676 . _:genid10676 . _:genid10677 . _:genid10674 _:genid10675 . _:genid10674 . . . _:genid10678 . _:genid10678 . _:genid10678 . _:genid10678 . "GO:0032102"^^ . "negative regulation of response to external stimulus"^^ . . _:genid10679 . _:genid10680 . _:genid10682 _:genid10681 . _:genid10680 _:genid10682 . _:genid10681 . _:genid10681 . _:genid10681 . _:genid10682 . _:genid10679 _:genid10680 . _:genid10679 . . . _:genid10683 . _:genid10683 . _:genid10683 . _:genid10683 . "GO:0032103"^^ . "positive regulation of response to external stimulus"^^ . . . "GO:0032259"^^ . "methylation"^^ . . _:genid10684 . _:genid10685 . _:genid10687 _:genid10686 . _:genid10685 _:genid10687 . _:genid10686 . _:genid10686 . _:genid10686 . _:genid10687 . _:genid10684 _:genid10685 . _:genid10684 . . . _:genid10688 . _:genid10688 . _:genid10688 . _:genid10688 . "GO:0032268"^^ . "regulation of cellular protein metabolic process"^^ . . _:genid10689 . _:genid10690 . _:genid10692 _:genid10691 . _:genid10690 _:genid10692 . _:genid10691 . _:genid10691 . _:genid10691 . _:genid10692 . _:genid10689 _:genid10690 . _:genid10689 . . . . _:genid10693 . _:genid10693 . _:genid10693 . _:genid10693 . "GO:0032269"^^ . "negative regulation of cellular protein metabolic process"^^ . . _:genid10694 . _:genid10695 . _:genid10697 _:genid10696 . _:genid10695 _:genid10697 . _:genid10696 . _:genid10696 . _:genid10696 . _:genid10697 . _:genid10694 _:genid10695 . _:genid10694 . . . . _:genid10698 . _:genid10698 . _:genid10698 . _:genid10698 . "GO:0032270"^^ . "positive regulation of cellular protein metabolic process"^^ . . _:genid10699 . _:genid10700 . _:genid10702 _:genid10701 . _:genid10700 _:genid10702 . _:genid10701 . _:genid10701 . _:genid10701 . _:genid10702 . _:genid10699 _:genid10700 . _:genid10699 . . . _:genid10703 . _:genid10703 . _:genid10703 . _:genid10703 . "GO:0032303"^^ . "regulation of icosanoid secretion"^^ . . _:genid10704 . _:genid10705 . _:genid10707 _:genid10706 . _:genid10705 _:genid10707 . _:genid10706 . _:genid10706 . _:genid10706 . _:genid10707 . _:genid10704 _:genid10705 . _:genid10704 . . . . _:genid10708 . _:genid10708 . _:genid10708 . _:genid10708 . "GO:0032304"^^ . "negative regulation of icosanoid secretion"^^ . . _:genid10709 . _:genid10710 . _:genid10712 _:genid10711 . _:genid10710 _:genid10712 . _:genid10711 . _:genid10711 . _:genid10711 . _:genid10712 . _:genid10709 _:genid10710 . _:genid10709 . . . . _:genid10713 . _:genid10713 . _:genid10713 . _:genid10713 . "GO:0032305"^^ . "positive regulation of icosanoid secretion"^^ . . . . "GO:0032309"^^ . "icosanoid secretion"^^ . . _:genid10714 . _:genid10715 . _:genid10717 _:genid10716 . _:genid10715 _:genid10717 . _:genid10716 . _:genid10716 . _:genid10716 . _:genid10717 . _:genid10714 _:genid10715 . _:genid10714 . . . _:genid10718 . _:genid10718 . _:genid10718 . _:genid10718 . "GO:0032368"^^ . "regulation of lipid transport"^^ . . _:genid10719 . _:genid10720 . _:genid10722 _:genid10721 . _:genid10720 _:genid10722 . _:genid10721 . _:genid10721 . _:genid10721 . _:genid10722 . _:genid10719 _:genid10720 . _:genid10719 . . . . _:genid10723 . _:genid10723 . _:genid10723 . _:genid10723 . "GO:0032369"^^ . "negative regulation of lipid transport"^^ . . _:genid10724 . _:genid10725 . _:genid10727 _:genid10726 . _:genid10725 _:genid10727 . _:genid10726 . _:genid10726 . _:genid10726 . _:genid10727 . _:genid10724 _:genid10725 . _:genid10724 . . . . _:genid10728 . _:genid10728 . _:genid10728 . _:genid10728 . "GO:0032370"^^ . "positive regulation of lipid transport"^^ . . _:genid10729 . _:genid10730 . _:genid10732 _:genid10731 . _:genid10730 _:genid10732 . _:genid10731 . _:genid10731 . _:genid10731 . _:genid10732 . _:genid10729 _:genid10730 . _:genid10729 . . _:genid10733 . _:genid10733 . _:genid10733 . _:genid10733 . "GO:0032409"^^ . "regulation of transporter activity"^^ . . _:genid10734 . _:genid10735 . _:genid10737 _:genid10736 . _:genid10735 _:genid10737 . _:genid10736 . _:genid10736 . _:genid10736 . _:genid10737 . _:genid10734 _:genid10735 . _:genid10734 . . . . _:genid10738 . _:genid10738 . _:genid10738 . _:genid10738 . "GO:0032410"^^ . "negative regulation of transporter activity"^^ . . _:genid10739 . _:genid10740 . _:genid10742 _:genid10741 . _:genid10740 _:genid10742 . _:genid10741 . _:genid10741 . _:genid10741 . _:genid10742 . _:genid10739 _:genid10740 . _:genid10739 . . . . _:genid10743 . _:genid10743 . _:genid10743 . _:genid10743 . "GO:0032411"^^ . "positive regulation of transporter activity"^^ . . _:genid10744 . _:genid10745 . _:genid10747 _:genid10746 . _:genid10745 _:genid10747 . _:genid10746 . _:genid10746 . _:genid10746 . _:genid10747 . _:genid10744 _:genid10745 . _:genid10744 . . . _:genid10748 . _:genid10748 . _:genid10748 . _:genid10748 . "GO:0032412"^^ . "regulation of ion transmembrane transporter activity"^^ . . _:genid10749 . _:genid10750 . _:genid10752 _:genid10751 . _:genid10750 _:genid10752 . _:genid10751 . _:genid10751 . _:genid10751 . _:genid10752 . _:genid10749 _:genid10750 . _:genid10749 . . . . _:genid10753 . _:genid10753 . _:genid10753 . _:genid10753 . "GO:0032413"^^ . "negative regulation of ion transmembrane transporter activity"^^ . . _:genid10754 . _:genid10755 . _:genid10757 _:genid10756 . _:genid10755 _:genid10757 . _:genid10756 . _:genid10756 . _:genid10756 . _:genid10757 . _:genid10754 _:genid10755 . _:genid10754 . . . . _:genid10758 . _:genid10758 . _:genid10758 . _:genid10758 . "GO:0032414"^^ . "positive regulation of ion transmembrane transporter activity"^^ . . . "GO:0032501"^^ . "multicellular organismal process"^^ . . . "GO:0032502"^^ . "developmental process"^^ . . . "GO:0032549"^^ . "ribonucleoside binding"^^ . . . "GO:0032640"^^ . "tumor necrosis factor production"^^ . . _:genid10759 . _:genid10760 . _:genid10762 _:genid10761 . _:genid10760 _:genid10762 . _:genid10761 . _:genid10761 . _:genid10761 . _:genid10762 . _:genid10759 _:genid10760 . _:genid10759 . . _:genid10763 . _:genid10763 . _:genid10763 . _:genid10763 . "GO:0032680"^^ . "regulation of tumor necrosis factor production"^^ . . _:genid10764 . _:genid10765 . _:genid10767 _:genid10766 . _:genid10765 _:genid10767 . _:genid10766 . _:genid10766 . _:genid10766 . _:genid10767 . _:genid10764 _:genid10765 . _:genid10764 . . . _:genid10768 . _:genid10768 . _:genid10768 . _:genid10768 . "GO:0032720"^^ . "negative regulation of tumor necrosis factor production"^^ . . _:genid10769 . _:genid10770 . _:genid10772 _:genid10771 . _:genid10770 _:genid10772 . _:genid10771 . _:genid10771 . _:genid10771 . _:genid10772 . _:genid10769 _:genid10770 . _:genid10769 . . . _:genid10773 . _:genid10773 . _:genid10773 . _:genid10773 . "GO:0032760"^^ . "positive regulation of tumor necrosis factor production"^^ . . . . . "GO:0032774"^^ . "RNA biosynthetic process"^^ . . _:genid10774 . _:genid10775 . _:genid10777 _:genid10776 . _:genid10775 _:genid10777 . _:genid10776 . _:genid10776 . _:genid10776 . _:genid10777 . _:genid10774 _:genid10775 . _:genid10774 . . _:genid10778 . _:genid10778 . _:genid10778 . _:genid10778 . "GO:0032879"^^ . "regulation of localization"^^ . . _:genid10779 . _:genid10780 . _:genid10782 _:genid10781 . _:genid10780 _:genid10782 . _:genid10781 . _:genid10781 . _:genid10781 . _:genid10782 . _:genid10779 _:genid10780 . _:genid10779 . . _:genid10783 . _:genid10783 . _:genid10783 . _:genid10783 . "GO:0032880"^^ . "regulation of protein localization"^^ . . _:genid10784 . _:genid10785 . _:genid10787 _:genid10786 . _:genid10785 _:genid10787 . _:genid10786 . _:genid10786 . _:genid10786 . _:genid10787 . _:genid10784 _:genid10785 . _:genid10784 . . _:genid10788 . _:genid10788 . _:genid10788 . _:genid10788 . "GO:0032890"^^ . "regulation of organic acid transport"^^ . . _:genid10789 . _:genid10790 . _:genid10792 _:genid10791 . _:genid10790 _:genid10792 . _:genid10791 . _:genid10791 . _:genid10791 . _:genid10792 . _:genid10789 _:genid10790 . _:genid10789 . . . _:genid10793 . _:genid10793 . _:genid10793 . _:genid10793 . "GO:0032891"^^ . "negative regulation of organic acid transport"^^ . . _:genid10794 . _:genid10795 . _:genid10797 _:genid10796 . _:genid10795 _:genid10797 . _:genid10796 . _:genid10796 . _:genid10796 . _:genid10797 . _:genid10794 _:genid10795 . _:genid10794 . . . _:genid10798 . _:genid10798 . _:genid10798 . _:genid10798 . "GO:0032892"^^ . "positive regulation of organic acid transport"^^ . . . . "GO:0032940"^^ . "secretion by cell"^^ . . . . . "GO:0032989"^^ . "cellular component morphogenesis"^^ . . . _:genid10799 . _:genid10799 . _:genid10799 . _:genid10799 . "A stable assembly of two or more macromolecules, i.e. proteins, nucleic acids, carbohydrates or lipids, in which at least one component is a protein and the constituent parts function together."^^ . "GO:0032991"^^ . "protein-containing complex"^^ . . . "Any process in which a macromolecule is transported to, or maintained in, a specific location."^^ . "GO:0033036"^^ . "macromolecule localization"^^ . . _:genid10800 . _:genid10801 . _:genid10803 _:genid10802 . _:genid10801 _:genid10803 . _:genid10802 . _:genid10802 . _:genid10802 . _:genid10803 . _:genid10800 _:genid10801 . _:genid10800 . . _:genid10804 . _:genid10804 . _:genid10804 . _:genid10804 . "GO:0033043"^^ . "regulation of organelle organization"^^ . . _:genid10805 . _:genid10806 . _:genid10808 _:genid10807 . _:genid10806 _:genid10808 . _:genid10807 . _:genid10807 . _:genid10807 . _:genid10808 . _:genid10805 _:genid10806 . _:genid10805 . . _:genid10809 . _:genid10809 . _:genid10809 . _:genid10809 . "GO:0033044"^^ . "regulation of chromosome organization"^^ . . . "GO:0033218"^^ . "amide binding"^^ . . . . "GO:0033554"^^ . "cellular response to stress"^^ . . . "Catalysis of the reaction: deoxynucleoside triphosphate + DNA(n) = diphosphate + DNA(n+1); the synthesis of DNA from deoxyribonucleotide triphosphates in the presence of a nucleic acid template and a 3'hydroxyl group."^^ . "DNA polymerase activity"^^ . . . . "GO:0034220"^^ . "ion transmembrane transport"^^ . . _:genid10810 . _:genid10811 . _:genid10813 _:genid10812 . _:genid10811 _:genid10813 . _:genid10812 . _:genid10812 . _:genid10812 . _:genid10813 . _:genid10810 _:genid10811 . _:genid10810 . . . _:genid10814 . _:genid10814 . _:genid10814 . _:genid10814 . "GO:0034248"^^ . "regulation of cellular amide metabolic process"^^ . . _:genid10815 . _:genid10816 . _:genid10818 _:genid10817 . _:genid10816 _:genid10818 . _:genid10817 . _:genid10817 . _:genid10817 . _:genid10818 . _:genid10815 _:genid10816 . _:genid10815 . . . . _:genid10819 . _:genid10819 . _:genid10819 . _:genid10819 . "GO:0034249"^^ . "negative regulation of cellular amide metabolic process"^^ . . _:genid10820 . _:genid10821 . _:genid10823 _:genid10822 . _:genid10821 _:genid10823 . _:genid10822 . _:genid10822 . _:genid10822 . _:genid10823 . _:genid10820 _:genid10821 . _:genid10820 . . . . _:genid10824 . _:genid10824 . _:genid10824 . _:genid10824 . "GO:0034250"^^ . "positive regulation of cellular amide metabolic process"^^ . . . . "GO:0034613"^^ . "cellular protein localization"^^ . . . . "GO:0034641"^^ . "cellular nitrogen compound metabolic process"^^ . . . . . "GO:0034645"^^ . "cellular macromolecule biosynthetic process"^^ . . . . . . . "GO:0034654"^^ . "nucleobase-containing compound biosynthetic process"^^ . . . . . . . "GO:0034655"^^ . "nucleobase-containing compound catabolic process"^^ . . . "GO:0034660"^^ . "ncRNA metabolic process"^^ . . . _:genid10825 . _:genid10825 . _:genid10825 . _:genid10825 . "GO:0034708"^^ . "methyltransferase complex"^^ . . _:genid10826 . _:genid10827 . _:genid10829 _:genid10828 . _:genid10827 _:genid10829 . _:genid10828 . _:genid10828 . _:genid10828 . _:genid10829 . _:genid10826 _:genid10827 . _:genid10826 . . _:genid10830 . _:genid10830 . _:genid10830 . _:genid10830 . "GO:0034762"^^ . "regulation of transmembrane transport"^^ . . _:genid10831 . _:genid10832 . _:genid10834 _:genid10833 . _:genid10832 _:genid10834 . _:genid10833 . _:genid10833 . _:genid10833 . _:genid10834 . _:genid10831 _:genid10832 . _:genid10831 . . . _:genid10835 . _:genid10835 . _:genid10835 . _:genid10835 . "GO:0034763"^^ . "negative regulation of transmembrane transport"^^ . . _:genid10836 . _:genid10837 . _:genid10839 _:genid10838 . _:genid10837 _:genid10839 . _:genid10838 . _:genid10838 . _:genid10838 . _:genid10839 . _:genid10836 _:genid10837 . _:genid10836 . . . _:genid10840 . _:genid10840 . _:genid10840 . _:genid10840 . "GO:0034764"^^ . "positive regulation of transmembrane transport"^^ . . _:genid10841 . _:genid10842 . _:genid10844 _:genid10843 . _:genid10842 _:genid10844 . _:genid10843 . _:genid10843 . _:genid10843 . _:genid10844 . _:genid10841 _:genid10842 . _:genid10841 . . . _:genid10845 . _:genid10845 . _:genid10845 . _:genid10845 . "GO:0034765"^^ . "regulation of ion transmembrane transport"^^ . . _:genid10846 . _:genid10847 . _:genid10849 _:genid10848 . _:genid10847 _:genid10849 . _:genid10848 . _:genid10848 . _:genid10848 . _:genid10849 . _:genid10846 _:genid10847 . _:genid10846 . . . . _:genid10850 . _:genid10850 . _:genid10850 . _:genid10850 . "GO:0034766"^^ . "negative regulation of ion transmembrane transport"^^ . . _:genid10851 . _:genid10852 . _:genid10854 _:genid10853 . _:genid10852 _:genid10854 . _:genid10853 . _:genid10853 . _:genid10853 . _:genid10854 . _:genid10851 _:genid10852 . _:genid10851 . . . . _:genid10855 . _:genid10855 . _:genid10855 . _:genid10855 . "GO:0034767"^^ . "positive regulation of ion transmembrane transport"^^ . . . . "GO:0035194"^^ . "posttranscriptional gene silencing by RNA"^^ . . . . "GO:0035592"^^ . "establishment of protein localization to extracellular region"^^ . . . . "GO:0035690"^^ . "cellular response to drug"^^ . . . "GO:0036094"^^ . "small molecule binding"^^ . . . . "GO:0036146"^^ . "cellular response to mycotoxin"^^ . . . "GO:0040007"^^ . "growth"^^ . . _:genid10856 . _:genid10857 . _:genid10859 _:genid10858 . _:genid10857 _:genid10859 . _:genid10858 . _:genid10858 . _:genid10858 . _:genid10859 . _:genid10856 _:genid10857 . _:genid10856 . . _:genid10860 . _:genid10860 . _:genid10860 . _:genid10860 . "GO:0040008"^^ . "regulation of growth"^^ . . . "GO:0040011"^^ . "locomotion"^^ . . _:genid10861 . _:genid10862 . _:genid10864 _:genid10863 . _:genid10862 _:genid10864 . _:genid10863 . _:genid10863 . _:genid10863 . _:genid10864 . _:genid10861 _:genid10862 . _:genid10861 . . _:genid10865 . _:genid10865 . _:genid10865 . _:genid10865 . "GO:0040012"^^ . "regulation of locomotion"^^ . . _:genid10866 . _:genid10867 . _:genid10869 _:genid10868 . _:genid10867 _:genid10869 . _:genid10868 . _:genid10868 . _:genid10868 . _:genid10869 . _:genid10866 _:genid10867 . _:genid10866 . . . _:genid10870 . _:genid10870 . _:genid10870 . _:genid10870 . "GO:0040013"^^ . "negative regulation of locomotion"^^ . . _:genid10871 . _:genid10872 . _:genid10874 _:genid10873 . _:genid10872 _:genid10874 . _:genid10873 . _:genid10873 . _:genid10873 . _:genid10874 . _:genid10871 _:genid10872 . _:genid10871 . . . _:genid10875 . _:genid10875 . _:genid10875 . _:genid10875 . "GO:0040017"^^ . "positive regulation of locomotion"^^ . . . "GO:0040029"^^ . "regulation of gene expression, epigenetic"^^ . . . "Any heritable epigenetic process that modulates the frequency, rate or extent of protein function by self-perpetuating conformational conversions of normal proteins in healthy cells. This is distinct from, though mechanistically analogous to, disease states associated with prion propagation and amyloidogenesis. A single protein, if it carries a glutamine/asparagine-rich ('prion') domain, can sometimes stably exist in at least two distinct physical states, each associated with a different phenotype; propagation of one of these traits is achieved by a self-perpetuating change in the protein from one form to the other, mediated by conformational changes in the glutamine/asparagine-rich domain. Prion domains are both modular and transferable to other proteins, on which they can confer a heritable epigenetic alteration of function; existing bioinformatics data indicate that they are rare in non-eukarya, but common in eukarya."^^ . "regulation of molecular function, epigenetic"^^ . . . . "GO:0040033"^^ . "negative regulation of translation, ncRNA-mediated"^^ . . . "GO:0042060"^^ . "wound healing"^^ . . . "A protein complex that contains a disulfide-linked heterodimer of T cell receptor (TCR) chains, which are members of the immunoglobulin superfamily, and mediates antigen recognition, ultimately resulting in T cell activation. The TCR heterodimer is associated with the CD3 complex, which consists of the nonpolymorphic polypeptides gamma, delta, epsilon, zeta, and, in some cases, eta (an RNA splice variant of zeta) or Fc epsilon chains."^^ . "T cell receptor complex"^^ . . _:genid10876 . _:genid10877 . _:genid10879 _:genid10878 . _:genid10877 _:genid10879 . _:genid10878 . _:genid10878 . _:genid10878 . _:genid10879 . _:genid10876 _:genid10877 . _:genid10876 . . _:genid10880 . _:genid10880 . _:genid10880 . _:genid10880 . "GO:0042127"^^ . "regulation of cell population proliferation"^^ . . . "GO:0042221"^^ . "response to chemical"^^ . . . "GO:0042277"^^ . "peptide binding"^^ . . . _:genid10881 . _:genid10881 . _:genid10881 . _:genid10881 . "GO:0042330"^^ . "taxis"^^ . . . "GO:0042391"^^ . "regulation of membrane potential"^^ . . . "GO:0042493"^^ . "response to drug"^^ . . . . "An immunoglobulin complex that is secreted into extracellular space and found in mucosal areas or other tissues or circulating in the blood or lymph. In its canonical form, a circulating immunoglobulin complex is composed of two identical heavy chains and two identical light chains, held together by disulfide bonds. Some forms of are polymers of the basic structure and contain additional components such as J-chain and the secretory component."^^ . "immunoglobulin complex, circulating"^^ . . . . _:genid10882 . _:genid10882 . _:genid10883 . _:genid10883 . _:genid10883 . _:genid10882 _:genid10883 . _:genid10882 . "A protein complex that possesses DNA polymerase activity and is involved in template directed synthesis of DNA."^^ . "DNA polymerase complex"^^ . . . . "GO:0042605"^^ . "peptide antigen binding"^^ . . . "GO:0042710"^^ . "biofilm formation"^^ . . . "GO:0042868"^^ . "antisense RNA metabolic process"^^ . . . "GO:0042886"^^ . "amide transport"^^ . . _:genid10884 . _:genid10885 . _:genid10887 _:genid10886 . _:genid10885 _:genid10887 . _:genid10886 . _:genid10886 . _:genid10886 . _:genid10887 . _:genid10884 _:genid10885 . _:genid10884 . . _:genid10888 . _:genid10888 . _:genid10888 . _:genid10888 . "GO:0042981"^^ . "regulation of apoptotic process"^^ . . . . . "GO:0043043"^^ . "peptide biosynthetic process"^^ . . _:genid10889 . _:genid10890 . _:genid10892 _:genid10891 . _:genid10890 _:genid10892 . _:genid10891 . _:genid10891 . _:genid10891 . _:genid10892 . _:genid10889 _:genid10890 . _:genid10889 . . . _:genid10893 . _:genid10893 . _:genid10893 . _:genid10893 . "GO:0043065"^^ . "positive regulation of apoptotic process"^^ . . _:genid10894 . _:genid10895 . _:genid10897 _:genid10896 . _:genid10895 _:genid10897 . _:genid10896 . _:genid10896 . _:genid10896 . _:genid10897 . _:genid10894 _:genid10895 . _:genid10894 . . . _:genid10898 . _:genid10898 . _:genid10898 . _:genid10898 . "GO:0043066"^^ . "negative regulation of apoptotic process"^^ . . _:genid10899 . _:genid10900 . _:genid10902 _:genid10901 . _:genid10900 _:genid10902 . _:genid10901 . _:genid10901 . _:genid10901 . _:genid10902 . _:genid10899 _:genid10900 . _:genid10899 . . _:genid10903 . _:genid10903 . _:genid10903 . _:genid10903 . "GO:0043067"^^ . "regulation of programmed cell death"^^ . . _:genid10904 . _:genid10905 . _:genid10907 _:genid10906 . _:genid10905 _:genid10907 . _:genid10906 . _:genid10906 . _:genid10906 . _:genid10907 . _:genid10904 _:genid10905 . _:genid10904 . . . _:genid10908 . _:genid10908 . _:genid10908 . _:genid10908 . "GO:0043068"^^ . "positive regulation of programmed cell death"^^ . . _:genid10909 . _:genid10910 . _:genid10912 _:genid10911 . _:genid10910 _:genid10912 . _:genid10911 . _:genid10911 . _:genid10911 . _:genid10912 . _:genid10909 _:genid10910 . _:genid10909 . . . _:genid10913 . _:genid10913 . _:genid10913 . _:genid10913 . "GO:0043069"^^ . "negative regulation of programmed cell death"^^ . . _:genid10914 . _:genid10915 . _:genid10917 _:genid10916 . _:genid10915 _:genid10917 . _:genid10916 . _:genid10916 . _:genid10916 . _:genid10917 . _:genid10914 _:genid10915 . _:genid10914 . . . _:genid10918 . _:genid10918 . _:genid10918 . _:genid10918 . "GO:0043085"^^ . "positive regulation of catalytic activity"^^ . . _:genid10919 . _:genid10920 . _:genid10922 _:genid10921 . _:genid10920 _:genid10922 . _:genid10921 . _:genid10921 . _:genid10921 . _:genid10922 . _:genid10919 _:genid10920 . _:genid10919 . . . _:genid10923 . _:genid10923 . _:genid10923 . _:genid10923 . "GO:0043086"^^ . "negative regulation of catalytic activity"^^ . . _:genid10924 . _:genid10925 . _:genid10927 _:genid10926 . _:genid10925 _:genid10927 . _:genid10926 . _:genid10926 . _:genid10926 . _:genid10927 . _:genid10924 _:genid10925 . _:genid10924 . . . _:genid10928 . _:genid10928 . _:genid10928 . _:genid10928 . "GO:0043143"^^ . "regulation of translation by machinery localization"^^ . . . "GO:0043170"^^ . "macromolecule metabolic process"^^ . . _:genid10929 . _:genid10930 . _:genid10932 _:genid10931 . _:genid10930 _:genid10932 . _:genid10931 . _:genid10931 . _:genid10931 . _:genid10932 . _:genid10929 _:genid10930 . _:genid10929 . . _:genid10933 . _:genid10933 . _:genid10933 . _:genid10933 . "GO:0043269"^^ . "regulation of ion transport"^^ . . _:genid10934 . _:genid10935 . _:genid10937 _:genid10936 . _:genid10935 _:genid10937 . _:genid10936 . _:genid10936 . _:genid10936 . _:genid10937 . _:genid10934 _:genid10935 . _:genid10934 . . . _:genid10938 . _:genid10938 . _:genid10938 . _:genid10938 . "GO:0043270"^^ . "positive regulation of ion transport"^^ . . _:genid10939 . _:genid10940 . _:genid10942 _:genid10941 . _:genid10940 _:genid10942 . _:genid10941 . _:genid10941 . _:genid10941 . _:genid10942 . _:genid10939 _:genid10940 . _:genid10939 . . . _:genid10943 . _:genid10943 . _:genid10943 . _:genid10943 . "GO:0043271"^^ . "negative regulation of ion transport"^^ . . _:genid10944 . _:genid10945 . _:genid10947 _:genid10946 . _:genid10945 _:genid10947 . _:genid10946 . _:genid10946 . _:genid10946 . _:genid10947 . _:genid10944 _:genid10945 . _:genid10944 . . . _:genid10948 . _:genid10948 . _:genid10948 . _:genid10948 . "GO:0043388"^^ . "positive regulation of DNA binding"^^ . . _:genid10949 . _:genid10950 . _:genid10952 _:genid10951 . _:genid10950 _:genid10952 . _:genid10951 . _:genid10951 . _:genid10951 . _:genid10952 . _:genid10949 _:genid10950 . _:genid10949 . . . _:genid10953 . _:genid10953 . _:genid10953 . _:genid10953 . "GO:0043392"^^ . "negative regulation of DNA binding"^^ . . _:genid10954 . _:genid10955 . _:genid10957 _:genid10956 . _:genid10955 _:genid10957 . _:genid10956 . _:genid10956 . _:genid10956 . _:genid10957 . _:genid10954 _:genid10955 . _:genid10954 . . _:genid10958 . _:genid10958 . _:genid10958 . _:genid10958 . "GO:0043393"^^ . "regulation of protein binding"^^ . . . "GO:0043412"^^ . "macromolecule modification"^^ . . . . . "GO:0043414"^^ . "macromolecule methylation"^^ . . . . "Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding."^^ . "GO:0043565"^^ . "sequence-specific DNA binding"^^ . . . "GO:0043603"^^ . "cellular amide metabolic process"^^ . . . . "GO:0043604"^^ . "amide biosynthetic process"^^ . . _:genid10959 . _:genid10960 . _:genid10962 _:genid10961 . _:genid10960 _:genid10962 . _:genid10961 . _:genid10961 . _:genid10961 . _:genid10962 . _:genid10959 _:genid10960 . _:genid10959 . . _:genid10963 . _:genid10963 . _:genid10963 . _:genid10963 . "GO:0043900"^^ . "regulation of multi-organism process"^^ . . _:genid10964 . _:genid10965 . _:genid10967 _:genid10966 . _:genid10965 _:genid10967 . _:genid10966 . _:genid10966 . _:genid10966 . _:genid10967 . _:genid10964 _:genid10965 . _:genid10964 . . . _:genid10968 . _:genid10968 . _:genid10968 . _:genid10968 . "GO:0043901"^^ . "negative regulation of multi-organism process"^^ . . _:genid10969 . _:genid10970 . _:genid10972 _:genid10971 . _:genid10970 _:genid10972 . _:genid10971 . _:genid10971 . _:genid10971 . _:genid10972 . _:genid10969 _:genid10970 . _:genid10969 . . . _:genid10973 . _:genid10973 . _:genid10973 . _:genid10973 . "GO:0043902"^^ . "positive regulation of multi-organism process"^^ . . _:genid10974 . _:genid10975 . _:genid10977 _:genid10976 . _:genid10975 _:genid10977 . _:genid10976 . _:genid10976 . _:genid10976 . _:genid10977 . _:genid10974 _:genid10975 . _:genid10974 . . . _:genid10978 . _:genid10978 . _:genid10978 . _:genid10978 . "Any process that modulates the frequency, rate or extent of the covalent transfer of a methyl group to either N-6 of adenine or C-5 or N-4 of cytosine."^^ . "GO:0044030"^^ . "regulation of DNA methylation"^^ . . _:genid10979 . _:genid10980 . _:genid10982 _:genid10981 . _:genid10980 _:genid10982 . _:genid10981 . _:genid10981 . _:genid10981 . _:genid10982 . _:genid10979 _:genid10980 . _:genid10979 . . _:genid10983 . _:genid10983 . _:genid10983 . _:genid10983 . "GO:0044070"^^ . "regulation of anion transport"^^ . . . "GO:0044085"^^ . "cellular component biogenesis"^^ . . _:genid10984 . _:genid10985 . _:genid10987 _:genid10986 . _:genid10985 _:genid10987 . _:genid10986 . _:genid10986 . _:genid10986 . _:genid10987 . _:genid10984 _:genid10985 . _:genid10984 . . _:genid10988 . _:genid10988 . _:genid10988 . _:genid10988 . "GO:0044087"^^ . "regulation of cellular component biogenesis"^^ . . _:genid10989 . _:genid10990 . _:genid10992 _:genid10991 . _:genid10990 _:genid10992 . _:genid10991 . _:genid10991 . _:genid10991 . _:genid10992 . _:genid10989 _:genid10990 . _:genid10989 . . . _:genid10993 . _:genid10993 . _:genid10993 . _:genid10993 . "GO:0044089"^^ . "positive regulation of cellular component biogenesis"^^ . . _:genid10994 . _:genid10995 . _:genid10997 _:genid10996 . _:genid10995 _:genid10997 . _:genid10996 . _:genid10996 . _:genid10996 . _:genid10997 . _:genid10994 _:genid10995 . _:genid10994 . . _:genid10998 . _:genid10998 . _:genid10998 . _:genid10998 . "GO:0044092"^^ . "negative regulation of molecular function"^^ . . _:genid10999 . _:genid11000 . _:genid11002 _:genid11001 . _:genid11000 _:genid11002 . _:genid11001 . _:genid11001 . _:genid11001 . _:genid11002 . _:genid10999 _:genid11000 . _:genid10999 . . _:genid11003 . _:genid11003 . _:genid11003 . _:genid11003 . "GO:0044093"^^ . "positive regulation of molecular function"^^ . . . . "GO:0044212"^^ . "transcription regulatory region DNA binding"^^ . . . . "GO:0044237"^^ . "cellular metabolic process"^^ . . . "GO:0044238"^^ . "primary metabolic process"^^ . . . . "GO:0044248"^^ . "cellular catabolic process"^^ . . . . "GO:0044249"^^ . "cellular biosynthetic process"^^ . . . . "GO:0044260"^^ . "cellular macromolecule metabolic process"^^ . . . . . "GO:0044265"^^ . "cellular macromolecule catabolic process"^^ . . . . "GO:0044267"^^ . "cellular protein metabolic process"^^ . . . . "GO:0044270"^^ . "cellular nitrogen compound catabolic process"^^ . . . . "GO:0044271"^^ . "cellular nitrogen compound biosynthetic process"^^ . . . "GO:0044728"^^ . "DNA methylation or demethylation"^^ . . . . "GO:0044764"^^ . "multi-organism cellular process"^^ . . _:genid11004 . _:genid11005 . _:genid11007 _:genid11006 . _:genid11005 _:genid11007 . _:genid11006 . _:genid11006 . _:genid11006 . _:genid11007 . _:genid11004 _:genid11005 . _:genid11004 . . _:genid11008 . _:genid11008 . _:genid11008 . _:genid11008 . "GO:0045182"^^ . "translation regulator activity"^^ . . . . "GO:0045184"^^ . "establishment of protein localization"^^ . . _:genid11009 . _:genid11010 . _:genid11012 _:genid11011 . _:genid11010 _:genid11012 . _:genid11011 . _:genid11011 . _:genid11011 . _:genid11012 . _:genid11009 _:genid11010 . _:genid11009 . . . . . . . _:genid11013 . _:genid11013 . _:genid11013 . _:genid11013 . "GO:0045727"^^ . "positive regulation of translation"^^ . . _:genid11014 . _:genid11015 . _:genid11017 _:genid11016 . _:genid11015 _:genid11017 . _:genid11016 . _:genid11016 . _:genid11016 . _:genid11017 . _:genid11014 _:genid11015 . _:genid11014 . . . . _:genid11018 . _:genid11018 . _:genid11018 . _:genid11018 . "GO:0045740"^^ . "positive regulation of DNA replication"^^ . . _:genid11019 . _:genid11020 . _:genid11022 _:genid11021 . _:genid11020 _:genid11022 . _:genid11021 . _:genid11021 . _:genid11021 . _:genid11022 . _:genid11019 _:genid11020 . _:genid11019 . . . _:genid11023 . _:genid11023 . _:genid11023 . _:genid11023 . "GO:0045759"^^ . "negative regulation of action potential"^^ . . _:genid11024 . _:genid11025 . _:genid11027 _:genid11026 . _:genid11025 _:genid11027 . _:genid11026 . _:genid11026 . _:genid11026 . _:genid11027 . _:genid11024 _:genid11025 . _:genid11024 . . . _:genid11028 . _:genid11028 . _:genid11028 . _:genid11028 . "GO:0045760"^^ . "positive regulation of action potential"^^ . . _:genid11029 . _:genid11030 . _:genid11032 _:genid11031 . _:genid11030 _:genid11032 . _:genid11031 . _:genid11031 . _:genid11031 . _:genid11032 . _:genid11029 _:genid11030 . _:genid11029 . . . . . _:genid11033 . _:genid11033 . _:genid11033 . _:genid11033 . "GO:0045892"^^ . "negative regulation of transcription, DNA-templated"^^ . . _:genid11034 . _:genid11035 . _:genid11037 _:genid11036 . _:genid11035 _:genid11037 . _:genid11036 . _:genid11036 . _:genid11036 . _:genid11037 . _:genid11034 _:genid11035 . _:genid11034 . . . . _:genid11038 . _:genid11038 . _:genid11038 . _:genid11038 . "GO:0045893"^^ . "positive regulation of transcription, DNA-templated"^^ . . _:genid11039 . _:genid11040 . _:genid11042 _:genid11041 . _:genid11040 _:genid11042 . _:genid11041 . _:genid11041 . _:genid11041 . _:genid11042 . _:genid11039 _:genid11040 . _:genid11039 . . . _:genid11043 . _:genid11043 . _:genid11043 . _:genid11043 . "GO:0045900"^^ . "negative regulation of translational elongation"^^ . . _:genid11044 . _:genid11045 . _:genid11047 _:genid11046 . _:genid11045 _:genid11047 . _:genid11046 . _:genid11046 . _:genid11046 . _:genid11047 . _:genid11044 _:genid11045 . _:genid11044 . . . _:genid11048 . _:genid11048 . _:genid11048 . _:genid11048 . "GO:0045901"^^ . "positive regulation of translational elongation"^^ . . _:genid11049 . _:genid11050 . _:genid11052 _:genid11051 . _:genid11050 _:genid11052 . _:genid11051 . _:genid11051 . _:genid11051 . _:genid11052 . _:genid11049 _:genid11050 . _:genid11049 . . . _:genid11053 . _:genid11053 . _:genid11053 . _:genid11053 . "GO:0045926"^^ . "negative regulation of growth"^^ . . _:genid11054 . _:genid11055 . _:genid11057 _:genid11056 . _:genid11055 _:genid11057 . _:genid11056 . _:genid11056 . _:genid11056 . _:genid11057 . _:genid11054 _:genid11055 . _:genid11054 . . . _:genid11058 . _:genid11058 . _:genid11058 . _:genid11058 . "GO:0045927"^^ . "positive regulation of growth"^^ . . _:genid11059 . _:genid11060 . _:genid11062 _:genid11061 . _:genid11060 _:genid11062 . _:genid11061 . _:genid11061 . _:genid11061 . _:genid11062 . _:genid11059 _:genid11060 . _:genid11059 . . . . _:genid11063 . _:genid11063 . _:genid11063 . _:genid11063 . "GO:0045934"^^ . "negative regulation of nucleobase-containing compound metabolic process"^^ . . _:genid11064 . _:genid11065 . _:genid11067 _:genid11066 . _:genid11065 _:genid11067 . _:genid11066 . _:genid11066 . _:genid11066 . _:genid11067 . _:genid11064 _:genid11065 . _:genid11064 . . . . _:genid11068 . _:genid11068 . _:genid11068 . _:genid11068 . "GO:0045935"^^ . "positive regulation of nucleobase-containing compound metabolic process"^^ . . . "GO:0045974"^^ . "regulation of translation, ncRNA-mediated"^^ . . . "GO:0046483"^^ . "heterocycle metabolic process"^^ . . . "GO:0046677"^^ . "response to antibiotic"^^ . . . . "GO:0046700"^^ . "heterocycle catabolic process"^^ . . . "GO:0046717"^^ . "acid secretion"^^ . . . "GO:0046903"^^ . "secretion"^^ . . . . "GO:0046942"^^ . "carboxylic acid transport"^^ . . _:genid11069 . _:genid11070 . _:genid11072 _:genid11071 . _:genid11070 _:genid11072 . _:genid11071 . _:genid11071 . _:genid11071 . _:genid11072 . _:genid11069 _:genid11070 . _:genid11069 . . _:genid11073 . _:genid11073 . _:genid11073 . _:genid11073 . "GO:0048518"^^ . "positive regulation of biological process"^^ . . _:genid11074 . _:genid11075 . _:genid11077 _:genid11076 . _:genid11075 _:genid11077 . _:genid11076 . _:genid11076 . _:genid11076 . _:genid11077 . _:genid11074 _:genid11075 . _:genid11074 . . _:genid11078 . _:genid11078 . _:genid11078 . _:genid11078 . "GO:0048519"^^ . "negative regulation of biological process"^^ . . _:genid11079 . _:genid11080 . _:genid11082 _:genid11081 . _:genid11080 _:genid11082 . _:genid11081 . _:genid11081 . _:genid11081 . _:genid11082 . _:genid11079 _:genid11080 . _:genid11079 . . . _:genid11083 . _:genid11083 . _:genid11083 . _:genid11083 . "GO:0048522"^^ . "positive regulation of cellular process"^^ . . _:genid11084 . _:genid11085 . _:genid11087 _:genid11086 . _:genid11085 _:genid11087 . _:genid11086 . _:genid11086 . _:genid11086 . _:genid11087 . _:genid11084 _:genid11085 . _:genid11084 . . . _:genid11088 . _:genid11088 . _:genid11088 . _:genid11088 . "GO:0048523"^^ . "negative regulation of cellular process"^^ . . . _:genid11089 . _:genid11089 . _:genid11089 . _:genid11089 . "GO:0048532"^^ . "anatomical structure arrangement"^^ . . _:genid11090 . _:genid11091 . _:genid11093 _:genid11092 . _:genid11091 _:genid11093 . _:genid11092 . _:genid11092 . _:genid11092 . _:genid11093 . _:genid11090 _:genid11091 . _:genid11090 . . _:genid11094 . _:genid11094 . _:genid11094 . _:genid11094 . "GO:0048583"^^ . "regulation of response to stimulus"^^ . . _:genid11095 . _:genid11096 . _:genid11098 _:genid11097 . _:genid11096 _:genid11098 . _:genid11097 . _:genid11097 . _:genid11097 . _:genid11098 . _:genid11095 _:genid11096 . _:genid11095 . . . _:genid11099 . _:genid11099 . _:genid11099 . _:genid11099 . "GO:0048584"^^ . "positive regulation of response to stimulus"^^ . . _:genid11100 . _:genid11101 . _:genid11103 _:genid11102 . _:genid11101 _:genid11103 . _:genid11102 . _:genid11102 . _:genid11102 . _:genid11103 . _:genid11100 _:genid11101 . _:genid11100 . . . _:genid11104 . _:genid11104 . _:genid11104 . _:genid11104 . "GO:0048585"^^ . "negative regulation of response to stimulus"^^ . . . _:genid11105 . _:genid11105 . _:genid11105 . _:genid11105 . "GO:0048646"^^ . "anatomical structure formation involved in morphogenesis"^^ . . . "GO:0048856"^^ . "anatomical structure development"^^ . . . . "GO:0048869"^^ . "cellular developmental process"^^ . . . . _:genid11106 . _:genid11106 . _:genid11106 . _:genid11106 . "GO:0048870"^^ . "cell motility"^^ . . . . "GO:0050482"^^ . "arachidonic acid secretion"^^ . . . _:genid11107 . _:genid11107 . _:genid11107 . _:genid11107 . "GO:0050663"^^ . "cytokine secretion"^^ . . _:genid11108 . _:genid11109 . _:genid11111 _:genid11110 . _:genid11109 _:genid11111 . _:genid11110 . _:genid11110 . _:genid11110 . _:genid11111 . _:genid11108 _:genid11109 . _:genid11108 . . . _:genid11112 . _:genid11112 . _:genid11112 . _:genid11112 . "GO:0050707"^^ . "regulation of cytokine secretion"^^ . . _:genid11113 . _:genid11114 . _:genid11116 _:genid11115 . _:genid11114 _:genid11116 . _:genid11115 . _:genid11115 . _:genid11115 . _:genid11116 . _:genid11113 _:genid11114 . _:genid11113 . . . . _:genid11117 . _:genid11117 . _:genid11117 . _:genid11117 . "GO:0050708"^^ . "regulation of protein secretion"^^ . . _:genid11118 . _:genid11119 . _:genid11121 _:genid11120 . _:genid11119 _:genid11121 . _:genid11120 . _:genid11120 . _:genid11120 . _:genid11121 . _:genid11118 _:genid11119 . _:genid11118 . . . . . _:genid11122 . _:genid11122 . _:genid11122 . _:genid11122 . "GO:0050709"^^ . "negative regulation of protein secretion"^^ . . _:genid11123 . _:genid11124 . _:genid11126 _:genid11125 . _:genid11124 _:genid11126 . _:genid11125 . _:genid11125 . _:genid11125 . _:genid11126 . _:genid11123 _:genid11124 . _:genid11123 . . . . _:genid11127 . _:genid11127 . _:genid11127 . _:genid11127 . "GO:0050710"^^ . "negative regulation of cytokine secretion"^^ . . _:genid11128 . _:genid11129 . _:genid11131 _:genid11130 . _:genid11129 _:genid11131 . _:genid11130 . _:genid11130 . _:genid11130 . _:genid11131 . _:genid11128 _:genid11129 . _:genid11128 . . . . . _:genid11132 . _:genid11132 . _:genid11132 . _:genid11132 . "GO:0050714"^^ . "positive regulation of protein secretion"^^ . . _:genid11133 . _:genid11134 . _:genid11136 _:genid11135 . _:genid11134 _:genid11136 . _:genid11135 . _:genid11135 . _:genid11135 . _:genid11136 . _:genid11133 _:genid11134 . _:genid11133 . . . . _:genid11137 . _:genid11137 . _:genid11137 . _:genid11137 . "GO:0050715"^^ . "positive regulation of cytokine secretion"^^ . . _:genid11138 . _:genid11139 . _:genid11141 _:genid11140 . _:genid11139 _:genid11141 . _:genid11140 . _:genid11140 . _:genid11140 . _:genid11141 . _:genid11138 _:genid11139 . _:genid11138 . . _:genid11142 . _:genid11142 . _:genid11142 . _:genid11142 . "GO:0050789"^^ . "regulation of biological process"^^ . . _:genid11143 . _:genid11144 . _:genid11146 _:genid11145 . _:genid11144 _:genid11146 . _:genid11145 . _:genid11145 . _:genid11145 . _:genid11146 . _:genid11143 _:genid11144 . _:genid11143 . . _:genid11147 . _:genid11147 . _:genid11147 . _:genid11147 . "GO:0050790"^^ . "regulation of catalytic activity"^^ . . _:genid11148 . _:genid11149 . _:genid11151 _:genid11150 . _:genid11149 _:genid11151 . _:genid11150 . _:genid11150 . _:genid11150 . _:genid11151 . _:genid11148 _:genid11149 . _:genid11148 . . _:genid11152 . _:genid11152 . _:genid11152 . _:genid11152 . "GO:0050793"^^ . "regulation of developmental process"^^ . . _:genid11153 . _:genid11154 . _:genid11156 _:genid11155 . _:genid11154 _:genid11156 . _:genid11155 . _:genid11155 . _:genid11155 . _:genid11156 . _:genid11153 _:genid11154 . _:genid11153 . . _:genid11157 . _:genid11157 . _:genid11157 . _:genid11157 . "GO:0050794"^^ . "regulation of cellular process"^^ . . . "Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism."^^ . "GO:0050896"^^ . "response to stimulus"^^ . . _:genid11158 . _:genid11159 . _:genid11161 _:genid11160 . _:genid11159 _:genid11161 . _:genid11160 . _:genid11160 . _:genid11160 . _:genid11161 . _:genid11158 _:genid11159 . _:genid11158 . . . _:genid11162 . _:genid11162 . _:genid11162 . _:genid11162 . "GO:0050920"^^ . "regulation of chemotaxis"^^ . . _:genid11163 . _:genid11164 . _:genid11166 _:genid11165 . _:genid11164 _:genid11166 . _:genid11165 . _:genid11165 . _:genid11165 . _:genid11166 . _:genid11163 _:genid11164 . _:genid11163 . . . . _:genid11167 . _:genid11167 . _:genid11167 . _:genid11167 . "GO:0050921"^^ . "positive regulation of chemotaxis"^^ . . _:genid11168 . _:genid11169 . _:genid11171 _:genid11170 . _:genid11169 _:genid11171 . _:genid11170 . _:genid11170 . _:genid11170 . _:genid11171 . _:genid11168 _:genid11169 . _:genid11168 . . . . _:genid11172 . _:genid11172 . _:genid11172 . _:genid11172 . "GO:0050922"^^ . "negative regulation of chemotaxis"^^ . . _:genid11173 . _:genid11174 . _:genid11176 _:genid11175 . _:genid11174 _:genid11176 . _:genid11175 . _:genid11175 . _:genid11175 . _:genid11176 . _:genid11173 _:genid11174 . _:genid11173 . . _:genid11177 . _:genid11177 . _:genid11177 . _:genid11177 . "GO:0051046"^^ . "regulation of secretion"^^ . . _:genid11178 . _:genid11179 . _:genid11181 _:genid11180 . _:genid11179 _:genid11181 . _:genid11180 . _:genid11180 . _:genid11180 . _:genid11181 . _:genid11178 _:genid11179 . _:genid11178 . . . _:genid11182 . _:genid11182 . _:genid11182 . _:genid11182 . "GO:0051047"^^ . "positive regulation of secretion"^^ . . _:genid11183 . _:genid11184 . _:genid11186 _:genid11185 . _:genid11184 _:genid11186 . _:genid11185 . _:genid11185 . _:genid11185 . _:genid11186 . _:genid11183 _:genid11184 . _:genid11183 . . . _:genid11187 . _:genid11187 . _:genid11187 . _:genid11187 . "GO:0051048"^^ . "negative regulation of secretion"^^ . . _:genid11188 . _:genid11189 . _:genid11191 _:genid11190 . _:genid11189 _:genid11191 . _:genid11190 . _:genid11190 . _:genid11190 . _:genid11191 . _:genid11188 _:genid11189 . _:genid11188 . . _:genid11192 . _:genid11192 . _:genid11192 . _:genid11192 . "GO:0051049"^^ . "regulation of transport"^^ . . _:genid11193 . _:genid11194 . _:genid11196 _:genid11195 . _:genid11194 _:genid11196 . _:genid11195 . _:genid11195 . _:genid11195 . _:genid11196 . _:genid11193 _:genid11194 . _:genid11193 . . . _:genid11197 . _:genid11197 . _:genid11197 . _:genid11197 . "GO:0051050"^^ . "positive regulation of transport"^^ . . _:genid11198 . _:genid11199 . _:genid11201 _:genid11200 . _:genid11199 _:genid11201 . _:genid11200 . _:genid11200 . _:genid11200 . _:genid11201 . _:genid11198 _:genid11199 . _:genid11198 . . . _:genid11202 . _:genid11202 . _:genid11202 . _:genid11202 . "GO:0051051"^^ . "negative regulation of transport"^^ . . _:genid11203 . _:genid11204 . _:genid11206 _:genid11205 . _:genid11204 _:genid11206 . _:genid11205 . _:genid11205 . _:genid11205 . _:genid11206 . _:genid11203 _:genid11204 . _:genid11203 . . . _:genid11207 . _:genid11207 . _:genid11207 . _:genid11207 . "GO:0051052"^^ . "regulation of DNA metabolic process"^^ . . _:genid11208 . _:genid11209 . _:genid11211 _:genid11210 . _:genid11209 _:genid11211 . _:genid11210 . _:genid11210 . _:genid11210 . _:genid11211 . _:genid11208 _:genid11209 . _:genid11208 . . . . _:genid11212 . _:genid11212 . _:genid11212 . _:genid11212 . "GO:0051053"^^ . "negative regulation of DNA metabolic process"^^ . . _:genid11213 . _:genid11214 . _:genid11216 _:genid11215 . _:genid11214 _:genid11216 . _:genid11215 . _:genid11215 . _:genid11215 . _:genid11216 . _:genid11213 _:genid11214 . _:genid11213 . . . . _:genid11217 . _:genid11217 . _:genid11217 . _:genid11217 . "GO:0051054"^^ . "positive regulation of DNA metabolic process"^^ . . _:genid11218 . _:genid11219 . _:genid11221 _:genid11220 . _:genid11219 _:genid11221 . _:genid11220 . _:genid11220 . _:genid11220 . _:genid11221 . _:genid11218 _:genid11219 . _:genid11218 . . . _:genid11222 . _:genid11222 . _:genid11222 . _:genid11222 . "GO:0051093"^^ . "negative regulation of developmental process"^^ . . _:genid11223 . _:genid11224 . _:genid11226 _:genid11225 . _:genid11224 _:genid11226 . _:genid11225 . _:genid11225 . _:genid11225 . _:genid11226 . _:genid11223 _:genid11224 . _:genid11223 . . . _:genid11227 . _:genid11227 . _:genid11227 . _:genid11227 . "GO:0051094"^^ . "positive regulation of developmental process"^^ . . _:genid11228 . _:genid11229 . _:genid11231 _:genid11230 . _:genid11229 _:genid11231 . _:genid11230 . _:genid11230 . _:genid11230 . _:genid11231 . _:genid11228 _:genid11229 . _:genid11228 . . _:genid11232 . _:genid11232 . _:genid11232 . _:genid11232 . "GO:0051098"^^ . "regulation of binding"^^ . . _:genid11233 . _:genid11234 . _:genid11236 _:genid11235 . _:genid11234 _:genid11236 . _:genid11235 . _:genid11235 . _:genid11235 . _:genid11236 . _:genid11233 _:genid11234 . _:genid11233 . . . _:genid11237 . _:genid11237 . _:genid11237 . _:genid11237 . "GO:0051099"^^ . "positive regulation of binding"^^ . . _:genid11238 . _:genid11239 . _:genid11241 _:genid11240 . _:genid11239 _:genid11241 . _:genid11240 . _:genid11240 . _:genid11240 . _:genid11241 . _:genid11238 _:genid11239 . _:genid11238 . . . _:genid11242 . _:genid11242 . _:genid11242 . _:genid11242 . "GO:0051100"^^ . "negative regulation of binding"^^ . . _:genid11243 . _:genid11244 . _:genid11246 _:genid11245 . _:genid11244 _:genid11246 . _:genid11245 . _:genid11245 . _:genid11245 . _:genid11246 . _:genid11243 _:genid11244 . _:genid11243 . . _:genid11247 . _:genid11247 . _:genid11247 . _:genid11247 . "GO:0051101"^^ . "regulation of DNA binding"^^ . . _:genid11248 . _:genid11249 . _:genid11251 _:genid11250 . _:genid11249 _:genid11251 . _:genid11250 . _:genid11250 . _:genid11250 . _:genid11251 . _:genid11248 _:genid11249 . _:genid11248 . . _:genid11252 . _:genid11252 . _:genid11252 . _:genid11252 . "GO:0051128"^^ . "regulation of cellular component organization"^^ . . _:genid11253 . _:genid11254 . _:genid11256 _:genid11255 . _:genid11254 _:genid11256 . _:genid11255 . _:genid11255 . _:genid11255 . _:genid11256 . _:genid11253 _:genid11254 . _:genid11253 . . . _:genid11257 . _:genid11257 . _:genid11257 . _:genid11257 . "GO:0051129"^^ . "negative regulation of cellular component organization"^^ . . _:genid11258 . _:genid11259 . _:genid11261 _:genid11260 . _:genid11259 _:genid11261 . _:genid11260 . _:genid11260 . _:genid11260 . _:genid11261 . _:genid11258 _:genid11259 . _:genid11258 . . . _:genid11262 . _:genid11262 . _:genid11262 . _:genid11262 . "GO:0051130"^^ . "positive regulation of cellular component organization"^^ . . _:genid11263 . _:genid11264 . _:genid11266 _:genid11265 . _:genid11264 _:genid11266 . _:genid11265 . _:genid11265 . _:genid11265 . _:genid11266 . _:genid11263 _:genid11264 . _:genid11263 . . _:genid11267 . _:genid11267 . _:genid11267 . _:genid11267 . "GO:0051171"^^ . "regulation of nitrogen compound metabolic process"^^ . . _:genid11268 . _:genid11269 . _:genid11271 _:genid11270 . _:genid11269 _:genid11271 . _:genid11270 . _:genid11270 . _:genid11270 . _:genid11271 . _:genid11268 _:genid11269 . _:genid11268 . . . _:genid11272 . _:genid11272 . _:genid11272 . _:genid11272 . "GO:0051172"^^ . "negative regulation of nitrogen compound metabolic process"^^ . . _:genid11273 . _:genid11274 . _:genid11276 _:genid11275 . _:genid11274 _:genid11276 . _:genid11275 . _:genid11275 . _:genid11275 . _:genid11276 . _:genid11273 _:genid11274 . _:genid11273 . . . _:genid11277 . _:genid11277 . _:genid11277 . _:genid11277 . "GO:0051173"^^ . "positive regulation of nitrogen compound metabolic process"^^ . . . "GO:0051179"^^ . "localization"^^ . . _:genid11278 . _:genid11279 . _:genid11281 _:genid11280 . _:genid11279 _:genid11281 . _:genid11280 . _:genid11280 . _:genid11280 . _:genid11281 . _:genid11278 _:genid11279 . _:genid11278 . . . . _:genid11282 . _:genid11282 . _:genid11282 . _:genid11282 . "GO:0051222"^^ . "positive regulation of protein transport"^^ . . _:genid11283 . _:genid11284 . _:genid11286 _:genid11285 . _:genid11284 _:genid11286 . _:genid11285 . _:genid11285 . _:genid11285 . _:genid11286 . _:genid11283 _:genid11284 . _:genid11283 . . . _:genid11287 . _:genid11287 . _:genid11287 . _:genid11287 . "GO:0051223"^^ . "regulation of protein transport"^^ . . _:genid11288 . _:genid11289 . _:genid11291 _:genid11290 . _:genid11289 _:genid11291 . _:genid11290 . _:genid11290 . _:genid11290 . _:genid11291 . _:genid11288 _:genid11289 . _:genid11288 . . . . _:genid11292 . _:genid11292 . _:genid11292 . _:genid11292 . "GO:0051224"^^ . "negative regulation of protein transport"^^ . . . "GO:0051234"^^ . "establishment of localization"^^ . . _:genid11293 . _:genid11294 . _:genid11296 _:genid11295 . _:genid11294 _:genid11296 . _:genid11295 . _:genid11295 . _:genid11295 . _:genid11296 . _:genid11293 _:genid11294 . _:genid11293 . . _:genid11297 . _:genid11297 . _:genid11297 . _:genid11297 . "GO:0051239"^^ . "regulation of multicellular organismal process"^^ . . _:genid11298 . _:genid11299 . _:genid11301 _:genid11300 . _:genid11299 _:genid11301 . _:genid11300 . _:genid11300 . _:genid11300 . _:genid11301 . _:genid11298 _:genid11299 . _:genid11298 . . . _:genid11302 . _:genid11302 . _:genid11302 . _:genid11302 . "GO:0051240"^^ . "positive regulation of multicellular organismal process"^^ . . _:genid11303 . _:genid11304 . _:genid11306 _:genid11305 . _:genid11304 _:genid11306 . _:genid11305 . _:genid11305 . _:genid11305 . _:genid11306 . _:genid11303 _:genid11304 . _:genid11303 . . . _:genid11307 . _:genid11307 . _:genid11307 . _:genid11307 . "GO:0051241"^^ . "negative regulation of multicellular organismal process"^^ . . _:genid11308 . _:genid11309 . _:genid11311 _:genid11310 . _:genid11309 _:genid11311 . _:genid11310 . _:genid11310 . _:genid11310 . _:genid11311 . _:genid11308 _:genid11309 . _:genid11308 . . . . _:genid11312 . _:genid11312 . _:genid11312 . _:genid11312 . "GO:0051246"^^ . "regulation of protein metabolic process"^^ . . _:genid11313 . _:genid11314 . _:genid11316 _:genid11315 . _:genid11314 _:genid11316 . _:genid11315 . _:genid11315 . _:genid11315 . _:genid11316 . _:genid11313 _:genid11314 . _:genid11313 . . . . _:genid11317 . _:genid11317 . _:genid11317 . _:genid11317 . "GO:0051247"^^ . "positive regulation of protein metabolic process"^^ . . _:genid11318 . _:genid11319 . _:genid11321 _:genid11320 . _:genid11319 _:genid11321 . _:genid11320 . _:genid11320 . _:genid11320 . _:genid11321 . _:genid11318 _:genid11319 . _:genid11318 . . . . _:genid11322 . _:genid11322 . _:genid11322 . _:genid11322 . "GO:0051248"^^ . "negative regulation of protein metabolic process"^^ . . _:genid11323 . _:genid11324 . _:genid11326 _:genid11325 . _:genid11324 _:genid11326 . _:genid11325 . _:genid11325 . _:genid11325 . _:genid11326 . _:genid11323 _:genid11324 . _:genid11323 . . . _:genid11327 . _:genid11327 . _:genid11327 . _:genid11327 . "GO:0051252"^^ . "regulation of RNA metabolic process"^^ . . _:genid11328 . _:genid11329 . _:genid11331 _:genid11330 . _:genid11329 _:genid11331 . _:genid11330 . _:genid11330 . _:genid11330 . _:genid11331 . _:genid11328 _:genid11329 . _:genid11328 . . . . _:genid11332 . _:genid11332 . _:genid11332 . _:genid11332 . "GO:0051253"^^ . "negative regulation of RNA metabolic process"^^ . . _:genid11333 . _:genid11334 . _:genid11336 _:genid11335 . _:genid11334 _:genid11336 . _:genid11335 . _:genid11335 . _:genid11335 . _:genid11336 . _:genid11333 _:genid11334 . _:genid11333 . . . . _:genid11337 . _:genid11337 . _:genid11337 . _:genid11337 . "GO:0051254"^^ . "positive regulation of RNA metabolic process"^^ . . _:genid11338 . _:genid11339 . _:genid11341 _:genid11340 . _:genid11339 _:genid11341 . _:genid11340 . _:genid11340 . _:genid11340 . _:genid11341 . _:genid11338 _:genid11339 . _:genid11338 . . . _:genid11342 . _:genid11342 . _:genid11342 . _:genid11342 . "GO:0051270"^^ . "regulation of cellular component movement"^^ . . _:genid11343 . _:genid11344 . _:genid11346 _:genid11345 . _:genid11344 _:genid11346 . _:genid11345 . _:genid11345 . _:genid11345 . _:genid11346 . _:genid11343 _:genid11344 . _:genid11343 . . . _:genid11347 . _:genid11347 . _:genid11347 . _:genid11347 . "GO:0051271"^^ . "negative regulation of cellular component movement"^^ . . _:genid11348 . _:genid11349 . _:genid11351 _:genid11350 . _:genid11349 _:genid11351 . _:genid11350 . _:genid11350 . _:genid11350 . _:genid11351 . _:genid11348 _:genid11349 . _:genid11348 . . . _:genid11352 . _:genid11352 . _:genid11352 . _:genid11352 . "GO:0051272"^^ . "positive regulation of cellular component movement"^^ . . . "A process that is carried out at the cellular level that results in the assembly, arrangement of constituent parts, or disassembly of chromosomes, structures composed of a very long molecule of DNA and associated proteins that carries hereditary information. This term covers covalent modifications at the molecular level as well as spatial relationships among the major components of a chromosome."^^ . "GO:0051276"^^ . "chromosome organization"^^ . . _:genid11353 . _:genid11354 . _:genid11356 _:genid11355 . _:genid11354 _:genid11356 . _:genid11355 . _:genid11355 . _:genid11355 . _:genid11356 . _:genid11353 _:genid11354 . _:genid11353 . . _:genid11357 . _:genid11357 . _:genid11357 . _:genid11357 . "GO:0051336"^^ . "regulation of hydrolase activity"^^ . . _:genid11358 . _:genid11359 . _:genid11361 _:genid11360 . _:genid11359 _:genid11361 . _:genid11360 . _:genid11360 . _:genid11360 . _:genid11361 . _:genid11358 _:genid11359 . _:genid11358 . . . _:genid11362 . _:genid11362 . _:genid11362 . _:genid11362 . "GO:0051345"^^ . "positive regulation of hydrolase activity"^^ . . _:genid11363 . _:genid11364 . _:genid11366 _:genid11365 . _:genid11364 _:genid11366 . _:genid11365 . _:genid11365 . _:genid11365 . _:genid11366 . _:genid11363 _:genid11364 . _:genid11363 . . . _:genid11367 . _:genid11367 . _:genid11367 . _:genid11367 . "GO:0051346"^^ . "negative regulation of hydrolase activity"^^ . . . "GO:0051641"^^ . "cellular localization"^^ . . . "GO:0051674"^^ . "localization of cell"^^ . . . "GO:0051704"^^ . "multi-organism process"^^ . . . . "GO:0051716"^^ . "cellular response to stimulus"^^ . . . "GO:0055085"^^ . "transmembrane transport"^^ . . _:genid11368 . _:genid11369 . _:genid11371 _:genid11370 . _:genid11369 _:genid11371 . _:genid11370 . _:genid11370 . _:genid11370 . _:genid11371 . _:genid11368 _:genid11369 . _:genid11368 . . _:genid11372 . _:genid11372 . _:genid11372 . _:genid11372 . "GO:0060147"^^ . "regulation of posttranscriptional gene silencing"^^ . . _:genid11373 . _:genid11374 . _:genid11376 _:genid11375 . _:genid11374 _:genid11376 . _:genid11375 . _:genid11375 . _:genid11375 . _:genid11376 . _:genid11373 _:genid11374 . _:genid11373 . . . _:genid11377 . _:genid11377 . _:genid11377 . _:genid11377 . "GO:0060148"^^ . "positive regulation of posttranscriptional gene silencing"^^ . . _:genid11378 . _:genid11379 . _:genid11381 _:genid11380 . _:genid11379 _:genid11381 . _:genid11380 . _:genid11380 . _:genid11380 . _:genid11381 . _:genid11378 _:genid11379 . _:genid11378 . . . _:genid11382 . _:genid11382 . _:genid11382 . _:genid11382 . "GO:0060149"^^ . "negative regulation of posttranscriptional gene silencing"^^ . . _:genid11383 . _:genid11384 . _:genid11386 _:genid11385 . _:genid11384 _:genid11386 . _:genid11385 . _:genid11385 . _:genid11385 . _:genid11386 . _:genid11383 _:genid11384 . _:genid11383 . . _:genid11387 . _:genid11387 . _:genid11387 . _:genid11387 . "GO:0060194"^^ . "regulation of antisense RNA transcription"^^ . . _:genid11388 . _:genid11389 . _:genid11391 _:genid11390 . _:genid11389 _:genid11391 . _:genid11390 . _:genid11390 . _:genid11390 . _:genid11391 . _:genid11388 _:genid11389 . _:genid11388 . . . _:genid11392 . _:genid11392 . _:genid11392 . _:genid11392 . "GO:0060195"^^ . "negative regulation of antisense RNA transcription"^^ . . _:genid11393 . _:genid11394 . _:genid11396 _:genid11395 . _:genid11394 _:genid11396 . _:genid11395 . _:genid11395 . _:genid11395 . _:genid11396 . _:genid11393 _:genid11394 . _:genid11393 . . . _:genid11397 . _:genid11397 . _:genid11397 . _:genid11397 . "GO:0060196"^^ . "positive regulation of antisense RNA transcription"^^ . . _:genid11398 . _:genid11399 . _:genid11401 _:genid11400 . _:genid11399 _:genid11401 . _:genid11400 . _:genid11400 . _:genid11400 . _:genid11401 . _:genid11398 _:genid11399 . _:genid11398 . . _:genid11402 . _:genid11402 . _:genid11402 . _:genid11402 . "GO:0060255"^^ . "regulation of macromolecule metabolic process"^^ . . . . _:genid11403 . _:genid11403 . _:genid11403 . _:genid11403 . "GO:0060326"^^ . "cell chemotaxis"^^ . . _:genid11404 . _:genid11405 . _:genid11407 _:genid11406 . _:genid11405 _:genid11407 . _:genid11406 . _:genid11406 . _:genid11406 . _:genid11407 . _:genid11404 _:genid11405 . _:genid11404 . . _:genid11408 . _:genid11408 . _:genid11408 . _:genid11408 . "GO:0060341"^^ . "regulation of cellular localization"^^ . . . "GO:0060352"^^ . "cell adhesion molecule production"^^ . . _:genid11409 . _:genid11410 . _:genid11412 _:genid11411 . _:genid11410 _:genid11412 . _:genid11411 . _:genid11411 . _:genid11411 . _:genid11412 . _:genid11409 _:genid11410 . _:genid11409 . . _:genid11413 . _:genid11413 . _:genid11413 . _:genid11413 . "GO:0060353"^^ . "regulation of cell adhesion molecule production"^^ . . _:genid11414 . _:genid11415 . _:genid11417 _:genid11416 . _:genid11415 _:genid11417 . _:genid11416 . _:genid11416 . _:genid11416 . _:genid11417 . _:genid11414 _:genid11415 . _:genid11414 . . . _:genid11418 . _:genid11418 . _:genid11418 . _:genid11418 . "GO:0060354"^^ . "negative regulation of cell adhesion molecule production"^^ . . _:genid11419 . _:genid11420 . _:genid11422 _:genid11421 . _:genid11420 _:genid11422 . _:genid11421 . _:genid11421 . _:genid11421 . _:genid11422 . _:genid11419 _:genid11420 . _:genid11419 . . . _:genid11423 . _:genid11423 . _:genid11423 . _:genid11423 . "GO:0060355"^^ . "positive regulation of cell adhesion molecule production"^^ . . _:genid11424 . _:genid11425 . _:genid11427 _:genid11426 . _:genid11425 _:genid11427 . _:genid11426 . _:genid11426 . _:genid11426 . _:genid11427 . _:genid11424 _:genid11425 . _:genid11424 . . . _:genid11428 . _:genid11428 . _:genid11428 . _:genid11428 . "GO:0060491"^^ . "regulation of cell projection assembly"^^ . . _:genid11429 . _:genid11430 . _:genid11432 _:genid11431 . _:genid11430 _:genid11432 . _:genid11431 . _:genid11431 . _:genid11431 . _:genid11432 . _:genid11429 _:genid11430 . _:genid11429 . . . _:genid11433 . _:genid11433 . _:genid11433 . _:genid11433 . "GO:0060548"^^ . "negative regulation of cell death"^^ . . _:genid11434 . _:genid11435 . _:genid11437 _:genid11436 . _:genid11435 _:genid11437 . _:genid11436 . _:genid11436 . _:genid11436 . _:genid11437 . _:genid11434 _:genid11435 . _:genid11434 . . _:genid11438 . _:genid11438 . _:genid11438 . _:genid11438 . "GO:0060561"^^ . "apoptotic process involved in morphogenesis"^^ . . _:genid11439 . _:genid11440 . _:genid11442 _:genid11441 . _:genid11440 _:genid11442 . _:genid11441 . _:genid11441 . _:genid11441 . _:genid11442 . _:genid11439 _:genid11440 . _:genid11439 . . _:genid11443 . _:genid11443 . _:genid11443 . _:genid11443 . "GO:0060966"^^ . "regulation of gene silencing by RNA"^^ . . _:genid11444 . _:genid11445 . _:genid11447 _:genid11446 . _:genid11445 _:genid11447 . _:genid11446 . _:genid11446 . _:genid11446 . _:genid11447 . _:genid11444 _:genid11445 . _:genid11444 . . . _:genid11448 . _:genid11448 . _:genid11448 . _:genid11448 . "GO:0060967"^^ . "negative regulation of gene silencing by RNA"^^ . . _:genid11449 . _:genid11450 . _:genid11452 _:genid11451 . _:genid11450 _:genid11452 . _:genid11451 . _:genid11451 . _:genid11451 . _:genid11452 . _:genid11449 _:genid11450 . _:genid11449 . . . _:genid11453 . _:genid11453 . _:genid11453 . _:genid11453 . "GO:0060968"^^ . "regulation of gene silencing"^^ . . _:genid11454 . _:genid11455 . _:genid11457 _:genid11456 . _:genid11455 _:genid11457 . _:genid11456 . _:genid11456 . _:genid11456 . _:genid11457 . _:genid11454 _:genid11455 . _:genid11454 . . . . _:genid11458 . _:genid11458 . _:genid11458 . _:genid11458 . "GO:0060969"^^ . "negative regulation of gene silencing"^^ . . _:genid11459 . _:genid11460 . _:genid11462 _:genid11461 . _:genid11460 _:genid11462 . _:genid11461 . _:genid11461 . _:genid11461 . _:genid11462 . _:genid11459 _:genid11460 . _:genid11459 . . _:genid11463 . _:genid11463 . _:genid11463 . _:genid11463 . "GO:0061041"^^ . "regulation of wound healing"^^ . . _:genid11464 . _:genid11465 . _:genid11467 _:genid11466 . _:genid11465 _:genid11467 . _:genid11466 . _:genid11466 . _:genid11466 . _:genid11467 . _:genid11464 _:genid11465 . _:genid11464 . . . . _:genid11468 . _:genid11468 . _:genid11468 . _:genid11468 . "GO:0061045"^^ . "negative regulation of wound healing"^^ . . . "GO:0061478"^^ . "response to platelet aggregation inhibitor"^^ . . . "GO:0065007"^^ . "biological regulation"^^ . . . "GO:0065008"^^ . "regulation of biological quality"^^ . . _:genid11469 . _:genid11470 . _:genid11472 _:genid11471 . _:genid11470 _:genid11472 . _:genid11471 . _:genid11471 . _:genid11471 . _:genid11472 . _:genid11469 _:genid11470 . _:genid11469 . . _:genid11473 . _:genid11473 . _:genid11473 . _:genid11473 . "GO:0065009"^^ . "regulation of molecular function"^^ . . _:genid11474 . _:genid11475 . _:genid11477 _:genid11476 . _:genid11475 _:genid11477 . _:genid11476 . _:genid11476 . _:genid11476 . _:genid11477 . _:genid11474 _:genid11475 . _:genid11474 . . _:genid11478 . _:genid11478 . _:genid11478 . _:genid11478 . "GO:0070201"^^ . "regulation of establishment of protein localization"^^ . . _:genid11479 . _:genid11480 . _:genid11482 _:genid11481 . _:genid11480 _:genid11482 . _:genid11481 . _:genid11481 . _:genid11481 . _:genid11482 . _:genid11479 _:genid11480 . _:genid11479 . . _:genid11483 . _:genid11483 . _:genid11483 . _:genid11483 . "GO:0070549"^^ . "negative regulation of translation involved in RNA interference"^^ . . . . "GO:0070727"^^ . "cellular macromolecule localization"^^ . . . . "GO:0070887"^^ . "cellular response to chemical stimulus"^^ . . . . "GO:0071310"^^ . "cellular response to organic substance"^^ . . . . "GO:0071407"^^ . "cellular response to organic cyclic compound"^^ . . . . . . "GO:0071417"^^ . "cellular response to organonitrogen compound"^^ . . . "GO:0071495"^^ . "cellular response to endogenous stimulus"^^ . . . "GO:0071692"^^ . "protein localization to extracellular region"^^ . . . "GO:0071702"^^ . "organic substance transport"^^ . . . "GO:0071704"^^ . "organic substance metabolic process"^^ . . . "GO:0071705"^^ . "nitrogen compound transport"^^ . . . "GO:0071706"^^ . "tumor necrosis factor superfamily cytokine production"^^ . . . . "GO:0071715"^^ . "icosanoid transport"^^ . . . "GO:0071840"^^ . "cellular component organization or biogenesis"^^ . . . . . "GO:0071897"^^ . "DNA biosynthetic process"^^ . . . . . . . . "GO:0072749"^^ . "cellular response to cytochalasin B"^^ . . _:genid11484 . _:genid11485 . _:genid11487 _:genid11486 . _:genid11485 _:genid11487 . _:genid11486 . _:genid11486 . _:genid11486 . _:genid11487 . _:genid11484 _:genid11485 . _:genid11484 . . _:genid11488 . _:genid11488 . _:genid11488 . _:genid11488 . "GO:0080090"^^ . "regulation of primary metabolic process"^^ . . _:genid11489 . _:genid11490 . _:genid11492 _:genid11491 . _:genid11490 _:genid11492 . _:genid11491 . _:genid11491 . _:genid11491 . _:genid11492 . _:genid11489 _:genid11490 . _:genid11489 . . _:genid11493 . _:genid11493 . _:genid11493 . _:genid11493 . "GO:0080134"^^ . "regulation of response to stress"^^ . . _:genid11494 . _:genid11495 . _:genid11497 _:genid11496 . _:genid11495 _:genid11497 . _:genid11496 . _:genid11496 . _:genid11496 . _:genid11497 . _:genid11494 _:genid11495 . _:genid11494 . . . _:genid11498 . _:genid11498 . _:genid11498 . _:genid11498 . "GO:0080135"^^ . "regulation of cellular response to stress"^^ . . _:genid11499 . _:genid11500 . _:genid11502 _:genid11501 . _:genid11500 _:genid11502 . _:genid11501 . _:genid11501 . _:genid11501 . _:genid11502 . _:genid11499 _:genid11500 . _:genid11499 . . _:genid11503 . _:genid11503 . _:genid11503 . _:genid11503 . "GO:0090087"^^ . "regulation of peptide transport"^^ . . _:genid11504 . _:genid11505 . _:genid11507 _:genid11506 . _:genid11505 _:genid11507 . _:genid11506 . _:genid11506 . _:genid11506 . _:genid11507 . _:genid11504 _:genid11505 . _:genid11504 . . _:genid11508 . _:genid11508 . _:genid11508 . _:genid11508 . "GO:0090237"^^ . "regulation of arachidonic acid secretion"^^ . . _:genid11509 . _:genid11510 . _:genid11512 _:genid11511 . _:genid11510 _:genid11512 . _:genid11511 . _:genid11511 . _:genid11511 . _:genid11512 . _:genid11509 _:genid11510 . _:genid11509 . . . _:genid11513 . _:genid11513 . _:genid11513 . _:genid11513 . "GO:0090238"^^ . "positive regulation of arachidonic acid secretion"^^ . . _:genid11514 . _:genid11515 . _:genid11517 _:genid11516 . _:genid11515 _:genid11517 . _:genid11516 . _:genid11516 . _:genid11516 . _:genid11517 . _:genid11514 _:genid11515 . _:genid11514 . . . _:genid11518 . _:genid11518 . _:genid11518 . _:genid11518 . "GO:0090303"^^ . "positive regulation of wound healing"^^ . . . . "GO:0090304"^^ . "nucleic acid metabolic process"^^ . . . "GO:0090305"^^ . "nucleic acid phosphodiester bond hydrolysis"^^ . . _:genid11519 . _:genid11520 . _:genid11522 _:genid11521 . _:genid11520 _:genid11522 . _:genid11521 . _:genid11521 . _:genid11521 . _:genid11522 . _:genid11519 _:genid11520 . _:genid11519 . . . _:genid11523 . _:genid11523 . _:genid11523 . _:genid11523 . "GO:0090342"^^ . "regulation of cell aging"^^ . . _:genid11524 . _:genid11525 . _:genid11527 _:genid11526 . _:genid11525 _:genid11527 . _:genid11526 . _:genid11526 . _:genid11526 . _:genid11527 . _:genid11524 _:genid11525 . _:genid11524 . . . . _:genid11528 . _:genid11528 . _:genid11528 . _:genid11528 . "GO:0090343"^^ . "positive regulation of cell aging"^^ . . _:genid11529 . _:genid11530 . _:genid11532 _:genid11531 . _:genid11530 _:genid11532 . _:genid11531 . _:genid11531 . _:genid11531 . _:genid11532 . _:genid11529 _:genid11530 . _:genid11529 . . . . _:genid11533 . _:genid11533 . _:genid11533 . _:genid11533 . "GO:0090344"^^ . "negative regulation of cell aging"^^ . . _:genid11534 . _:genid11535 . _:genid11537 _:genid11536 . _:genid11535 _:genid11537 . _:genid11536 . _:genid11536 . _:genid11536 . _:genid11537 . _:genid11534 _:genid11535 . _:genid11534 . . _:genid11538 . _:genid11538 . _:genid11538 . _:genid11538 . "GO:0090592"^^ . "DNA synthesis involved in DNA replication"^^ . . . "GO:0097159"^^ . "organic cyclic compound binding"^^ . . . _:genid11539 . _:genid11539 . _:genid11539 . _:genid11539 . _:genid11540 . _:genid11540 . _:genid11540 . _:genid11540 . "GO:0097194"^^ . "execution phase of apoptosis"^^ . . . . "GO:0097237"^^ . "cellular response to toxic substance"^^ . . . "GO:0097367"^^ . "carbohydrate derivative binding"^^ . . . "Any constituent part of a neuron, the basic cellular unit of nervous tissue. A typical neuron consists of a cell body (often called the soma), an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the nervous system."^^ . "neuron part"^^ . . . "GO:0097659"^^ . "nucleic acid-templated transcription"^^ . . _:genid11541 . _:genid11542 . _:genid11544 _:genid11543 . _:genid11542 _:genid11544 . _:genid11543 . _:genid11543 . _:genid11543 . _:genid11544 . _:genid11541 _:genid11542 . _:genid11541 . . . _:genid11545 . _:genid11545 . _:genid11545 . _:genid11545 . "GO:0098900"^^ . "regulation of action potential"^^ . . . . "GO:0120031"^^ . "plasma membrane bounded cell projection assembly"^^ . . _:genid11546 . _:genid11547 . _:genid11549 _:genid11548 . _:genid11547 _:genid11549 . _:genid11548 . _:genid11548 . _:genid11548 . _:genid11549 . _:genid11546 _:genid11547 . _:genid11546 . . . _:genid11550 . _:genid11550 . _:genid11550 . _:genid11550 . "GO:0120032"^^ . "regulation of plasma membrane bounded cell projection assembly"^^ . . _:genid11551 . _:genid11552 . _:genid11554 _:genid11553 . _:genid11552 _:genid11554 . _:genid11553 . _:genid11553 . _:genid11553 . _:genid11554 . _:genid11551 _:genid11552 . _:genid11551 . . . _:genid11555 . _:genid11555 . _:genid11555 . _:genid11555 . "GO:0120033"^^ . "negative regulation of plasma membrane bounded cell projection assembly"^^ . . _:genid11556 . _:genid11557 . _:genid11559 _:genid11558 . _:genid11557 _:genid11559 . _:genid11558 . _:genid11558 . _:genid11558 . _:genid11559 . _:genid11556 _:genid11557 . _:genid11556 . . . . _:genid11560 . _:genid11560 . _:genid11560 . _:genid11560 . "GO:0120034"^^ . "positive regulation of plasma membrane bounded cell projection assembly"^^ . . _:genid11561 . _:genid11562 . _:genid11564 _:genid11563 . _:genid11562 _:genid11564 . _:genid11563 . _:genid11563 . _:genid11563 . _:genid11564 . _:genid11561 _:genid11562 . _:genid11561 . . _:genid11565 . _:genid11565 . _:genid11565 . _:genid11565 . "GO:0120035"^^ . "regulation of plasma membrane bounded cell projection organization"^^ . . . "GO:0120036"^^ . "plasma membrane bounded cell projection organization"^^ . . . "GO:0140097"^^ . "catalytic activity, acting on DNA"^^ . . . . "GO:0140352"^^ . "export from cell"^^ . . _:genid11566 . _:genid11567 . _:genid11569 _:genid11568 . _:genid11567 _:genid11569 . _:genid11568 . _:genid11568 . _:genid11568 . _:genid11569 . _:genid11566 _:genid11567 . _:genid11566 . . _:genid11570 . _:genid11570 . _:genid11570 . _:genid11570 . "GO:1900117"^^ . "regulation of execution phase of apoptosis"^^ . . _:genid11571 . _:genid11572 . _:genid11574 _:genid11573 . _:genid11572 _:genid11574 . _:genid11573 . _:genid11573 . _:genid11573 . _:genid11574 . _:genid11571 _:genid11572 . _:genid11571 . . . _:genid11575 . _:genid11575 . _:genid11575 . _:genid11575 . "GO:1900118"^^ . "negative regulation of execution phase of apoptosis"^^ . . _:genid11576 . _:genid11577 . _:genid11579 _:genid11578 . _:genid11577 _:genid11579 . _:genid11578 . _:genid11578 . _:genid11578 . _:genid11579 . _:genid11576 _:genid11577 . _:genid11576 . . . _:genid11580 . _:genid11580 . _:genid11580 . _:genid11580 . "GO:1900119"^^ . "positive regulation of execution phase of apoptosis"^^ . . _:genid11581 . _:genid11582 . _:genid11584 _:genid11583 . _:genid11582 _:genid11584 . _:genid11583 . _:genid11583 . _:genid11583 . _:genid11584 . _:genid11581 _:genid11582 . _:genid11581 . . _:genid11585 . _:genid11585 . _:genid11585 . _:genid11585 . "GO:1900130"^^ . "regulation of lipid binding"^^ . . _:genid11586 . _:genid11587 . _:genid11589 _:genid11588 . _:genid11587 _:genid11589 . _:genid11588 . _:genid11588 . _:genid11588 . _:genid11589 . _:genid11586 _:genid11587 . _:genid11586 . . . _:genid11590 . _:genid11590 . _:genid11590 . _:genid11590 . "GO:1900131"^^ . "negative regulation of lipid binding"^^ . . _:genid11591 . _:genid11592 . _:genid11594 _:genid11593 . _:genid11592 _:genid11594 . _:genid11593 . _:genid11593 . _:genid11593 . _:genid11594 . _:genid11591 _:genid11592 . _:genid11591 . . . _:genid11595 . _:genid11595 . _:genid11595 . _:genid11595 . "GO:1900132"^^ . "positive regulation of lipid binding"^^ . . _:genid11596 . _:genid11597 . _:genid11599 _:genid11598 . _:genid11597 _:genid11599 . _:genid11598 . _:genid11598 . _:genid11598 . _:genid11599 . _:genid11596 _:genid11597 . _:genid11596 . . . _:genid11600 . _:genid11600 . _:genid11600 . _:genid11600 . "GO:1900139"^^ . "negative regulation of arachidonic acid secretion"^^ . . _:genid11601 . _:genid11602 . _:genid11604 _:genid11603 . _:genid11602 _:genid11604 . _:genid11603 . _:genid11603 . _:genid11603 . _:genid11604 . _:genid11601 _:genid11602 . _:genid11601 . . . _:genid11605 . _:genid11605 . _:genid11605 . _:genid11605 . "GO:1900368"^^ . "regulation of RNA interference"^^ . . _:genid11606 . _:genid11607 . _:genid11609 _:genid11608 . _:genid11607 _:genid11609 . _:genid11608 . _:genid11608 . _:genid11608 . _:genid11609 . _:genid11606 _:genid11607 . _:genid11606 . . . . _:genid11610 . _:genid11610 . _:genid11610 . _:genid11610 . "GO:1900369"^^ . "negative regulation of RNA interference"^^ . . _:genid11611 . _:genid11612 . _:genid11614 _:genid11613 . _:genid11612 _:genid11614 . _:genid11613 . _:genid11613 . _:genid11613 . _:genid11614 . _:genid11611 _:genid11612 . _:genid11611 . . . _:genid11615 . _:genid11615 . _:genid11615 . _:genid11615 . "GO:1900370"^^ . "positive regulation of RNA interference"^^ . . . . . . . "GO:1901328"^^ . "response to cytochalasin B"^^ . . . "GO:1901360"^^ . "organic cyclic compound metabolic process"^^ . . . . "GO:1901361"^^ . "organic cyclic compound catabolic process"^^ . . . . "GO:1901362"^^ . "organic cyclic compound biosynthetic process"^^ . . . "GO:1901363"^^ . "heterocyclic compound binding"^^ . . . . "GO:1901564"^^ . "organonitrogen compound metabolic process"^^ . . . . "GO:1901566"^^ . "organonitrogen compound biosynthetic process"^^ . . . "GO:1901571"^^ . "fatty acid derivative transport"^^ . . . . "GO:1901575"^^ . "organic substance catabolic process"^^ . . . . "GO:1901576"^^ . "organic substance biosynthetic process"^^ . . . "GO:1901698"^^ . "response to nitrogen compound"^^ . . . . "GO:1901699"^^ . "cellular response to nitrogen compound"^^ . . . "GO:1901700"^^ . "response to oxygen-containing compound"^^ . . . . "GO:1901701"^^ . "cellular response to oxygen-containing compound"^^ . . _:genid11616 . _:genid11617 . _:genid11619 _:genid11618 . _:genid11617 _:genid11619 . _:genid11618 . _:genid11618 . _:genid11618 . _:genid11619 . _:genid11616 _:genid11617 . _:genid11616 . . . _:genid11620 . _:genid11620 . _:genid11620 . _:genid11620 . "GO:1902337"^^ . "regulation of apoptotic process involved in morphogenesis"^^ . . _:genid11621 . _:genid11622 . _:genid11624 _:genid11623 . _:genid11622 _:genid11624 . _:genid11623 . _:genid11623 . _:genid11623 . _:genid11624 . _:genid11621 _:genid11622 . _:genid11621 . . . _:genid11625 . _:genid11625 . _:genid11625 . _:genid11625 . "GO:1902338"^^ . "negative regulation of apoptotic process involved in morphogenesis"^^ . . _:genid11626 . _:genid11627 . _:genid11629 _:genid11628 . _:genid11627 _:genid11629 . _:genid11628 . _:genid11628 . _:genid11628 . _:genid11629 . _:genid11626 _:genid11627 . _:genid11626 . . . _:genid11630 . _:genid11630 . _:genid11630 . _:genid11630 . "GO:1902339"^^ . "positive regulation of apoptotic process involved in morphogenesis"^^ . . . "GO:1902494"^^ . "catalytic complex"^^ . . _:genid11631 . _:genid11632 . _:genid11634 _:genid11633 . _:genid11632 _:genid11634 . _:genid11633 . _:genid11633 . _:genid11633 . _:genid11634 . _:genid11631 _:genid11632 . _:genid11631 . . . . _:genid11635 . _:genid11635 . _:genid11635 . _:genid11635 . "GO:1902510"^^ . "regulation of apoptotic DNA fragmentation"^^ . . _:genid11636 . _:genid11637 . _:genid11639 _:genid11638 . _:genid11637 _:genid11639 . _:genid11638 . _:genid11638 . _:genid11638 . _:genid11639 . _:genid11636 _:genid11637 . _:genid11636 . . . . . _:genid11640 . _:genid11640 . _:genid11640 . _:genid11640 . "GO:1902511"^^ . "negative regulation of apoptotic DNA fragmentation"^^ . . _:genid11641 . _:genid11642 . _:genid11644 _:genid11643 . _:genid11642 _:genid11644 . _:genid11643 . _:genid11643 . _:genid11643 . _:genid11644 . _:genid11641 _:genid11642 . _:genid11641 . . . . . _:genid11645 . _:genid11645 . _:genid11645 . _:genid11645 . "GO:1902512"^^ . "positive regulation of apoptotic DNA fragmentation"^^ . . _:genid11646 . _:genid11647 . _:genid11649 _:genid11648 . _:genid11647 _:genid11649 . _:genid11648 . _:genid11648 . _:genid11648 . _:genid11649 . _:genid11646 _:genid11647 . _:genid11646 . . . . . _:genid11650 . _:genid11650 . _:genid11650 . _:genid11650 . "GO:1902679"^^ . "negative regulation of RNA biosynthetic process"^^ . . _:genid11651 . _:genid11652 . _:genid11654 _:genid11653 . _:genid11652 _:genid11654 . _:genid11653 . _:genid11653 . _:genid11653 . _:genid11654 . _:genid11651 _:genid11652 . _:genid11651 . . . . . _:genid11655 . _:genid11655 . _:genid11655 . _:genid11655 . "GO:1902680"^^ . "positive regulation of RNA biosynthetic process"^^ . . _:genid11656 . _:genid11657 . _:genid11659 _:genid11658 . _:genid11657 _:genid11659 . _:genid11658 . _:genid11658 . _:genid11658 . _:genid11659 . _:genid11656 _:genid11657 . _:genid11656 . . _:genid11660 . _:genid11660 . _:genid11660 . _:genid11660 . "GO:1902742"^^ . "apoptotic process involved in development"^^ . . _:genid11661 . _:genid11662 . _:genid11664 _:genid11663 . _:genid11662 _:genid11664 . _:genid11663 . _:genid11663 . _:genid11663 . _:genid11664 . _:genid11661 _:genid11662 . _:genid11661 . . _:genid11665 . _:genid11665 . _:genid11665 . _:genid11665 . "GO:1903034"^^ . "regulation of response to wounding"^^ . . _:genid11666 . _:genid11667 . _:genid11669 _:genid11668 . _:genid11667 _:genid11669 . _:genid11668 . _:genid11668 . _:genid11668 . _:genid11669 . _:genid11666 _:genid11667 . _:genid11666 . . . _:genid11670 . _:genid11670 . _:genid11670 . _:genid11670 . "GO:1903035"^^ . "negative regulation of response to wounding"^^ . . _:genid11671 . _:genid11672 . _:genid11674 _:genid11673 . _:genid11672 _:genid11674 . _:genid11673 . _:genid11673 . _:genid11673 . _:genid11674 . _:genid11671 _:genid11672 . _:genid11671 . . . _:genid11675 . _:genid11675 . _:genid11675 . _:genid11675 . "GO:1903036"^^ . "positive regulation of response to wounding"^^ . . _:genid11676 . _:genid11677 . _:genid11679 _:genid11678 . _:genid11677 _:genid11679 . _:genid11678 . _:genid11678 . _:genid11678 . _:genid11679 . _:genid11676 _:genid11677 . _:genid11676 . . _:genid11680 . _:genid11680 . _:genid11680 . _:genid11680 . "GO:1903353"^^ . "regulation of nucleus organization"^^ . . _:genid11681 . _:genid11682 . _:genid11684 _:genid11683 . _:genid11682 _:genid11684 . _:genid11683 . _:genid11683 . _:genid11683 . _:genid11684 . _:genid11681 _:genid11682 . _:genid11681 . . _:genid11685 . _:genid11685 . _:genid11685 . _:genid11685 . "GO:1903506"^^ . "regulation of nucleic acid-templated transcription"^^ . . _:genid11686 . _:genid11687 . _:genid11689 _:genid11688 . _:genid11687 _:genid11689 . _:genid11688 . _:genid11688 . _:genid11688 . _:genid11689 . _:genid11686 _:genid11687 . _:genid11686 . . . _:genid11690 . _:genid11690 . _:genid11690 . _:genid11690 . "GO:1903507"^^ . "negative regulation of nucleic acid-templated transcription"^^ . . _:genid11691 . _:genid11692 . _:genid11694 _:genid11693 . _:genid11692 _:genid11694 . _:genid11693 . _:genid11693 . _:genid11693 . _:genid11694 . _:genid11691 _:genid11692 . _:genid11691 . . . _:genid11695 . _:genid11695 . _:genid11695 . _:genid11695 . "GO:1903508"^^ . "positive regulation of nucleic acid-templated transcription"^^ . . _:genid11696 . _:genid11697 . _:genid11699 _:genid11698 . _:genid11697 _:genid11699 . _:genid11698 . _:genid11698 . _:genid11698 . _:genid11699 . _:genid11696 _:genid11697 . _:genid11696 . . . _:genid11700 . _:genid11700 . _:genid11700 . _:genid11700 . "GO:1903530"^^ . "regulation of secretion by cell"^^ . . _:genid11701 . _:genid11702 . _:genid11704 _:genid11703 . _:genid11702 _:genid11704 . _:genid11703 . _:genid11703 . _:genid11703 . _:genid11704 . _:genid11701 _:genid11702 . _:genid11701 . . . . _:genid11705 . _:genid11705 . _:genid11705 . _:genid11705 . "GO:1903531"^^ . "negative regulation of secretion by cell"^^ . . _:genid11706 . _:genid11707 . _:genid11709 _:genid11708 . _:genid11707 _:genid11709 . _:genid11708 . _:genid11708 . _:genid11708 . _:genid11709 . _:genid11706 _:genid11707 . _:genid11706 . . . . _:genid11710 . _:genid11710 . _:genid11710 . _:genid11710 . "GO:1903532"^^ . "positive regulation of secretion by cell"^^ . . _:genid11711 . _:genid11712 . _:genid11714 _:genid11713 . _:genid11712 _:genid11714 . _:genid11713 . _:genid11713 . _:genid11713 . _:genid11714 . _:genid11711 _:genid11712 . _:genid11711 . . _:genid11715 . _:genid11715 . _:genid11715 . _:genid11715 . "GO:1903555"^^ . "regulation of tumor necrosis factor superfamily cytokine production"^^ . . _:genid11716 . _:genid11717 . _:genid11719 _:genid11718 . _:genid11717 _:genid11719 . _:genid11718 . _:genid11718 . _:genid11718 . _:genid11719 . _:genid11716 _:genid11717 . _:genid11716 . . . _:genid11720 . _:genid11720 . _:genid11720 . _:genid11720 . "GO:1903556"^^ . "negative regulation of tumor necrosis factor superfamily cytokine production"^^ . . _:genid11721 . _:genid11722 . _:genid11724 _:genid11723 . _:genid11722 _:genid11724 . _:genid11723 . _:genid11723 . _:genid11723 . _:genid11724 . _:genid11721 _:genid11722 . _:genid11721 . . . _:genid11725 . _:genid11725 . _:genid11725 . _:genid11725 . "GO:1903557"^^ . "positive regulation of tumor necrosis factor superfamily cytokine production"^^ . . _:genid11726 . _:genid11727 . _:genid11729 _:genid11728 . _:genid11727 _:genid11729 . _:genid11728 . _:genid11728 . _:genid11728 . _:genid11729 . _:genid11726 _:genid11727 . _:genid11726 . . . _:genid11730 . _:genid11730 . _:genid11730 . _:genid11730 . "GO:1903624"^^ . "regulation of DNA catabolic process"^^ . . _:genid11731 . _:genid11732 . _:genid11734 _:genid11733 . _:genid11732 _:genid11734 . _:genid11733 . _:genid11733 . _:genid11733 . _:genid11734 . _:genid11731 _:genid11732 . _:genid11731 . . . . _:genid11735 . _:genid11735 . _:genid11735 . _:genid11735 . "GO:1903625"^^ . "negative regulation of DNA catabolic process"^^ . . _:genid11736 . _:genid11737 . _:genid11739 _:genid11738 . _:genid11737 _:genid11739 . _:genid11738 . _:genid11738 . _:genid11738 . _:genid11739 . _:genid11736 _:genid11737 . _:genid11736 . . . . _:genid11740 . _:genid11740 . _:genid11740 . _:genid11740 . "GO:1903626"^^ . "positive regulation of DNA catabolic process"^^ . . _:genid11741 . _:genid11742 . _:genid11744 _:genid11743 . _:genid11742 _:genid11744 . _:genid11743 . _:genid11743 . _:genid11743 . _:genid11744 . _:genid11741 _:genid11742 . _:genid11741 . . . _:genid11745 . _:genid11745 . _:genid11745 . _:genid11745 . "GO:1903792"^^ . "negative regulation of anion transport"^^ . . _:genid11746 . _:genid11747 . _:genid11749 _:genid11748 . _:genid11747 _:genid11749 . _:genid11748 . _:genid11748 . _:genid11748 . _:genid11749 . _:genid11746 _:genid11747 . _:genid11746 . . . _:genid11750 . _:genid11750 . _:genid11750 . _:genid11750 . "GO:1903793"^^ . "positive regulation of anion transport"^^ . . _:genid11751 . _:genid11752 . _:genid11754 _:genid11753 . _:genid11752 _:genid11754 . _:genid11753 . _:genid11753 . _:genid11753 . _:genid11754 . _:genid11751 _:genid11752 . _:genid11751 . . . _:genid11755 . _:genid11755 . _:genid11755 . _:genid11755 . "GO:1903827"^^ . "regulation of cellular protein localization"^^ . . _:genid11756 . _:genid11757 . _:genid11759 _:genid11758 . _:genid11757 _:genid11759 . _:genid11758 . _:genid11758 . _:genid11758 . _:genid11759 . _:genid11756 _:genid11757 . _:genid11756 . . . _:genid11760 . _:genid11760 . _:genid11760 . _:genid11760 . "GO:1903828"^^ . "negative regulation of cellular protein localization"^^ . . _:genid11761 . _:genid11762 . _:genid11764 _:genid11763 . _:genid11762 _:genid11764 . _:genid11763 . _:genid11763 . _:genid11763 . _:genid11764 . _:genid11761 _:genid11762 . _:genid11761 . . . _:genid11765 . _:genid11765 . _:genid11765 . _:genid11765 . "GO:1903829"^^ . "positive regulation of cellular protein localization"^^ . . . . "GO:1903963"^^ . "arachidonate transport"^^ . . _:genid11766 . _:genid11767 . _:genid11769 _:genid11768 . _:genid11767 _:genid11769 . _:genid11768 . _:genid11768 . _:genid11768 . _:genid11769 . _:genid11766 _:genid11767 . _:genid11766 . . _:genid11770 . _:genid11770 . _:genid11770 . _:genid11770 . "GO:1904170"^^ . "regulation of bleb assembly"^^ . . _:genid11771 . _:genid11772 . _:genid11774 _:genid11773 . _:genid11772 _:genid11774 . _:genid11773 . _:genid11773 . _:genid11773 . _:genid11774 . _:genid11771 _:genid11772 . _:genid11771 . . . _:genid11775 . _:genid11775 . _:genid11775 . _:genid11775 . "GO:1904171"^^ . "negative regulation of bleb assembly"^^ . . _:genid11776 . _:genid11777 . _:genid11779 _:genid11778 . _:genid11777 _:genid11779 . _:genid11778 . _:genid11778 . _:genid11778 . _:genid11779 . _:genid11776 _:genid11777 . _:genid11776 . . . _:genid11780 . _:genid11780 . _:genid11780 . _:genid11780 . "GO:1904172"^^ . "positive regulation of bleb assembly"^^ . . _:genid11781 . _:genid11782 . _:genid11784 _:genid11783 . _:genid11782 _:genid11784 . _:genid11783 . _:genid11783 . _:genid11783 . _:genid11784 . _:genid11781 _:genid11782 . _:genid11781 . . . _:genid11785 . _:genid11785 . _:genid11785 . _:genid11785 . "GO:1904467"^^ . "regulation of tumor necrosis factor secretion"^^ . . _:genid11786 . _:genid11787 . _:genid11789 _:genid11788 . _:genid11787 _:genid11789 . _:genid11788 . _:genid11788 . _:genid11788 . _:genid11789 . _:genid11786 _:genid11787 . _:genid11786 . . . . _:genid11790 . _:genid11790 . _:genid11790 . _:genid11790 . "GO:1904468"^^ . "negative regulation of tumor necrosis factor secretion"^^ . . _:genid11791 . _:genid11792 . _:genid11794 _:genid11793 . _:genid11792 _:genid11794 . _:genid11793 . _:genid11793 . _:genid11793 . _:genid11794 . _:genid11791 _:genid11792 . _:genid11791 . . . . _:genid11795 . _:genid11795 . _:genid11795 . _:genid11795 . "GO:1904469"^^ . "positive regulation of tumor necrosis factor secretion"^^ . . _:genid11796 . _:genid11797 . _:genid11799 _:genid11798 . _:genid11797 _:genid11799 . _:genid11798 . _:genid11798 . _:genid11798 . _:genid11799 . _:genid11796 _:genid11797 . _:genid11796 . . . . _:genid11800 . _:genid11800 . _:genid11800 . _:genid11800 . "GO:1904746"^^ . "negative regulation of apoptotic process involved in development"^^ . . _:genid11801 . _:genid11802 . _:genid11804 _:genid11803 . _:genid11802 _:genid11804 . _:genid11803 . _:genid11803 . _:genid11803 . _:genid11804 . _:genid11801 _:genid11802 . _:genid11801 . . . . _:genid11805 . _:genid11805 . _:genid11805 . _:genid11805 . "GO:1904747"^^ . "positive regulation of apoptotic process involved in development"^^ . . _:genid11806 . _:genid11807 . _:genid11809 _:genid11808 . _:genid11807 _:genid11809 . _:genid11808 . _:genid11808 . _:genid11808 . _:genid11809 . _:genid11806 _:genid11807 . _:genid11806 . . . _:genid11810 . _:genid11810 . _:genid11810 . _:genid11810 . "GO:1904748"^^ . "regulation of apoptotic process involved in development"^^ . . _:genid11811 . _:genid11812 . _:genid11814 _:genid11813 . _:genid11812 _:genid11814 . _:genid11813 . _:genid11813 . _:genid11813 . _:genid11814 . _:genid11811 _:genid11812 . _:genid11811 . . . _:genid11815 . _:genid11815 . _:genid11815 . _:genid11815 . "GO:1904796"^^ . "regulation of core promoter binding"^^ . _:genid11816 . _:genid11816 . _:genid11816 . _:genid11816 . _:genid11816 "true"^^ . . _:genid11817 . _:genid11818 . _:genid11820 _:genid11819 . _:genid11818 _:genid11820 . _:genid11819 . _:genid11819 . _:genid11819 . _:genid11820 . _:genid11817 _:genid11818 . _:genid11817 . . . . _:genid11821 . _:genid11821 . _:genid11821 . _:genid11821 . "GO:1904797"^^ . "negative regulation of core promoter binding"^^ . _:genid11822 . _:genid11822 . _:genid11822 . _:genid11822 . _:genid11822 "true"^^ . . _:genid11823 . _:genid11824 . _:genid11826 _:genid11825 . _:genid11824 _:genid11826 . _:genid11825 . _:genid11825 . _:genid11825 . _:genid11826 . _:genid11823 _:genid11824 . _:genid11823 . . . . _:genid11827 . _:genid11827 . _:genid11827 . _:genid11827 . "GO:1904798"^^ . "positive regulation of core promoter binding"^^ . _:genid11828 . _:genid11828 . _:genid11828 . _:genid11828 . _:genid11828 "true"^^ . . _:genid11829 . _:genid11830 . _:genid11832 _:genid11831 . _:genid11830 _:genid11832 . _:genid11831 . _:genid11831 . _:genid11831 . _:genid11832 . _:genid11829 _:genid11830 . _:genid11829 . . . _:genid11833 . _:genid11833 . _:genid11833 . _:genid11833 . "GO:1904950"^^ . "negative regulation of establishment of protein localization"^^ . . _:genid11834 . _:genid11835 . _:genid11837 _:genid11836 . _:genid11835 _:genid11837 . _:genid11836 . _:genid11836 . _:genid11836 . _:genid11837 . _:genid11834 _:genid11835 . _:genid11834 . . . _:genid11838 . _:genid11838 . _:genid11838 . _:genid11838 . "GO:1904951"^^ . "positive regulation of establishment of protein localization"^^ . . _:genid11839 . _:genid11840 . _:genid11842 _:genid11841 . _:genid11840 _:genid11842 . _:genid11841 . _:genid11841 . _:genid11841 . _:genid11842 . _:genid11839 _:genid11840 . _:genid11839 . . . _:genid11843 . _:genid11843 . _:genid11843 . _:genid11843 . "GO:1905642"^^ . "negative regulation of DNA methylation"^^ . . _:genid11844 . _:genid11845 . _:genid11847 _:genid11846 . _:genid11845 _:genid11847 . _:genid11846 . _:genid11846 . _:genid11846 . _:genid11847 . _:genid11844 _:genid11845 . _:genid11844 . . . _:genid11848 . _:genid11848 . _:genid11848 . _:genid11848 . "GO:1905643"^^ . "positive regulation of DNA methylation"^^ . . _:genid11849 . _:genid11850 . _:genid11852 _:genid11851 . _:genid11850 _:genid11852 . _:genid11851 . _:genid11851 . _:genid11851 . _:genid11852 . _:genid11849 _:genid11850 . _:genid11849 . . _:genid11853 . _:genid11853 . _:genid11853 . _:genid11853 . "GO:1905952"^^ . "regulation of lipid localization"^^ . . _:genid11854 . _:genid11855 . _:genid11857 _:genid11856 . _:genid11855 _:genid11857 . _:genid11856 . _:genid11856 . _:genid11856 . _:genid11857 . _:genid11854 _:genid11855 . _:genid11854 . . . _:genid11858 . _:genid11858 . _:genid11858 . _:genid11858 . "GO:1905953"^^ . "negative regulation of lipid localization"^^ . . _:genid11859 . _:genid11860 . _:genid11862 _:genid11861 . _:genid11860 _:genid11862 . _:genid11861 . _:genid11861 . _:genid11861 . _:genid11862 . _:genid11859 _:genid11860 . _:genid11859 . . . _:genid11863 . _:genid11863 . _:genid11863 . _:genid11863 . "GO:1905954"^^ . "positive regulation of lipid localization"^^ . . . "GO:1990234"^^ . "transferase complex"^^ . . . _:genid11864 . _:genid11864 . _:genid11864 . _:genid11864 . "GO:1990774"^^ . "tumor necrosis factor secretion"^^ . . _:genid11865 . _:genid11866 . _:genid11868 _:genid11867 . _:genid11866 _:genid11868 . _:genid11867 . _:genid11867 . _:genid11867 . _:genid11868 . _:genid11865 _:genid11866 . _:genid11865 . . . _:genid11869 . _:genid11869 . _:genid11869 . _:genid11869 . "GO:2000112"^^ . "regulation of cellular macromolecule biosynthetic process"^^ . . _:genid11870 . _:genid11871 . _:genid11873 _:genid11872 . _:genid11871 _:genid11873 . _:genid11872 . _:genid11872 . _:genid11872 . _:genid11873 . _:genid11870 _:genid11871 . _:genid11870 . . . . _:genid11874 . _:genid11874 . _:genid11874 . _:genid11874 . "GO:2000113"^^ . "negative regulation of cellular macromolecule biosynthetic process"^^ . . _:genid11875 . _:genid11876 . _:genid11878 _:genid11877 . _:genid11876 _:genid11878 . _:genid11877 . _:genid11877 . _:genid11877 . _:genid11878 . _:genid11875 _:genid11876 . _:genid11875 . . . _:genid11879 . _:genid11879 . _:genid11879 . _:genid11879 . "GO:2000145"^^ . "regulation of cell motility"^^ . . _:genid11880 . _:genid11881 . _:genid11883 _:genid11882 . _:genid11881 _:genid11883 . _:genid11882 . _:genid11882 . _:genid11882 . _:genid11883 . _:genid11880 _:genid11881 . _:genid11880 . . . . _:genid11884 . _:genid11884 . _:genid11884 . _:genid11884 . "GO:2000146"^^ . "negative regulation of cell motility"^^ . . _:genid11885 . _:genid11886 . _:genid11888 _:genid11887 . _:genid11886 _:genid11888 . _:genid11887 . _:genid11887 . _:genid11887 . _:genid11888 . _:genid11885 _:genid11886 . _:genid11885 . . . . _:genid11889 . _:genid11889 . _:genid11889 . _:genid11889 . "GO:2000147"^^ . "positive regulation of cell motility"^^ . . _:genid11890 . _:genid11891 . _:genid11893 _:genid11892 . _:genid11891 _:genid11893 . _:genid11892 . _:genid11892 . _:genid11892 . _:genid11893 . _:genid11890 _:genid11891 . _:genid11890 . . . . _:genid11894 . _:genid11894 . _:genid11894 . _:genid11894 . "GO:2000191"^^ . "regulation of fatty acid transport"^^ . . _:genid11895 . _:genid11896 . _:genid11898 _:genid11897 . _:genid11896 _:genid11898 . _:genid11897 . _:genid11897 . _:genid11897 . _:genid11898 . _:genid11895 _:genid11896 . _:genid11895 . . . . . _:genid11899 . _:genid11899 . _:genid11899 . _:genid11899 . "GO:2000192"^^ . "negative regulation of fatty acid transport"^^ . . _:genid11900 . _:genid11901 . _:genid11903 _:genid11902 . _:genid11901 _:genid11903 . _:genid11902 . _:genid11902 . _:genid11902 . _:genid11903 . _:genid11900 _:genid11901 . _:genid11900 . . . . . _:genid11904 . _:genid11904 . _:genid11904 . _:genid11904 . "GO:2000193"^^ . "positive regulation of fatty acid transport"^^ . . _:genid11905 . _:genid11906 . _:genid11908 _:genid11907 . _:genid11906 _:genid11908 . _:genid11907 . _:genid11907 . _:genid11907 . _:genid11908 . _:genid11905 _:genid11906 . _:genid11905 . . . _:genid11909 . _:genid11909 . _:genid11909 . _:genid11909 . "GO:2000278"^^ . "regulation of DNA biosynthetic process"^^ . . _:genid11910 . _:genid11911 . _:genid11913 _:genid11912 . _:genid11911 _:genid11913 . _:genid11912 . _:genid11912 . _:genid11912 . _:genid11913 . _:genid11910 _:genid11911 . _:genid11910 . . . . _:genid11914 . _:genid11914 . _:genid11914 . _:genid11914 . "GO:2000279"^^ . "negative regulation of DNA biosynthetic process"^^ . . _:genid11915 . _:genid11916 . _:genid11918 _:genid11917 . _:genid11916 _:genid11918 . _:genid11917 . _:genid11917 . _:genid11917 . _:genid11918 . _:genid11915 _:genid11916 . _:genid11915 . . . . . _:genid11919 . _:genid11919 . _:genid11919 . _:genid11919 . "GO:2000573"^^ . "positive regulation of DNA biosynthetic process"^^ . . _:genid11920 . _:genid11921 . _:genid11923 _:genid11922 . _:genid11921 _:genid11923 . _:genid11922 . _:genid11922 . _:genid11922 . _:genid11923 . _:genid11920 _:genid11921 . _:genid11920 . . _:genid11924 . _:genid11924 . _:genid11924 . _:genid11924 . "GO:2000677"^^ . "regulation of transcription regulatory region DNA binding"^^ . . _:genid11925 . _:genid11926 . _:genid11928 _:genid11927 . _:genid11926 _:genid11928 . _:genid11927 . _:genid11927 . _:genid11927 . _:genid11928 . _:genid11925 _:genid11926 . _:genid11925 . . . _:genid11929 . _:genid11929 . _:genid11929 . _:genid11929 . "GO:2000678"^^ . "negative regulation of transcription regulatory region DNA binding"^^ . . _:genid11930 . _:genid11931 . _:genid11933 _:genid11932 . _:genid11931 _:genid11933 . _:genid11932 . _:genid11932 . _:genid11932 . _:genid11933 . _:genid11930 _:genid11931 . _:genid11930 . . . _:genid11934 . _:genid11934 . _:genid11934 . _:genid11934 . "GO:2000679"^^ . "positive regulation of transcription regulatory region DNA binding"^^ . . _:genid11935 . _:genid11936 . _:genid11938 _:genid11937 . _:genid11936 _:genid11938 . _:genid11937 . _:genid11937 . _:genid11937 . _:genid11938 . _:genid11935 _:genid11936 . _:genid11935 . . _:genid11939 . _:genid11939 . _:genid11939 . _:genid11939 . "GO:2001020"^^ . "regulation of response to DNA damage stimulus"^^ . . _:genid11940 . _:genid11941 . _:genid11943 _:genid11942 . _:genid11941 _:genid11943 . _:genid11942 . _:genid11942 . _:genid11942 . _:genid11943 . _:genid11940 _:genid11941 . _:genid11940 . . . . _:genid11944 . _:genid11944 . _:genid11944 . _:genid11944 . "GO:2001021"^^ . "negative regulation of response to DNA damage stimulus"^^ . . _:genid11945 . _:genid11946 . _:genid11948 _:genid11947 . _:genid11946 _:genid11948 . _:genid11947 . _:genid11947 . _:genid11947 . _:genid11948 . _:genid11945 _:genid11946 . _:genid11945 . . . . _:genid11949 . _:genid11949 . _:genid11949 . _:genid11949 . "GO:2001022"^^ . "positive regulation of response to DNA damage stimulus"^^ . . _:genid11950 . _:genid11951 . _:genid11953 _:genid11952 . _:genid11951 _:genid11953 . _:genid11952 . _:genid11952 . _:genid11952 . _:genid11953 . _:genid11950 _:genid11951 . _:genid11950 . . _:genid11954 . _:genid11954 . _:genid11954 . _:genid11954 . "GO:2001023"^^ . "regulation of response to drug"^^ . . _:genid11955 . _:genid11956 . _:genid11958 _:genid11957 . _:genid11956 _:genid11958 . _:genid11957 . _:genid11957 . _:genid11957 . _:genid11958 . _:genid11955 _:genid11956 . _:genid11955 . . . _:genid11959 . _:genid11959 . _:genid11959 . _:genid11959 . "GO:2001024"^^ . "negative regulation of response to drug"^^ . . _:genid11960 . _:genid11961 . _:genid11963 _:genid11962 . _:genid11961 _:genid11963 . _:genid11962 . _:genid11962 . _:genid11962 . _:genid11963 . _:genid11960 _:genid11961 . _:genid11960 . . . _:genid11964 . _:genid11964 . _:genid11964 . _:genid11964 . "GO:2001025"^^ . "positive regulation of response to drug"^^ . . _:genid11965 . _:genid11966 . _:genid11968 _:genid11967 . _:genid11966 _:genid11968 . _:genid11967 . _:genid11967 . _:genid11967 . _:genid11968 . _:genid11965 _:genid11966 . _:genid11965 . . . _:genid11969 . _:genid11969 . _:genid11969 . _:genid11969 . "GO:2001038"^^ . "regulation of cellular response to drug"^^ . . _:genid11970 . _:genid11971 . _:genid11973 _:genid11972 . _:genid11971 _:genid11973 . _:genid11972 . _:genid11972 . _:genid11972 . _:genid11973 . _:genid11970 _:genid11971 . _:genid11970 . . . . _:genid11974 . _:genid11974 . _:genid11974 . _:genid11974 . "GO:2001039"^^ . "negative regulation of cellular response to drug"^^ . . _:genid11975 . _:genid11976 . _:genid11978 _:genid11977 . _:genid11976 _:genid11978 . _:genid11977 . _:genid11977 . _:genid11977 . _:genid11978 . _:genid11975 _:genid11976 . _:genid11975 . . . . _:genid11979 . _:genid11979 . _:genid11979 . _:genid11979 . "GO:2001040"^^ . "positive regulation of cellular response to drug"^^ . . _:genid11980 . _:genid11981 . _:genid11983 _:genid11982 . _:genid11981 _:genid11983 . _:genid11982 . _:genid11982 . _:genid11982 . _:genid11983 . _:genid11980 _:genid11981 . _:genid11980 . . . . _:genid11984 . _:genid11984 . _:genid11984 . _:genid11984 . "GO:2001141"^^ . "regulation of RNA biosynthetic process"^^ . . _:genid11985 . _:genid11986 . _:genid11988 _:genid11987 . _:genid11986 _:genid11988 . _:genid11987 . _:genid11987 . _:genid11987 . _:genid11988 . _:genid11985 _:genid11986 . _:genid11985 . . . _:genid11989 . _:genid11989 . _:genid11989 . _:genid11989 . "GO:2001251"^^ . "negative regulation of chromosome organization"^^ . . _:genid11990 . _:genid11991 . _:genid11993 _:genid11992 . _:genid11991 _:genid11993 . _:genid11992 . _:genid11992 . _:genid11992 . _:genid11993 . _:genid11990 _:genid11991 . _:genid11990 . . . _:genid11994 . _:genid11994 . _:genid11994 . _:genid11994 . "GO:2001252"^^ . "positive regulation of chromosome organization"^^ . . . "A measurement unit label is as a label that is part of a scalar measurement datum and denotes a unit of measure."@en . "measurement unit label"@en . . . "a directive information entity that describes an intended process endpoint. When part of a plan specification the concretization is realized in a planned process in which the bearer tries to effect the world so that the process endpoint is achieved."@en . "objective specification"@en . . . "a directive information entity that describes an action the bearer will take"@en . "action specification"@en . . . "A label is a symbol that is part of some other datum and is used to either partially define the denotation of that datum or to provide a means for identifying the datum as a member of the set of data with the same label"@en . "datum label"@en . . _:genid11995 . _:genid11996 . _:genid11998 _:genid11997 . _:genid11996 _:genid11998 . _:genid11997 . _:genid11997 . _:genid11997 . _:genid11998 . _:genid11995 _:genid11996 . _:genid11995 . . "A quality of an information bearer that imparts the information content"@en . "information carrier"@en . . . "a data item is an information content entity that is intended to be a truthful statement about something (modulo, e.g., measurement precision or other systematic errors) and is constructed/acquired by a method which reliably tends to produce (approximately) truthful statements."@en . "data item"@en . . . _:genid11999 . _:genid11999 . _:genid11999 . _:genid11999 . "A generically dependent continuant that is about some thing."@en . "information content entity"@en . . . _:genid12000 . _:genid12000 . _:genid12000 . _:genid12000 . _:genid12001 . _:genid12001 . _:genid12001 "1"^^ . _:genid12001 . _:genid12002 . _:genid12002 . _:genid12002 "1"^^ . _:genid12002 . "a scalar measurement datum is a measurement datum that is composed of two parts, numerals and a unit label."@en . "scalar measurement datum"@en . . . _:genid12003 . _:genid12003 . _:genid12003 . _:genid12003 . "An information content entity whose concretizations indicate to their bearer how to realize them in a process."@en . "directive information entity"@en . . . "A diagram that presents one or more tuples of information by mapping those tuples in to a two dimensional space in a non arbitrary way."@en . "graph"@en . . . "A plan specification which describes the inputs and output of mathematical functions as well as workflow of execution for achieving an predefined objective. Algorithms are realized usually by means of implementation as computer programs for execution by automata."@en . "algorithm"@en . . . "The curation status of the term. The allowed values come from an enumerated list of predefined terms. See the specification of these instances for more detailed definitions of each enumerated value."@en . "curation status specification"@en . . . "An image is an affine projection to a two dimensional surface, of measurements of some quality of an entity or entities repeated at regular intervals across a spatial range, where the measurements are represented as color and luminosity on the projected on surface."@en . "image"@en . . . "data about an ontology part is a data item about a part of an ontology, for example a term"@en . "data about an ontology part"@en . . . _:genid12004 . _:genid12004 . _:genid12004 . _:genid12004 . _:genid12005 . _:genid12005 . _:genid12005 . _:genid12005 . "A directive information entity with action specifications and objective specifications as parts that, when concretized, is realized in a process in which the bearer tries to achieve the objectives by taking the actions specified."@en . "plan specification"@en . . . _:genid12006 . _:genid12006 . _:genid12006 . _:genid12006 . "A measurement datum is an information content entity that is a recording of the output of a measurement such as produced by a device."@en . "measurement datum"@en . . _:genid12007 . _:genid12008 . _:genid12010 _:genid12009 . _:genid12008 _:genid12010 . _:genid12009 . _:genid12009 . _:genid12011 . _:genid12011 . _:genid12011 . _:genid12009 _:genid12011 . _:genid12010 . _:genid12007 _:genid12008 . _:genid12007 . . "A material entity in which a concretization of an information content entity inheres."@en . "material information bearer"@en . . . "The reason for which a term has been deprecated. The allowed values come from an enumerated list of predefined terms. See the specification of these instances for more detailed definitions of each enumerated value."@en . "obsolescence reason specification"@en . . . "An information content entity consisting of a two dimensional arrangement of information content entities such that the arrangement itself is about something."@en . "figure"@en . . . "A figure that expresses one or more propositions"@en . "diagram"@en . . . "A denotator type indicates how a term should be interpreted from an ontological perspective."^^ . "denotator type"^^ . . . _:genid12012 . _:genid12014 _:genid12013 . _:genid12013 . _:genid12013 . _:genid12013 . _:genid12016 _:genid12015 . _:genid12014 _:genid12016 . _:genid12015 . _:genid12015 . _:genid12015 . _:genid12016 . _:genid12012 _:genid12014 . _:genid12012 . "A scalar measurement datum that is the result of measurement of mass quality"@en . "mass measurement datum"@en . . . _:genid12017 . _:genid12019 _:genid12018 . _:genid12018 . _:genid12018 . _:genid12018 . _:genid12021 _:genid12020 . _:genid12019 _:genid12021 . _:genid12020 . _:genid12020 . _:genid12020 . _:genid12021 . _:genid12017 _:genid12019 . _:genid12017 . "A scalar measurement datum that is the result of measuring a temporal interval"@en . "time measurement datum"@en . . . "A line graph is a type of graph created by connecting a series of data\npoints together with a line."@en . "line graph"@en . . . "A part of an extended organism that itself has as part a population of one or more infectious agents and that (1) exists as a result of processes initiated by members of the infectious agent population and is (2) clinically abnormal in virtue of the presence of this infectious agent population, or (3) has a disposition to bring clinical abnormality to immunocompetent organisms of the same Species as the host (the organism corresponding to the extended organism) through transmission of a member or offspring of a member of the infectious agent population."@en . "infection"@en . . . "Viruses"^^ . . . "Euteleostomi"^^ . . . "Bacteria"^^ . . . "Archaea"^^ . . . "Eukaryota"^^ . . . "Euarchontoglires"^^ . . . "Tetrapoda"^^ . . . "Amniota"^^ . . . "Opisthokonta"^^ . . . "Bilateria"^^ . . . "Mammalia"^^ . . . "Vertebrata "^^ . . . "Homo sapiens"^^ . . _:genid12022 . _:genid12022 . _:genid12023 . _:genid12023 . _:genid12023 . _:genid12022 _:genid12023 . _:genid12022 . . "A processual entity that realizes a plan which is the concretization of a plan specification."@en . "planned process"@en . . . "Biological_feature_identification_objective is an objective role carried out by the proposition defining the aim of a study designed to examine or characterize a particular biological feature."@en . "biological feature identification objective"@en . . . _:genid12024 . _:genid12024 . _:genid12024 . _:genid12024 . "a role inhering in a material entity that is realized when characteristics or responses elicited by the substance are used for comparison or reference."@en . "reference substance role"@en . . . _:genid12025 . _:genid12025 . _:genid12025 . _:genid12025 . _:genid12026 . _:genid12026 . _:genid12027 . _:genid12028 . _:genid12030 _:genid12029 . _:genid12028 _:genid12030 . _:genid12029 . _:genid12029 . _:genid12029 . _:genid12030 . _:genid12027 _:genid12028 . _:genid12026 _:genid12027 . _:genid12026 . "Chromatography column in chemistry is a tube and contents (typically glass) used to purify individual chemical compounds from mixtures of compounds. It is often used for preparative applications on scales from micrograms up to kilograms."@en . "chromatography column"@en . . . "is the transplantation of living cells, tissues or \\norgans from one species to another such as from pigs to humans"@en . "xenotransplantation"@en . . _:genid12031 . _:genid12032 . _:genid12034 _:genid12033 . _:genid12032 _:genid12034 . _:genid12033 . _:genid12033 . _:genid12033 . _:genid12034 . _:genid12031 _:genid12032 . _:genid12031 . . "Is a material entity that is created or changed during material processing."@en . "processed material"@en . . . . . _:genid12035 . _:genid12035 . _:genid12035 . _:genid12035 . _:genid12036 . _:genid12036 . _:genid12036 . _:genid12036 . _:genid12037 . _:genid12037 . _:genid12037 . _:genid12037 . _:genid12038 . _:genid12038 . _:genid12038 . _:genid12038 . "a device that facilitates the separation of mixtures. The function of a chromatography device involves passing a mixture dissolved in a \"mobile phase\" through a stationary phase, which separates the analyte to be measured from other molecules in the mixture and allows it to be isolated."@en . "chromatography device"@en . . . _:genid12039 . _:genid12041 _:genid12040 . _:genid12040 . _:genid12040 . _:genid12040 . _:genid12043 _:genid12042 . _:genid12041 _:genid12043 . _:genid12042 . _:genid12042 . _:genid12042 . _:genid12045 _:genid12044 . _:genid12043 _:genid12045 . _:genid12044 . _:genid12044 . _:genid12044 . _:genid12045 . _:genid12039 _:genid12041 . _:genid12039 . _:genid12046 . _:genid12046 . _:genid12047 . _:genid12048 . _:genid12049 . _:genid12048 _:genid12049 . _:genid12049 . _:genid12047 _:genid12048 . _:genid12046 _:genid12047 . _:genid12046 . _:genid12050 . _:genid12050 . _:genid12050 . _:genid12050 . _:genid12051 . _:genid12051 . _:genid12051 . _:genid12051 . "A mass spectrometer is an instrument which is used to measure the mass to charge ratio of ions. All mass spectrometers consist of three basic parts: an ion source, a mass analyzer, and a detector system. The stages within the mass spectrometer are: 1. Production of ions from the sample 2. Separation of ions with different masses 3. Detection of the number of ions of each mass produced 4.Collection of data to generate the mass spectrum"@en . "mass spectrometer"@en . . . "is the transplantation of organs between members of the same species."@en . "allotransplantation"@en . . . _:genid12052 . _:genid12052 . _:genid12052 . _:genid12052 . "a reference role in which the characteristics or responses elicited by the substance playing the reference substance role are used to establish a \"100%\" response"^^ . "positive reference substance role"@en . . . _:genid12053 . _:genid12053 . _:genid12053 . _:genid12053 . _:genid12054 . _:genid12054 . _:genid12054 . _:genid12054 . "a role that inheres in a material entity that is realized in an assay in which data is generated about the bearer of the evaluant role"@en . "evaluant role"@en . . _:genid12055 . _:genid12055 . _:genid12055 . _:genid12055 . . _:genid12056 . _:genid12056 . _:genid12056 . _:genid12056 . _:genid12057 . _:genid12057 . _:genid12058 . _:genid12059 . _:genid12061 _:genid12060 . _:genid12059 _:genid12061 . _:genid12060 . _:genid12060 . _:genid12060 . _:genid12061 . _:genid12058 _:genid12059 . _:genid12057 _:genid12058 . _:genid12057 . _:genid12062 . _:genid12062 . _:genid12063 . _:genid12064 . _:genid12066 _:genid12065 . _:genid12064 _:genid12066 . _:genid12065 . _:genid12065 . _:genid12067 . _:genid12068 . _:genid12070 _:genid12069 . _:genid12068 _:genid12070 . _:genid12069 . _:genid12069 . _:genid12069 . _:genid12070 . _:genid12067 _:genid12068 . _:genid12065 _:genid12067 . _:genid12066 . _:genid12063 _:genid12064 . _:genid12062 _:genid12063 . _:genid12062 . . "A planned process with the objective to produce information about the material entity that is the evaluant, by physically examining it or its proxies."@en . "assay"@en . . . "a processed material that provides the needed nourishment for microorganisms or cells grown in vitro."^^ . "culture medium"@en . . . "A role inhering in a biological or chemical entity that is intended to be applied in a scientific technique to participate (or have molecular components that participate) in a chemical reaction that facilitates the generation of data about some entity distinct from the bearer, or the generation of some specified material output distinct from the bearer."@en . "reagent role"@en . . _:genid12071 . _:genid12071 . _:genid12071 . _:genid12071 . . _:genid12072 . _:genid12072 . _:genid12072 . _:genid12072 . _:genid12073 . _:genid12073 . _:genid12073 . _:genid12073 . "A planned process which results in physical changes in a specified input material"@en . "material processing"@en . . . _:genid12074 . _:genid12074 . _:genid12074 . _:genid12074 . "A role that is realized through the execution of a study design in which the bearer of the role participates and in which data about that bearer is collected."^^ . "participant under investigation role"@en . . . _:genid12075 . _:genid12075 . _:genid12075 . _:genid12075 . "a protocol application to replace an organ or tissue of an organism"@en . "transplantation"@en . . . _:genid12076 . _:genid12076 . _:genid12077 . _:genid12078 . _:genid12080 _:genid12079 . _:genid12078 _:genid12080 . _:genid12079 . _:genid12079 . _:genid12079 . _:genid12080 . _:genid12077 _:genid12078 . _:genid12076 _:genid12077 . _:genid12076 . "a role borne by a material entity that is gained during a specimen collection process and that can be realized by use of the specimen in an investigation"@en . "specimen role"@en . . . "Sequence_feature_identification_objective is a biological_feature_identification_objective role describing a study designed to examine or characterize molecular features exhibited at the level of a macromolecular sequence, e.g. nucleic acid, protein, polysaccharide."@en . "sequence feature identification objective"@en . . _:genid12081 . _:genid12082 . _:genid12084 _:genid12083 . _:genid12082 _:genid12084 . _:genid12083 . _:genid12083 . _:genid12085 . _:genid12086 . _:genid12088 _:genid12087 . _:genid12086 _:genid12088 . _:genid12087 . _:genid12087 . _:genid12087 . _:genid12088 . _:genid12085 _:genid12086 . _:genid12083 _:genid12085 . _:genid12084 . _:genid12081 _:genid12082 . _:genid12081 . . "An intervention design is a study design in which a controlled process applied to the subjects (the intervention) serves as the independent variable manipulated by the experimentalist. The treatment (perturbation or intervention) defined can be defined as a combination of values taken by independent variable manipulated by the experimentalists are applied to the recruited subjects assigned (possibly by applying specific methods) to treatment groups. The specificity of intervention design is the fact that independent variables are being manipulated and a response of the biological system is evaluated via response variables as monitored by possibly a series of assays."@en . "intervention design"@en . . . "Molecular_feature_identification_objective is a biological_feature_identification_objective role describing a study designed to examine or characterize molecular features of a biological system, e.g. expression profiling, copy number of molecular components, epigenetic modifications."@en . "molecular feature identification objective"@en . . . _:genid12089 . _:genid12089 . _:genid12089 . _:genid12089 . "a device manufacture with the intent to provide a porous unsized paper used for filtering."@en . "filter paper"@en . . . _:genid12090 . _:genid12092 _:genid12091 . _:genid12091 . _:genid12091 . _:genid12091 . _:genid12094 _:genid12093 . _:genid12092 _:genid12094 . _:genid12093 . _:genid12093 . _:genid12093 "2"^^ . _:genid12094 . _:genid12090 _:genid12092 . _:genid12090 . _:genid12095 . _:genid12095 . _:genid12095 . _:genid12095 . _:genid12096 . _:genid12096 . _:genid12096 . _:genid12096 . _:genid12097 . _:genid12097 . _:genid12097 . _:genid12097 . "A material combination in which cell cultures of two or more different types are are combined and allowed to culture as one."@en . "cell co-culturing"@en . . . _:genid12098 . _:genid12098 . _:genid12098 . _:genid12098 . _:genid12099 . _:genid12099 . _:genid12099 . _:genid12099 . "Mixed population of cDNAs (complementaryDNA) made from mRNA from a defined source, usually a specific cell type. This term should be associated only to nucleic acid interactors not to their proteins product. For instance in 2h screening use living cells (MI:0349) as sample process.\n\nALT DEF (PRS):: a cDNA library is a collection of host cells, typically E.Coli cells but not exclusively. modified by transfer of plasmid DNA molecule used as vector containing a fragment or totality of cDNA molecule (the insert) . cDNA library may have an array of role and applications."@en . "cDNA library"@en . . . _:genid12100 . _:genid12100 . _:genid12100 . _:genid12100 . "An assay that produces a picture of an entity."^^ . "imaging assay" . . . _:genid12101 . _:genid12101 . _:genid12101 . _:genid12101 . "A microtiter_plate is a flat plate with multiple wells used as small test tubes."@en . "microtiter plate"@en . . . "An immunoprecipitation in which chromatin (i.e. packaged DNA which can include protein and RNA complexes) is cut into short regions, reversibly cross linked, and antibodies or tags are used to select for pieces of chromatin with desired characteristics."@en . "chromatin immunoprecipitation"@en . . _:genid12102 . _:genid12103 . _:genid12105 _:genid12104 . _:genid12103 _:genid12105 . _:genid12104 . _:genid12104 . _:genid12106 . _:genid12107 . _:genid12109 _:genid12108 . _:genid12107 _:genid12109 . _:genid12108 . _:genid12108 . _:genid12108 . _:genid12109 . _:genid12106 _:genid12107 . _:genid12104 _:genid12106 . _:genid12111 _:genid12110 . _:genid12105 _:genid12111 . _:genid12110 . _:genid12110 . _:genid12112 . _:genid12112 . _:genid12113 . _:genid12114 . _:genid12116 _:genid12115 . _:genid12114 _:genid12116 . _:genid12115 . _:genid12115 . _:genid12115 . _:genid12116 . _:genid12113 _:genid12114 . _:genid12112 _:genid12113 . _:genid12110 _:genid12112 . _:genid12111 . _:genid12102 _:genid12103 . _:genid12102 . . "An assay that measures the amount of radiation in the radioactive spectrum (alpha, beta or gamma rays) emitted from an input material."^^ . "radioactivity detection" . . . "Cellular_feature_identification_objective is a biological_feature_identification_objective role describing a study designed to examine or characterize a biological feature monitored at the cellular level, e.g. stage of cell cycle, stage of differentiation."@en . "cellular feature identification objective"@en . . . _:genid12117 . _:genid12117 . _:genid12118 . _:genid12119 . _:genid12121 _:genid12120 . _:genid12119 _:genid12121 . _:genid12120 . _:genid12120 . _:genid12120 . _:genid12121 . _:genid12118 _:genid12119 . _:genid12117 _:genid12118 . _:genid12117 . _:genid12122 . _:genid12122 . _:genid12122 . _:genid12122 . _:genid12123 . _:genid12123 . _:genid12123 . _:genid12123 . "enzymatic cleavage is a protocol application to digest the fraction of input material that is susceptible to that enzyme"@en . "enzymatic cleavage"@en . . . "An entity that can bear roles, has members, and has a set of organization rules. Members of organizations are either organizations themselves or individual people. Members can bear specific organization member roles that are determined in the organization rules. The organization rules also determine how decisions are made on behalf of the organization by the organization members."@en . "organization"@en . . . "A molecular label role which inheres in a material entity and which is realized in the process of detecting a molecular dye that imparts color to some material of interest. "^^ . "dye role"@en . . . _:genid12124 . _:genid12124 . _:genid12124 . _:genid12124 . "Is a material transformation in which strands of nucleic acids that are (somewhat) complementary form a double-stranded molecule. Has input at least two single stranded molecules of nucleic acid molecules."@en . "artificially induced nucleic acid hybridization"@en . . . _:genid12125 . _:genid12125 . _:genid12125 . _:genid12125 . "A DNA extraction is a nucleic acid extraction where the desired output material is DNA."@en . "DNA extraction"@en . . . "Organism_feature_identification_objective is a biological_feature_identification_objective role describing a study designed to examine or characterize a biological feature monitored at the level of the organism, e.g. height, weight, stage of development, stage of life cycle."@en . "organism feature identification objective"@en . . . "A plan specification which has sufficient level of detail and quantitative information to communicate it between investigation agents, so that different investigation agents will reliably be able to independently reproduce the process."@en . "protocol"@en . . _:genid12126 . _:genid12126 . _:genid12126 . _:genid12126 . . _:genid12127 . _:genid12127 . _:genid12127 . _:genid12127 . _:genid12128 . _:genid12128 . _:genid12128 . _:genid12128 . _:genid12129 . _:genid12129 . _:genid12130 . _:genid12131 . _:genid12133 _:genid12132 . _:genid12131 _:genid12133 . _:genid12132 . _:genid12132 . _:genid12132 . _:genid12135 _:genid12134 . _:genid12133 _:genid12135 . _:genid12134 . _:genid12134 . _:genid12136 . _:genid12137 . _:genid12139 _:genid12138 . _:genid12137 _:genid12139 . _:genid12138 . _:genid12138 . _:genid12138 . _:genid12139 . _:genid12136 _:genid12137 . _:genid12134 _:genid12136 . _:genid12135 . _:genid12130 _:genid12131 . _:genid12129 _:genid12130 . _:genid12129 . "is a process with the objective to place a material entity bearing the 'material to be added role' into a material bearing the 'target of material addition role'."@en . "adding a material entity into a target"@en . . . _:genid12140 . _:genid12140 . _:genid12141 . _:genid12142 . _:genid12143 . _:genid12142 _:genid12143 . _:genid12143 . _:genid12141 _:genid12142 . _:genid12140 _:genid12141 . _:genid12140 . "A measurand role borne by a molecular entity or an atom and realized in an analyte assay which achieves the objective to measure the magnitude/concentration/amount of the analyte in the entity bearing evaluant role."@en . "analyte role"@en . . . "An assay that determines interactions between proteins, such as protein-protein binding."^^ . "protein-protein interaction detection assay" . . . _:genid12144 . _:genid12144 . _:genid12145 . _:genid12146 . _:genid12148 _:genid12147 . _:genid12146 _:genid12148 . _:genid12147 . _:genid12147 . _:genid12147 . _:genid12148 . _:genid12145 _:genid12146 . _:genid12144 _:genid12145 . _:genid12144 . _:genid12149 . _:genid12149 . _:genid12149 . _:genid12149 . "a eluate is a material entity which results from an elution, e.g. from a chromatography column. it has as part a material entity with role mobile phase"@en . "eluate"@en . . . "material to be added role is a protocol participant role realized by a material which is added into a material bearing the target of material addition role in a material addition process"@en . "material to be added role"@en . . . . _:genid12150 . _:genid12150 . _:genid12150 . _:genid12150 . _:genid12151 . _:genid12151 . _:genid12151 . _:genid12151 . _:genid12152 . _:genid12152 . _:genid12152 . _:genid12152 . _:genid12153 . _:genid12153 . _:genid12153 . _:genid12153 . "histological sample preparation is the preparation of an input tissue via slicing and labeling to make tissue microstructure of interest visible in a future histology assay"@en . "histological sample preparation"@en . . . . _:genid12154 . _:genid12154 . _:genid12154 . _:genid12154 . _:genid12155 . _:genid12155 . _:genid12155 . _:genid12155 . "A Mass analyzer is a device that separates ions according to their mass-to-charge ratio. All mass spectrometers are based on dynamics of charged particles in electric and magnetic fields in vacuum where the two laws of Lorentz force law and Newton's second law of motion apply."@en . "mass analyzer"@en . . . _:genid12156 . _:genid12156 . _:genid12156 . _:genid12156 . "An ion source is a device that is part of a mass\nspectrometer that ionizes the material under analysis. The ions are\nthen transported by magnetic or electric fields to the mass analyzer.\nTechniques for ionization have been key to determining what types of\nsamples can be analyzed by mass spectrometry. Electron ionization and\nchemical ionization are used for gases and vapors. In chemical\nionization sources, the material is ionized by chemical ion-molecule\nreactions during collisions in the source. Two techniques often used\nwith liquid and solid biological samples include electrospray\nionization (due to John Fenn PMID 2675315.) and matrix-assisted laser\ndesorption/ionization (MALDI, due to M. Karas and F. Hillenkamp\n(Measuring Mass: From Positive Rays to Proteins by Michael A. Grayson\n(Editor) (ISBN 0-941901-31-9)))."@en . "ion source"@en . . . _:genid12157 . _:genid12157 . _:genid12157 . _:genid12157 . "An ion detector is a device that measures and records\nthe charge induced or current produced when an ion passes by or hits a\nsurface. \n\nExample: In a scanning instrument the signal produced in the detector\nduring the course of the scan versus where the instrument is in the\nscan (at what m/Q) will produce a mass spectrum, a record of ions as a\nfunction of m/Q."@en . "ion detector"@en . . . _:genid12158 . _:genid12158 . _:genid12158 . _:genid12158 . "An assay that detects and identifies chemical entities resulting from biochemical and cellular metabolism"^^ . "metabolite profiling assay" . . . "A light emission function is an excitation function to excite a material to a specific excitation state that it emits light."@en . "light emission function"@en . . . "A magnify function is a function to increase the size of a transmitted object image through the precise arrangement of energy diffraction elements along an imaging path."@en . "magnify function"@en . . . "A contain function is a function to constrain a material entities location in space"@en . "contain function"@en . . . "A heat function is a function that increases the internal kinetic energy of a material"@en . "heat function"@en . . . "A material separation function is a function that increases the resolution between two or more material entities. The to distinction between the entities is usually based on some associated physical quality."@en . "material separation function"@en . . . "A excitation function is a function to inject energy by bombarding a material with energetic particles (e.g., photons) thereby imbuing internal material components such as electrons with additional energy. These internal, 'excited' particles may lead to the rupturing of covalent chemical bonds or may quickly relax back to there unexcited state with an exponential time course thereby locally emitting energy in the form of photons."@en . "excitation function"@en . . . "A synthesizing function is a function to assemble new output materials from distinct input materials. The output materials typically consist of chemically distinct monomeric objects or object aggregate polymers."^^ . "synthesizing function"@en . . . "A perturb function is a function that disrupts the normal function of a system induced through either internal or external means. External means of perturbation include: (1) displacement fields in the physical sense - e.g., temperature change, osmotic shock, pressure change; (2) application of small molecules such as drugs or toxins to perturb the function of specific pathways or application of surfactants to perturb the normal function of plasma membrane. Internal means of perturbation include: (1) manipulation of gene function via gene knockout or transcript knockdown via RNAi; (2) directed genetic mutation leading to minimal aa alterations that interfere with peptide function."@en . "perturb function"@en . . . "A filter function is a function to prevent the flow of certain entities based on a quality or qualities of the entity while allowing entities which have different qualities to pass through"@en . "filter function"@en . . . "A mechanical function is a function that is realised via mechanical work (through an certain amount of energy transferred by some force)."@en . "mechanical function"@en . . . "An electricity supply function is an energy supply function to transfer electricity from one source to another, typically a consumer of the electricity or as a stimulus during a neuroscience experiment."@en . "electricity supply function"@en . . . "An ionization function is a function to physically convert an atom or molecule into an ion by adding or removing charged particles such as electrons or other ions."@en . "ionization function"@en . . . "A cool function is a function to decrease the internal kinetic energy of a material below the initial kinetic energy of that type of material."@en . "cool function"@en . . . "An energy supply function is a function to supply or transfer energy from an energy source to a consumer of the energy"@en . "energy supply function"@en . . . _:genid12159 . _:genid12159 . _:genid12159 . _:genid12159 . _:genid12160 . _:genid12160 . _:genid12160 . _:genid12160 . "An image acquisition function is a function to acquire an image of a material"@en . "image acquisition function"@en . . _:genid12161 . _:genid12162 . _:genid12164 _:genid12163 . _:genid12162 _:genid12164 . _:genid12163 . _:genid12163 . _:genid12163 . _:genid12164 . _:genid12161 _:genid12162 . _:genid12161 . . "An image creation device is a device which captures a digitized image of an object"@en . "image creation device"@en . . . "A solid support function is a function of a device on which an entity is kept in a defined position and prevented in its movement"@en . "solid support function"@en . . . "An environmental control function is a function that regulates a contained environment within specified parameter ranges. For example the control of light exposure, humidity and temperature."@en . "environment control function"@en . . . "A sort function is a function to distinguish material components based on some associated physical quality or entity and to partition the separate components into distinct fractions according to a defined order."@en . "sort function"@en . . _:genid12165 . _:genid12166 . _:genid12168 _:genid12167 . _:genid12166 _:genid12168 . _:genid12167 . _:genid12167 . _:genid12167 . _:genid12168 . _:genid12165 _:genid12166 . _:genid12165 . . . "is double stranded DNA that is the specified output of a polymerase chain reaction"@en . "PCR product"@en . . . _:genid12169 . _:genid12169 . _:genid12169 . _:genid12169 . _:genid12170 . _:genid12170 . _:genid12170 . _:genid12170 . "a reference substance role which inheres in nucleic acid material entity and is realized in the process of using the nucleic acid bearing the template role as a reference during synthesis of a reverse copy."^^ . "nucleic acid template role"@en . . . _:genid12171 . _:genid12173 _:genid12172 . _:genid12172 . _:genid12172 . _:genid12172 . _:genid12175 _:genid12174 . _:genid12173 _:genid12175 . _:genid12174 . _:genid12174 . _:genid12174 . _:genid12175 . _:genid12171 _:genid12173 . _:genid12171 . "A material to be added role played by a small, self-replicating DNA or RNA molecule - usually a plasmid or chromosome - and realized in a process whereby foreign DNA or RNA is inserted into the vector during the process of cloning."@en . "cloning vector role"@en . . . _:genid12176 . _:genid12176 . _:genid12177 . _:genid12178 . _:genid12180 _:genid12179 . _:genid12178 _:genid12180 . _:genid12179 . _:genid12179 . _:genid12179 . _:genid12180 . _:genid12177 _:genid12178 . _:genid12176 _:genid12177 . _:genid12176 . _:genid12181 . _:genid12181 . _:genid12181 . _:genid12181 . _:genid12182 . _:genid12182 . _:genid12182 . _:genid12182 . "PCR is the process in which a DNA polymerase is used to amplify a piece of DNA by in vitro enzymatic replication. As PCR progresses, the DNA thus generated is itself used as a template for replication. This sets in motion a chain reaction in which the DNA template is exponentially amplified."@en . "polymerase chain reaction"@en . . . "cloning insert role is a role which inheres in DNA or RNA and is realized by the process of being inserted into a cloning vector in a cloning process."@en . "cloning insert role"@en . . _:genid12183 . _:genid12184 . _:genid12186 _:genid12185 . _:genid12184 _:genid12186 . _:genid12185 . _:genid12185 . _:genid12187 . _:genid12187 . _:genid12187 . _:genid12185 _:genid12187 . _:genid12186 . _:genid12183 _:genid12184 . _:genid12183 . . "enzyme and has_function some GO:0003964 (RNA-directed DNA polymerase\nactivity)"@en . "reverse transcriptase"@en . . . _:genid12188 . _:genid12188 . _:genid12188 . _:genid12188 . "an extract is a material entity which results from an extraction process"@en . "extract"@en . . _:genid12189 . _:genid12190 . _:genid12192 _:genid12191 . _:genid12190 _:genid12192 . _:genid12191 . _:genid12194 _:genid12193 . _:genid12193 . _:genid12193 . _:genid12195 . _:genid12196 . _:genid12198 _:genid12197 . _:genid12196 _:genid12198 . _:genid12197 . _:genid12197 . _:genid12197 . _:genid12198 . _:genid12195 _:genid12196 . _:genid12193 _:genid12195 . _:genid12200 _:genid12199 . _:genid12194 _:genid12200 . _:genid12199 . _:genid12199 . _:genid12201 . _:genid12202 . _:genid12204 _:genid12203 . _:genid12202 _:genid12204 . _:genid12203 . _:genid12203 . _:genid12203 . _:genid12204 . _:genid12201 _:genid12202 . _:genid12199 _:genid12201 . _:genid12200 . _:genid12191 _:genid12194 . _:genid12206 _:genid12205 . _:genid12192 _:genid12206 . _:genid12205 . _:genid12208 _:genid12207 . _:genid12207 . _:genid12207 . _:genid12209 . _:genid12210 . _:genid12212 _:genid12211 . _:genid12210 _:genid12212 . _:genid12211 . _:genid12211 . _:genid12211 . _:genid12212 . _:genid12209 _:genid12210 . _:genid12207 _:genid12209 . _:genid12214 _:genid12213 . _:genid12208 _:genid12214 . _:genid12213 . _:genid12213 . _:genid12213 . _:genid12214 . _:genid12205 _:genid12208 . _:genid12216 _:genid12215 . _:genid12206 _:genid12216 . _:genid12215 . _:genid12215 . _:genid12217 . _:genid12218 . _:genid12220 _:genid12219 . _:genid12218 _:genid12220 . _:genid12219 . _:genid12219 . _:genid12219 . _:genid12220 . _:genid12217 _:genid12218 . _:genid12215 _:genid12217 . _:genid12222 _:genid12221 . _:genid12216 _:genid12222 . _:genid12221 . _:genid12221 . _:genid12221 . _:genid12224 _:genid12223 . _:genid12222 _:genid12224 . _:genid12223 . _:genid12223 . _:genid12225 . _:genid12225 . _:genid12225 . _:genid12223 _:genid12225 . _:genid12227 _:genid12226 . _:genid12224 _:genid12227 . _:genid12226 . _:genid12226 . _:genid12226 . _:genid12227 . _:genid12189 _:genid12190 . _:genid12189 . . "An assay that determines gene expression and transcription activity using ribonucleic acids collected from a material entity."^^ . "transcription profiling assay" . . _:genid12228 . _:genid12229 . _:genid12231 _:genid12230 . _:genid12229 _:genid12231 . _:genid12230 . _:genid12232 . _:genid12233 . _:genid12232 _:genid12233 . _:genid12234 . _:genid12233 _:genid12234 . _:genid12236 _:genid12235 . _:genid12234 _:genid12236 . _:genid12235 . _:genid12235 . _:genid12235 . _:genid12238 _:genid12237 . _:genid12236 _:genid12238 . _:genid12237 . _:genid12237 . _:genid12237 . _:genid12240 _:genid12239 . _:genid12238 _:genid12240 . _:genid12239 . _:genid12239 . _:genid12239 . _:genid12240 . _:genid12230 _:genid12232 . _:genid12242 _:genid12241 . _:genid12231 _:genid12242 . _:genid12241 . _:genid12241 . _:genid12243 . _:genid12243 . _:genid12243 . _:genid12241 _:genid12243 . _:genid12242 . _:genid12228 _:genid12229 . _:genid12228 . . "(protein or rna) or has_part (protein or rna) and\nhas_function some GO:0003824 (catalytic activity)"@en . "enzyme"@en . . . _:genid12244 . _:genid12244 . _:genid12244 . _:genid12244 . _:genid12245 . _:genid12245 . _:genid12245 . _:genid12245 . "a material entity resulting from the polymerization of acrylamide with TEMED in some buffer solution"@en . "polyacrylamide gel"@en . . . "is the specification of an objective to add a material into a target material. The adding is asymmetric in the sense that the target material largely retains its identity"@en . "adding material objective"@en . . . _:genid12246 . _:genid12248 _:genid12247 . _:genid12247 . _:genid12247 . _:genid12249 . _:genid12250 . _:genid12252 _:genid12251 . _:genid12250 _:genid12252 . _:genid12251 . _:genid12251 . _:genid12251 . _:genid12252 . _:genid12249 _:genid12250 . _:genid12247 _:genid12249 . _:genid12254 _:genid12253 . _:genid12248 _:genid12254 . _:genid12253 . _:genid12253 . _:genid12255 . _:genid12256 . _:genid12258 _:genid12257 . _:genid12256 _:genid12258 . _:genid12257 . _:genid12257 . _:genid12257 . _:genid12258 . _:genid12255 _:genid12256 . _:genid12253 _:genid12255 . _:genid12254 . _:genid12246 _:genid12248 . _:genid12246 . _:genid12259 . _:genid12259 . _:genid12260 . _:genid12261 . _:genid12263 _:genid12262 . _:genid12261 _:genid12263 . _:genid12262 . _:genid12262 . _:genid12262 . _:genid12263 . _:genid12260 _:genid12261 . _:genid12259 _:genid12260 . _:genid12259 . _:genid12264 . _:genid12264 . _:genid12264 . _:genid12264 . _:genid12265 . _:genid12265 . _:genid12265 . _:genid12265 . "An assay which generates data about a genotype from a specimen of genomic DNA. A variety of techniques and instruments can be used to produce information about sequence variation at particular genomic positions."^^ . "genotyping assay" . . . "an assay objective to determine the presence or concentration of an analyte in the evaluant"@en . "analyte measurement objective"@en . . . _:genid12266 . _:genid12266 . _:genid12266 . _:genid12266 . "a material entity resulting from the polymerization of agarose after heating agarose suspended in some buffer solution"@en . "agarose gel"@en . . . "an objective specification to determine a specified type of information about an evaluated entity (the material entity bearing evaluant role)"@en . "assay objective"@en . . . _:genid12267 . _:genid12267 . _:genid12267 . _:genid12267 . _:genid12268 . _:genid12268 . _:genid12268 . _:genid12268 . "An assay with the objective to capture information about the presence, concentration, or amount of an analyte in an evaluant."^^ . "analyte assay" . . . _:genid12269 . _:genid12269 . _:genid12269 . _:genid12269 . _:genid12270 . _:genid12270 . _:genid12270 . _:genid12270 . "target of material addition role is a role realized by an entity into which a material is added in a material addition process"^^ . "target of material addition role"@en . . . _:genid12271 . _:genid12271 . _:genid12271 . _:genid12271 . _:genid12272 . _:genid12272 . _:genid12273 . _:genid12273 . _:genid12273 . _:genid12272 _:genid12273 . _:genid12272 . "An electrophysiology recording assay where the recording location of the electrode is intracellular"^^ . "intra cellular electrophysiology recording assay" . . . _:genid12274 . _:genid12274 . _:genid12274 . _:genid12274 . _:genid12275 . _:genid12275 . _:genid12276 . _:genid12276 . _:genid12276 . _:genid12275 _:genid12276 . _:genid12275 . "Measure function is a function that is borne by a processed material and realized in a process in which information about some entity is expressed relative to some reference."@en . "measure function"@en . . . _:genid12277 . _:genid12277 . _:genid12277 . _:genid12277 . _:genid12278 . _:genid12278 . _:genid12279 . _:genid12279 . _:genid12279 . _:genid12278 _:genid12279 . _:genid12278 . "An electrophysiology recording assay where the recording location of the electrode is extracellular"^^ . "extracellular electrophysiology recording assay" . . . "an objective specifiction that creates an specific output object from input materials."@en . "material transformation objective"@en . . . _:genid12280 . _:genid12282 _:genid12281 . _:genid12281 . _:genid12281 . _:genid12283 . _:genid12284 . _:genid12286 _:genid12285 . _:genid12284 _:genid12286 . _:genid12285 . _:genid12285 . _:genid12285 . _:genid12286 . _:genid12283 _:genid12284 . _:genid12281 _:genid12283 . _:genid12288 _:genid12287 . _:genid12282 _:genid12288 . _:genid12287 . _:genid12287 . _:genid12287 . _:genid12288 . _:genid12280 _:genid12282 . _:genid12280 . "An assay that identifies the amount and type of material entities present in a sample by fragmenting the sample and measuring the mass-to-charge ratio of the resulting particles."^^ . "mass spectrometry assay" . . _:genid12289 . _:genid12290 . _:genid12292 _:genid12291 . _:genid12290 _:genid12292 . _:genid12291 . _:genid12291 . _:genid12293 . _:genid12293 . _:genid12293 . _:genid12291 _:genid12293 . _:genid12292 . _:genid12289 _:genid12290 . _:genid12289 . . "a planned process that carries out a study design"^^ . "study design execution"^^ . . . "An affinity column is a chromatography column that is used in affinity chromatography. Differences in the affinity of molecules to be separated to a stationary phase are used for discriminate retention."@en . "affinity column"@en . . . "A Gel filtration column is a chromatography column for size-exclusion chromatography, in which the stationary phase is a gel. The main application of gel filtration chromatography is the fractionation of proteins and other water-soluble polymers."@en . "gel filtration column"@en . . . _:genid12294 . _:genid12294 . _:genid12295 . _:genid12296 . _:genid12298 _:genid12297 . _:genid12296 _:genid12298 . _:genid12297 . _:genid12297 . _:genid12297 . _:genid12298 . _:genid12295 _:genid12296 . _:genid12294 _:genid12295 . _:genid12294 . _:genid12299 . _:genid12299 . _:genid12299 . _:genid12299 . _:genid12300 . _:genid12300 . _:genid12300 . _:genid12300 . "reverse transcribe pcr is a process which allow amplification of cDNA during a pcr reaction while the cDNA results from a retrotranscription of messenger RNA isolated from a material entity."^^ . "reverse transcribed polymerase chain reaction"^^ . . . _:genid12301 . _:genid12301 . _:genid12301 . _:genid12301 . _:genid12302 . _:genid12302 . _:genid12302 . _:genid12302 . "a material entity that consists of all the molecules of a specific type that are located in some bounded region and which is part of a more massive material entity that has parts that are other such aggregates"@en . "scattered molecular aggregate"@en . . . "A chromatography consumable is a consumable that is used in a chromatography experiment."@en . "chromatography consumable"@en . . . "A size exclusion column is a chromatography column as used in size exclusion chromatography and which enables the separation of mixtures according to differrences in molecular size."@en . "size exclusion column"@en . . . "An assay that exploits the magnetic properties of certain nuclei (those with a spin) to resonate when placed in particular magnetic field conditions. Instruments recording NMR spectrum and sets of analysis can be used to deduce identity of chemical as well as composition of complex chemical mixtures."^^ . "NMR spectroscopy assay" . . _:genid12303 . _:genid12304 . _:genid12306 _:genid12305 . _:genid12304 _:genid12306 . _:genid12305 . _:genid12308 _:genid12307 . _:genid12307 . _:genid12307 . _:genid12309 . _:genid12310 . _:genid12312 _:genid12311 . _:genid12310 _:genid12312 . _:genid12311 . _:genid12311 . _:genid12311 . _:genid12312 . _:genid12309 _:genid12310 . _:genid12307 _:genid12309 . _:genid12314 _:genid12313 . _:genid12308 _:genid12314 . _:genid12313 . _:genid12313 . _:genid12313 . _:genid12314 . _:genid12305 _:genid12308 . _:genid12316 _:genid12315 . _:genid12306 _:genid12316 . _:genid12315 . _:genid12318 _:genid12317 . _:genid12317 . _:genid12317 . _:genid12319 . _:genid12320 . _:genid12322 _:genid12321 . _:genid12320 _:genid12322 . _:genid12321 . _:genid12321 . _:genid12321 . _:genid12322 . _:genid12319 _:genid12320 . _:genid12317 _:genid12319 . _:genid12324 _:genid12323 . _:genid12318 _:genid12324 . _:genid12323 . _:genid12323 . _:genid12325 . _:genid12326 . _:genid12328 _:genid12327 . _:genid12326 _:genid12328 . _:genid12327 . _:genid12327 . _:genid12327 . _:genid12328 . _:genid12325 _:genid12326 . _:genid12323 _:genid12325 . _:genid12324 . _:genid12315 _:genid12318 . _:genid12330 _:genid12329 . _:genid12316 _:genid12330 . _:genid12329 . _:genid12329 . _:genid12329 . _:genid12330 . _:genid12303 _:genid12304 . _:genid12303 . . "A sequencing assay which determines information on the sequence of a DNA molecule."^^ . "DNA sequencing assay" . . . _:genid12331 . _:genid12331 . _:genid12332 . _:genid12333 . _:genid12335 _:genid12334 . _:genid12333 _:genid12335 . _:genid12334 . _:genid12334 . _:genid12334 . _:genid12335 . _:genid12332 _:genid12333 . _:genid12331 _:genid12332 . _:genid12331 . "An assay that studies blood and blood producing organs using a variety of techniques and instruments"^^ . "hematology assay" . . . _:genid12336 . _:genid12338 _:genid12337 . _:genid12337 . _:genid12337 . _:genid12339 . _:genid12340 . _:genid12342 _:genid12341 . _:genid12340 _:genid12342 . _:genid12341 . _:genid12341 . _:genid12341 . _:genid12342 . _:genid12339 _:genid12340 . _:genid12337 _:genid12339 . _:genid12344 _:genid12343 . _:genid12338 _:genid12344 . _:genid12343 . _:genid12343 . _:genid12345 . _:genid12346 . _:genid12348 _:genid12347 . _:genid12346 _:genid12348 . _:genid12347 . _:genid12347 . _:genid12347 . _:genid12348 . _:genid12345 _:genid12346 . _:genid12343 _:genid12345 . _:genid12344 . _:genid12336 _:genid12338 . _:genid12336 . _:genid12349 . _:genid12349 . _:genid12350 . _:genid12351 . _:genid12353 _:genid12352 . _:genid12351 _:genid12353 . _:genid12352 . _:genid12352 . _:genid12352 . _:genid12353 . _:genid12350 _:genid12351 . _:genid12349 _:genid12350 . _:genid12349 . _:genid12354 . _:genid12354 . _:genid12355 . _:genid12355 . _:genid12355 . _:genid12354 _:genid12355 . _:genid12354 . _:genid12356 . _:genid12356 . _:genid12356 . _:genid12356 . "An assay that measures the state of methylation of DNA molecules using genomic DNA collected from a material entity using a range of techniques and instrument such as DNA sequencers and often relying on treatment with bisulfites to ensure cytosine conversion."^^ . "DNA methylation profiling assay" . . _:genid12357 . _:genid12358 . _:genid12359 . _:genid12358 _:genid12359 . _:genid12359 . _:genid12357 _:genid12358 . _:genid12357 . . "is an objective to transform a material entity into spatially separated components."^^ . "material separation objective"^^ . . _:genid12360 . _:genid12360 . _:genid12360 . _:genid12360 . . "A differential expression analysis data transformation is a data transformation that has an objective of differential expression analysis. Frequently this data transformation involves summarizing or otherwise aggregating signals from various samples categorized into groups, and calculating measures of group differences from these aggregated signals."@en . "differential expression analysis data transformation"@en . . . _:genid12361 . _:genid12361 . _:genid12361 . _:genid12361 . _:genid12362 . _:genid12362 . _:genid12362 . _:genid12362 . _:genid12363 . _:genid12363 . _:genid12363 . _:genid12363 . "a portion of urine collected from an organism"^^ . "urine specimen"^^ . . _:genid12364 . _:genid12364 . _:genid12364 . _:genid12364 . . _:genid12365 . _:genid12365 . _:genid12365 . _:genid12365 . "is a material processing with the objective to combine two or more material entities as input into a single material entity as output."^^ . "material combination"^^ . . . _:genid12366 . _:genid12366 . _:genid12366 . _:genid12366 . "a quality inheres_in some device and is concretization of some (device_setting_specification and is_about a quality of the device"^^ . "device setting"^^ . . _:genid12367 . _:genid12368 . _:genid12370 _:genid12369 . _:genid12368 _:genid12370 . _:genid12369 . _:genid12369 . _:genid12369 . _:genid12370 . _:genid12367 _:genid12368 . _:genid12367 . . _:genid12371 . _:genid12371 . _:genid12371 . _:genid12371 . _:genid12372 . _:genid12372 . _:genid12372 . _:genid12372 . "A planned process with the objective of collecting a specimen."^^ . "specimen collection process" . . . _:genid12373 . _:genid12375 _:genid12374 . _:genid12374 . _:genid12374 . _:genid12376 . _:genid12377 . _:genid12379 _:genid12378 . _:genid12377 _:genid12379 . _:genid12378 . _:genid12378 . _:genid12378 . _:genid12379 . _:genid12376 _:genid12377 . _:genid12374 _:genid12376 . _:genid12381 _:genid12380 . _:genid12375 _:genid12381 . _:genid12380 . _:genid12380 . _:genid12380 . _:genid12381 . _:genid12373 _:genid12375 . _:genid12373 . "A cell proliferation assay in which cells are cultured in the presence of BrdU which is incorporated into newly synthesized DNA of replicating cells (during the S phase of the cell cycle), substituting for thymidine during DNA replication, which can be quantified by BrdU specific antibodies."^^ . "BrdU incorporation assay" . . . _:genid12382 . _:genid12384 _:genid12383 . _:genid12383 . _:genid12383 . _:genid12385 . _:genid12386 . _:genid12388 _:genid12387 . _:genid12386 _:genid12388 . _:genid12387 . _:genid12387 . _:genid12387 . _:genid12388 . _:genid12385 _:genid12386 . _:genid12383 _:genid12385 . _:genid12390 _:genid12389 . _:genid12384 _:genid12390 . _:genid12389 . _:genid12389 . _:genid12389 . _:genid12390 . _:genid12382 _:genid12384 . _:genid12382 . _:genid12391 . _:genid12391 . _:genid12391 . _:genid12391 . "A cell proliferation assay in which cells are cultured in the presence of tritiated thymidine which is incorporated into newly synthesized DNA of replicating cells (during the S phase of the cell cycle). The radioactivity of tritiated thymidine in a cell is a proxy for cells that were actively replicating."^^ . "tritiated thymidine incorporation assay" . . _:genid12392 . _:genid12394 _:genid12393 . _:genid12393 . _:genid12393 . _:genid12393 . _:genid12396 _:genid12395 . _:genid12394 _:genid12396 . _:genid12395 . _:genid12395 . _:genid12395 . _:genid12396 . _:genid12392 _:genid12394 . _:genid12392 . . . _:genid12397 . _:genid12397 . _:genid12397 . _:genid12397 . "a material obtained from an organism in order to be a representative of the whole"^^ . "sample from organism"^^ . . . . "A material separation objective aiming to separate material into multiple portions, each of which contains a similar composition of the input material."^^ . "portioning objective"^^ . . . "A material separation objective aiming to separate a material entity that has parts of different types, and end with at least one output that is a material with parts of fewer types (modulo impurities)."^^ . "separation into different composition objective"^^ . . . "A objective specification to obtain a material entity for potential use as an input during an investigation."^^ . "specimen collection objective" . . . _:genid12398 . _:genid12398 . _:genid12398 . _:genid12398 . _:genid12399 . _:genid12399 . _:genid12399 . _:genid12399 . "is a process with the objective to prepare a liquid solution of one or more chemicals at desired concentrations."^^ . "creating a mixture of molecules in solution"^^ . . . "is an objective to obtain an output material that contains several input materials."^^ . "material combination objective"^^ . . . _:genid12400 . _:genid12400 . _:genid12400 . _:genid12400 . _:genid12401 . _:genid12401 . _:genid12401 . _:genid12401 . "is a process which realizes a material separation objective by relying on antibodies to specifically binding to material entity"^^ . "immunoprecipitation"^^ . . . _:genid12402 . _:genid12402 . _:genid12402 . _:genid12402 . _:genid12403 . _:genid12403 . _:genid12403 . _:genid12403 . _:genid12404 . _:genid12404 . _:genid12405 . _:genid12405 . _:genid12405 . _:genid12404 _:genid12405 . _:genid12404 . "An assay that measures the occurrence of death events in one or more organisms over time"^^ . "survival assessment assay" . . . _:genid12406 . _:genid12406 . _:genid12407 . _:genid12408 . _:genid12409 . _:genid12408 _:genid12409 . _:genid12409 . _:genid12407 _:genid12408 . _:genid12406 _:genid12407 . _:genid12406 . _:genid12410 . _:genid12410 . _:genid12411 . _:genid12412 . _:genid12413 . _:genid12412 _:genid12413 . _:genid12414 . _:genid12413 _:genid12414 . _:genid12415 . _:genid12414 _:genid12415 . _:genid12415 . _:genid12411 _:genid12412 . _:genid12410 _:genid12411 . _:genid12410 . _:genid12416 . _:genid12416 . _:genid12416 . _:genid12416 . "is a process which results in the creation of a library from fragments of DNA using cloning vectors or oligonucleotides with the role of adaptors."^^ . "library preparation"^^ . . _:genid12417 . _:genid12418 . _:genid12420 _:genid12419 . _:genid12418 _:genid12420 . _:genid12419 . _:genid12422 _:genid12421 . _:genid12421 . _:genid12421 . _:genid12423 . _:genid12424 . _:genid12426 _:genid12425 . _:genid12424 _:genid12426 . _:genid12425 . _:genid12425 . _:genid12425 . _:genid12426 . _:genid12423 _:genid12424 . _:genid12421 _:genid12423 . _:genid12428 _:genid12427 . _:genid12422 _:genid12428 . _:genid12427 . _:genid12427 . _:genid12427 . _:genid12428 . _:genid12419 _:genid12422 . _:genid12430 _:genid12429 . _:genid12420 _:genid12430 . _:genid12429 . _:genid12429 . _:genid12429 . _:genid12430 . _:genid12417 _:genid12418 . _:genid12417 . . "An assay in which chromatin is immunoprecipitated and subsequently analyzed using a DNA sequencing step to identify which parts of DNA are part of the isolated chromatin"^^ . "ChIP-seq assay" . . . "is a collection of short paired tags from the two ends of DNA fragments are extracted and covalently linked as ditag constructs"^^ . "paired-end library"^^ . . _:genid12431 . _:genid12432 . _:genid12434 _:genid12433 . _:genid12432 _:genid12434 . _:genid12433 . _:genid12433 . _:genid12433 . _:genid12434 . _:genid12431 _:genid12432 . _:genid12431 . . "A recombinant vector is created by a recombinant vector cloning process, and contains nucleic acids that can be amplified. It retains functions of the original cloning vector."^^ . "recombinant vector"^^ . . . "is a collection of short tags from DNA fragments, are extracted and covalently linked as single tag constructs"^^ . "single fragment library"^^ . . _:genid12435 . _:genid12436 . _:genid12438 _:genid12437 . _:genid12436 _:genid12438 . _:genid12437 . _:genid12437 . _:genid12437 . _:genid12438 . _:genid12435 _:genid12436 . _:genid12435 . . . _:genid12439 . _:genid12439 . _:genid12439 . _:genid12439 . "A cloning vector is an engineered material that is used as an input material for a recombinant vector cloning process to carry inserted nucleic acids. It contains an origin of replication for a specific destination host organism, encodes for a selectable gene product and contains a cloning site."^^ . "cloning vector"^^ . . . "A material sample role is a specimen role borne by a material entity that is the output of a material sampling process."^^ . "material sample role"^^ . . _:genid12440 . _:genid12441 . _:genid12443 _:genid12442 . _:genid12441 _:genid12443 . _:genid12442 . _:genid12442 . _:genid12442 . _:genid12445 _:genid12444 . _:genid12443 _:genid12445 . _:genid12444 . _:genid12444 . _:genid12444 . _:genid12445 . _:genid12440 _:genid12441 . _:genid12440 . . "A specimen gathering process with the objective to obtain a specimen that is representative of the input material entity"^^ . "material sampling process"^^ . . _:genid12446 . _:genid12447 . _:genid12449 _:genid12448 . _:genid12447 _:genid12449 . _:genid12448 . _:genid12448 . _:genid12448 . _:genid12449 . _:genid12446 _:genid12447 . _:genid12446 . . "A material entity that has the material sample role"^^ . "material sample"^^ . . . _:genid12450 . _:genid12450 . _:genid12450 . _:genid12450 . "a directive information entity that is part of a study design. Independent variables are entities whose values are selected to determine its relationship to an observed phenomenon (the dependent variable). In such an experiment, an attempt is made to find evidence that the values of the independent variable determine the values of the dependent variable (that which is being measured). The independent variable can be changed as required, and its values do not represent a problem requiring explanation in an analysis, but are taken simply as given. The dependent variable on the other hand, usually cannot be directly controlled"@en . "study design independent variable"@en . . . "A measurement data that represents the percentage of people or animals in a study or treatment group who are alive for a given period of time after diagnosis or initiation of monitoring."^^ . "survival rate"^^ . . . "The objective to separate a material entity into different compositions of which one or more have are purified fractions that contain higher concentration of a desired component, while others contain impurities and are not of interest"^^ . "purification objective"^^ . . . _:genid12451 . _:genid12451 . _:genid12451 . _:genid12451 . _:genid12452 . _:genid12452 . _:genid12452 . _:genid12452 . "A process in which bonds are created that link one polymer to another"^^ . "cross linking"^^ . . . "An objective specification maintains some or all of the qualities of a material over time."^^ . "material maintenance objective"^^ . . . _:genid12453 . _:genid12453 . _:genid12454 . _:genid12455 . _:genid12457 _:genid12456 . _:genid12455 _:genid12457 . _:genid12456 . _:genid12456 . _:genid12456 . _:genid12457 . _:genid12454 _:genid12455 . _:genid12453 _:genid12454 . _:genid12453 . "a planned process in which an organism is exposed to some stimulus with the intent to invoke an action"^^ . "presentation of stimulus"^^ . . _:genid12458 . _:genid12459 . _:genid12461 _:genid12460 . _:genid12459 _:genid12461 . _:genid12460 . _:genid12460 . _:genid12460 . _:genid12461 . _:genid12458 _:genid12459 . _:genid12458 . . . "DNA that has been produced in an enzymatic amplification process"^^ . "amplified DNA"^^ . . _:genid12462 . _:genid12462 . _:genid12463 . _:genid12463 . _:genid12463 . _:genid12462 _:genid12463 . _:genid12462 . . "a quality of a DNA molecule that inheres in its bearer due to the order of its DNA nucleotide residues."^^ . "primary structure of DNA macromolecule"^^ . . . _:genid12464 . _:genid12464 . _:genid12464 . _:genid12464 . _:genid12465 . _:genid12465 . _:genid12465 . _:genid12465 . "An electrode of very fine caliber consisting usually of a fine wire or a glass tube of capillary diameter drawn to a fine point and filled with saline or a metal used in physiological experiments to stimulate or record action currents of extracellular or intracellular origin in the nervous system."^^ . "micro electrode"^^ . . _:genid12466 . _:genid12467 . _:genid12469 _:genid12468 . _:genid12467 _:genid12469 . _:genid12468 . _:genid12468 . _:genid12468 . _:genid12469 . _:genid12466 _:genid12467 . _:genid12466 . . "A device in which a measure function inheres."^^ . "measurement device"^^ . . . "The output of an extraction process in which DNA molecules above a molecular weight cutoff are purified in order to exclude DNA from organellas."^^ . "high molecular weight DNA extract"^^ . . _:genid12470 . _:genid12470 . _:genid12470 . _:genid12470 . . "a process with that achieves the objective to maintain some or all of the characteristics of an input material over time"^^ . "material maintenance"^^ . . _:genid12471 . _:genid12471 . _:genid12472 . _:genid12472 . _:genid12472 . _:genid12471 _:genid12472 . _:genid12471 . . "The primary structure of an RNA molecule that is completely defined by the set of its nucleic residue parts and the linear order induced by the peptide bonds that hold them together"^^ . "primary structure of RNA molecule"^^ . . . _:genid12473 . _:genid12473 . _:genid12473 . _:genid12473 . "A role played by a nucleic acid molecule that is used in a planned process for its ability to bind a nucleic acid molecules with complementary nucleotide sequence"^^ . "complementary nucleotide probe role"^^ . . . _:genid12474 . _:genid12476 _:genid12475 . _:genid12475 . _:genid12475 . _:genid12477 . _:genid12478 . _:genid12480 _:genid12479 . _:genid12478 _:genid12480 . _:genid12479 . _:genid12479 . _:genid12479 . _:genid12480 . _:genid12477 _:genid12478 . _:genid12475 _:genid12477 . _:genid12482 _:genid12481 . _:genid12476 _:genid12482 . _:genid12481 . _:genid12481 . _:genid12481 . _:genid12482 . _:genid12474 _:genid12476 . _:genid12474 . "An assay that determines the presence of gene transcripts by hybridizing labeled RNA or DNA probes against messenger RNAs isolated from tissue or cell cultures, resolved on denaturing gel, transfered by a blotting procedure to a solid support. Detection of hybridization signals is carried out by immunofluorescence or radioactivity measurements using photographic films or digital imaging devices such as Phosphor Imager."^^ . "northern blot assay" . . _:genid12483 . _:genid12483 . _:genid12484 . _:genid12485 . _:genid12487 _:genid12486 . _:genid12485 _:genid12487 . _:genid12486 . _:genid12486 . _:genid12488 . _:genid12489 . _:genid12491 _:genid12490 . _:genid12489 _:genid12491 . _:genid12490 . _:genid12490 . _:genid12490 . _:genid12491 . _:genid12488 _:genid12489 . _:genid12486 _:genid12488 . _:genid12487 . _:genid12484 _:genid12485 . _:genid12483 _:genid12484 . _:genid12483 . . . "a specimen that was taken from a live organism"^^ . "pre-mortem specimen"^^ . . _:genid12492 . _:genid12493 . _:genid12495 _:genid12494 . _:genid12493 _:genid12495 . _:genid12494 . _:genid12497 _:genid12496 . _:genid12496 . _:genid12496 . _:genid12498 . _:genid12499 . _:genid12501 _:genid12500 . _:genid12499 _:genid12501 . _:genid12500 . _:genid12500 . _:genid12502 . _:genid12503 . _:genid12505 _:genid12504 . _:genid12503 _:genid12505 . _:genid12504 . _:genid12504 . _:genid12504 . _:genid12505 . _:genid12502 _:genid12503 . _:genid12500 _:genid12502 . _:genid12501 . _:genid12498 _:genid12499 . _:genid12496 _:genid12498 . _:genid12507 _:genid12506 . _:genid12497 _:genid12507 . _:genid12506 . _:genid12506 . _:genid12508 . _:genid12509 . _:genid12511 _:genid12510 . _:genid12509 _:genid12511 . _:genid12510 . _:genid12510 . _:genid12510 . _:genid12511 . _:genid12508 _:genid12509 . _:genid12506 _:genid12508 . _:genid12507 . _:genid12494 _:genid12497 . _:genid12513 _:genid12512 . _:genid12495 _:genid12513 . _:genid12512 . _:genid12515 _:genid12514 . _:genid12514 . _:genid12514 . _:genid12516 . _:genid12517 . _:genid12519 _:genid12518 . _:genid12517 _:genid12519 . _:genid12518 . _:genid12518 . _:genid12518 . _:genid12519 . _:genid12516 _:genid12517 . _:genid12514 _:genid12516 . _:genid12521 _:genid12520 . _:genid12515 _:genid12521 . _:genid12520 . _:genid12520 . _:genid12520 . _:genid12521 . _:genid12512 _:genid12515 . _:genid12513 . _:genid12492 _:genid12493 . _:genid12492 . . "An analyte assay in which a specified input material (the evaluant) is examined for the presence or quantity of specified nucleic acid polymers, which are identified based on the use of complementary nucleic acid probes."^^ . "detection of specific nucleic acid polymers with complementary probes" . . . _:genid12522 . _:genid12522 . _:genid12522 . _:genid12522 . _:genid12523 . _:genid12523 . _:genid12523 . _:genid12523 . "an extract which is the output of an extraction process in which RNA molecules are isolated from a specimen."^^ . "RNA extract"^^ . . _:genid12524 . _:genid12525 . _:genid12527 _:genid12526 . _:genid12525 _:genid12527 . _:genid12526 . _:genid12526 . _:genid12526 . _:genid12529 _:genid12528 . _:genid12527 _:genid12529 . _:genid12528 . _:genid12528 . _:genid12530 . _:genid12530 . _:genid12530 . _:genid12528 _:genid12530 . _:genid12529 . _:genid12524 _:genid12525 . _:genid12524 . . "A cytometry assay that monitors a cell population to track how many are killed by other cells."^^ . "cell-cell killing assay" . . _:genid12531 . _:genid12532 . _:genid12534 _:genid12533 . _:genid12532 _:genid12534 . _:genid12533 . _:genid12536 _:genid12535 . _:genid12535 . _:genid12535 . _:genid12537 . _:genid12538 . _:genid12540 _:genid12539 . _:genid12538 _:genid12540 . _:genid12539 . _:genid12539 . _:genid12539 . _:genid12540 . _:genid12537 _:genid12538 . _:genid12535 _:genid12537 . _:genid12542 _:genid12541 . _:genid12536 _:genid12542 . _:genid12541 . _:genid12541 . _:genid12543 . _:genid12544 . _:genid12546 _:genid12545 . _:genid12544 _:genid12546 . _:genid12545 . _:genid12545 . _:genid12545 . _:genid12546 . _:genid12543 _:genid12544 . _:genid12541 _:genid12543 . _:genid12542 . _:genid12533 _:genid12536 . _:genid12534 . _:genid12531 _:genid12532 . _:genid12531 . . "A cell killing assay that measures if and how many target cells are killed within an organism."^^ . "in vivo cell killing assay" . . _:genid12547 . _:genid12548 . _:genid12550 _:genid12549 . _:genid12548 _:genid12550 . _:genid12549 . _:genid12552 _:genid12551 . _:genid12551 . _:genid12551 . _:genid12553 . _:genid12554 . _:genid12556 _:genid12555 . _:genid12554 _:genid12556 . _:genid12555 . _:genid12555 . _:genid12555 . _:genid12556 . _:genid12553 _:genid12554 . _:genid12551 _:genid12553 . _:genid12558 _:genid12557 . _:genid12552 _:genid12558 . _:genid12557 . _:genid12557 . _:genid12559 . _:genid12560 . _:genid12562 _:genid12561 . _:genid12560 _:genid12562 . _:genid12561 . _:genid12561 . _:genid12561 . _:genid12562 . _:genid12559 _:genid12560 . _:genid12557 _:genid12559 . _:genid12558 . _:genid12549 _:genid12552 . _:genid12564 _:genid12563 . _:genid12550 _:genid12564 . _:genid12563 . _:genid12563 . _:genid12565 . _:genid12565 . _:genid12565 . _:genid12563 _:genid12565 . _:genid12564 . _:genid12547 _:genid12548 . _:genid12547 . . "A cytometry assay which measures the degreee to which input cells are replicating."^^ . "cell proliferation assay" . . . _:genid12566 . _:genid12568 _:genid12567 . _:genid12567 . _:genid12567 . _:genid12569 . _:genid12570 . _:genid12572 _:genid12571 . _:genid12570 _:genid12572 . _:genid12571 . _:genid12571 . _:genid12571 . _:genid12572 . _:genid12569 _:genid12570 . _:genid12567 _:genid12569 . _:genid12574 _:genid12573 . _:genid12568 _:genid12574 . _:genid12573 . _:genid12573 . _:genid12575 . _:genid12576 . _:genid12578 _:genid12577 . _:genid12576 _:genid12578 . _:genid12577 . _:genid12577 . _:genid12577 . _:genid12578 . _:genid12575 _:genid12576 . _:genid12573 _:genid12575 . _:genid12574 . _:genid12566 _:genid12568 . _:genid12566 . _:genid12579 . _:genid12581 _:genid12580 . _:genid12580 . _:genid12580 . _:genid12582 . _:genid12583 . _:genid12585 _:genid12584 . _:genid12583 _:genid12585 . _:genid12584 . _:genid12584 . _:genid12584 . _:genid12585 . _:genid12582 _:genid12583 . _:genid12580 _:genid12582 . _:genid12587 _:genid12586 . _:genid12581 _:genid12587 . _:genid12586 . _:genid12586 . _:genid12586 . _:genid12587 . _:genid12579 _:genid12581 . _:genid12579 . _:genid12588 . _:genid12588 . _:genid12588 . _:genid12588 . _:genid12589 . _:genid12589 . _:genid12589 . _:genid12589 . _:genid12590 . _:genid12590 . _:genid12591 . _:genid12591 . _:genid12591 . _:genid12590 _:genid12591 . _:genid12590 . "An analyte assay that detects the presence of a specific sequence in a DNA sample, which has been digested by restriction enzymes, resolved by gel electrophoresis, and blotted to a solid support, followed by hybridization of a probe raised against a specific sequence and detected with fluorescence or radioactivity."^^ . "Southern blot assay" . . . _:genid12592 . _:genid12592 . _:genid12592 . _:genid12592 . "An assay, based on the PCR, that amplifies and simultaneously quantifies a specific DNA molecule based on the use of complementary probes/primers. It enables both detection and quantification (as absolute number of copies or relative amount when normalized to DNA input or additional normalizing genes) of one or more specific sequences in a DNA sample."^^ . "real time polymerase chain reaction assay" . . _:genid12593 . _:genid12593 . _:genid12594 . _:genid12595 . _:genid12597 _:genid12596 . _:genid12595 _:genid12597 . _:genid12596 . _:genid12596 . _:genid12598 . _:genid12599 . _:genid12601 _:genid12600 . _:genid12599 _:genid12601 . _:genid12600 . _:genid12600 . _:genid12600 . _:genid12601 . _:genid12598 _:genid12599 . _:genid12596 _:genid12598 . _:genid12597 . _:genid12594 _:genid12595 . _:genid12593 _:genid12594 . _:genid12593 . . "a specimen that was taken from a dead organism"^^ . "post mortem specimen"^^ . . _:genid12602 . _:genid12603 . _:genid12605 _:genid12604 . _:genid12603 _:genid12605 . _:genid12604 . _:genid12607 _:genid12606 . _:genid12606 . _:genid12606 . _:genid12608 . _:genid12609 . _:genid12611 _:genid12610 . _:genid12609 _:genid12611 . _:genid12610 . _:genid12610 . _:genid12610 . _:genid12611 . _:genid12608 _:genid12609 . _:genid12606 _:genid12608 . _:genid12613 _:genid12612 . _:genid12607 _:genid12613 . _:genid12612 . _:genid12612 . _:genid12614 . _:genid12615 . _:genid12617 _:genid12616 . _:genid12615 _:genid12617 . _:genid12616 . _:genid12616 . _:genid12616 . _:genid12617 . _:genid12614 _:genid12615 . _:genid12612 _:genid12614 . _:genid12613 . _:genid12604 _:genid12607 . _:genid12605 . _:genid12602 _:genid12603 . _:genid12602 . . "A cell killing assay that measures if and how many target cells are actively killed by other cells in a cell culture."^^ . "in vitro cell killing assay" . . . _:genid12618 . _:genid12620 _:genid12619 . _:genid12619 . _:genid12619 . _:genid12621 . _:genid12622 . _:genid12624 _:genid12623 . _:genid12622 _:genid12624 . _:genid12623 . _:genid12623 . _:genid12623 . _:genid12624 . _:genid12621 _:genid12622 . _:genid12619 _:genid12621 . _:genid12626 _:genid12625 . _:genid12620 _:genid12626 . _:genid12625 . _:genid12625 . _:genid12625 . _:genid12626 . _:genid12618 _:genid12620 . _:genid12618 . "A 3D structure determination assay in which the diffraction of pattern of X-ray beams in a crystal of purified material entities is used to resolve the 3-dimensional structure of the material entity of interest."^^ . "X-ray crystallography assay" . . . _:genid12627 . _:genid12627 . _:genid12627 . _:genid12627 . _:genid12628 . _:genid12628 . _:genid12629 . _:genid12629 . _:genid12629 . _:genid12628 _:genid12629 . _:genid12628 . "An assay in which the activity of a promoter in a cell is monitored by using a reporter gene that was inserted in a genomic location under control of the promoter and whose expression can be easily detected based on qualities or functions of the gene."^^ . "promoter activity detection by reporter gene assay" . . _:genid12630 . _:genid12631 . _:genid12633 _:genid12632 . _:genid12631 _:genid12633 . _:genid12632 . _:genid12635 _:genid12634 . _:genid12634 . _:genid12634 . _:genid12636 . _:genid12637 . _:genid12639 _:genid12638 . _:genid12637 _:genid12639 . _:genid12638 . _:genid12638 . _:genid12638 . _:genid12639 . _:genid12636 _:genid12637 . _:genid12634 _:genid12636 . _:genid12641 _:genid12640 . _:genid12635 _:genid12641 . _:genid12640 . _:genid12640 . _:genid12640 . _:genid12641 . _:genid12632 _:genid12635 . _:genid12643 _:genid12642 . _:genid12633 _:genid12643 . _:genid12642 . _:genid12642 . _:genid12642 . _:genid12643 . _:genid12630 _:genid12631 . _:genid12630 . . "A cytometry assay in which an input cell population is put in solution, is passed by a laser, and optical sensors are used to detect scattering of the laser light and/or fluorescence of specific markers to count and characterize the particles in solution."^^ . "flow cytometry assay" . . . _:genid12644 . _:genid12646 _:genid12645 . _:genid12645 . _:genid12645 . _:genid12647 . _:genid12648 . _:genid12650 _:genid12649 . _:genid12648 _:genid12650 . _:genid12649 . _:genid12649 . _:genid12649 . _:genid12650 . _:genid12647 _:genid12648 . _:genid12645 _:genid12647 . _:genid12652 _:genid12651 . _:genid12646 _:genid12652 . _:genid12651 . _:genid12651 . _:genid12651 . _:genid12652 . _:genid12644 _:genid12646 . _:genid12644 . _:genid12653 . _:genid12653 . _:genid12653 . _:genid12653 . "a labeled specimen that is the output of a labeling process and has grain labeled RNA to be able to detect RNA in future experiments."^^ . "labeled RNA extract"^^ . . . _:genid12654 . _:genid12656 _:genid12655 . _:genid12655 . _:genid12655 . _:genid12657 . _:genid12658 . _:genid12660 _:genid12659 . _:genid12658 _:genid12660 . _:genid12659 . _:genid12659 . _:genid12659 . _:genid12660 . _:genid12657 _:genid12658 . _:genid12655 _:genid12657 . _:genid12662 _:genid12661 . _:genid12656 _:genid12662 . _:genid12661 . _:genid12661 . _:genid12661 . _:genid12662 . _:genid12654 _:genid12656 . _:genid12654 . "A binding assay that uses the detection of electromagnetic waves in a surface to detect material entities adsorbed to the surface, which change the local optical index of refraction."^^ . "surface plasmon resonance binding assay" . . _:genid12663 . _:genid12664 . _:genid12666 _:genid12665 . _:genid12664 _:genid12666 . _:genid12665 . _:genid12665 . _:genid12665 . _:genid12668 _:genid12667 . _:genid12666 _:genid12668 . _:genid12667 . _:genid12667 . _:genid12667 . _:genid12668 . _:genid12663 _:genid12664 . _:genid12663 . . . "A specimen that has been modified in order to be able to detect it in future experiments"^^ . "labeled specimen"^^ . . _:genid12669 . _:genid12669 . _:genid12669 . _:genid12669 . . "is a material entity bearing the disposition to infect an organism"@en . "infectious agent"@en . . . _:genid12670 . _:genid12670 . _:genid12670 . _:genid12670 . "A measurement device that is used to calculate the heat flow of a chemical reaction or physical change."^^ . "calorimeter"^^ . . . _:genid12671 . _:genid12673 _:genid12672 . _:genid12672 . _:genid12672 . _:genid12672 . _:genid12675 _:genid12674 . _:genid12673 _:genid12675 . _:genid12674 . _:genid12674 . _:genid12674 . _:genid12675 . _:genid12671 _:genid12673 . _:genid12671 . _:genid12676 . _:genid12676 . _:genid12677 . _:genid12678 . _:genid12680 _:genid12679 . _:genid12678 _:genid12680 . _:genid12679 . _:genid12679 . _:genid12681 . _:genid12681 . _:genid12681 . _:genid12679 _:genid12681 . _:genid12680 . _:genid12677 _:genid12678 . _:genid12676 _:genid12677 . _:genid12676 . "the part of the execution of an intervention design study which is varied between two or more subjects in the study"^^ . "study intervention"^^ . . _:genid12682 . _:genid12682 . _:genid12682 . _:genid12682 . . "A device with a separation function realized in a planed process"^^ . "material separation device"^^ . . _:genid12683 . _:genid12684 . _:genid12685 . _:genid12684 _:genid12685 . _:genid12685 . _:genid12683 _:genid12684 . _:genid12683 . . . "A specimen that has been intentionally physically modified."^^ . "processed specimen"^^ . . . "An assay in which a measurement is made by observing entities located in a live cell."^^ . "in live cell assay" . . . _:genid12686 . _:genid12686 . _:genid12687 . _:genid12688 . _:genid12690 _:genid12689 . _:genid12688 _:genid12690 . _:genid12689 . _:genid12689 . _:genid12691 . _:genid12692 . _:genid12694 _:genid12693 . _:genid12692 _:genid12694 . _:genid12693 . _:genid12693 . _:genid12693 . _:genid12694 . _:genid12691 _:genid12692 . _:genid12689 _:genid12691 . _:genid12690 . _:genid12687 _:genid12688 . _:genid12686 _:genid12687 . _:genid12686 . "An assay in which a measurement is made by observing entities located in an organism."^^ . "in live organism assay" . . _:genid12695 . _:genid12695 . _:genid12695 . _:genid12695 . . "A device that can be used to restrict the location of material entities over time"^^ . "container"^^ . . . _:genid12696 . _:genid12696 . _:genid12696 . _:genid12696 . _:genid12697 . _:genid12697 . _:genid12697 . _:genid12697 . _:genid12698 . _:genid12699 . _:genid12701 _:genid12700 . _:genid12699 _:genid12701 . _:genid12700 . _:genid12700 . _:genid12700 . _:genid12701 . _:genid12698 _:genid12699 . _:genid12698 . "A material entity that is designed to perform a function in a scientific investigation, but is not a reagent."^^ . "device"^^ . . _:genid12702 . _:genid12703 . _:genid12705 _:genid12704 . _:genid12703 _:genid12705 . _:genid12704 . _:genid12704 . _:genid12704 . _:genid12705 . _:genid12702 _:genid12703 . _:genid12702 . "A measurement datum that representing the primary structure of a macromolecule(it's sequence) sometimes associated with an indicator of confidence of that measurement.\n"^^ . "sequence data"@en . . _:genid12706 . _:genid12707 . _:genid12709 _:genid12708 . _:genid12707 _:genid12709 . _:genid12708 . _:genid12708 . _:genid12708 . _:genid12711 _:genid12710 . _:genid12709 _:genid12711 . _:genid12710 . _:genid12710 . _:genid12712 . _:genid12712 . _:genid12712 . _:genid12710 _:genid12712 . _:genid12711 . _:genid12706 _:genid12707 . _:genid12706 . . "A binding assay which uses a flow cytometer to detect pairs of cells that are bound to each other by staining them with different fluorescent labels."^^ . "cell-cell binding detection by flow cytometry assay" . . . "An assay in which a measurement is made by observing entities located in a container."^^ . "in container assay" . . . _:genid12713 . _:genid12713 . _:genid12714 . _:genid12715 . _:genid12717 _:genid12716 . _:genid12715 _:genid12717 . _:genid12716 . _:genid12716 . _:genid12716 . _:genid12717 . _:genid12714 _:genid12715 . _:genid12713 _:genid12714 . _:genid12713 . _:genid12718 . _:genid12718 . _:genid12719 . _:genid12720 . _:genid12722 _:genid12721 . _:genid12720 _:genid12722 . _:genid12721 . _:genid12721 . _:genid12721 . _:genid12722 . _:genid12719 _:genid12720 . _:genid12718 _:genid12719 . _:genid12718 . "A study design in which the independent variable is the environmental condition in which the specimen is growing"^^ . "growth condition intervention design"^^ . . . _:genid12723 . _:genid12723 . _:genid12724 . _:genid12724 . _:genid12724 . _:genid12723 _:genid12724 . _:genid12723 . "A device that is used to amplify a single or few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence."^^ . "PCR instrument"^^ . . . "A microscope that produces an image of an object by targeting it with an electron beam"^^ . "electron microscope"^^ . . . "The collection of material entities and their qualities that are located near a live organism, tissue or cell and can influence its growth."^^ . "growth environment"^^ . . . _:genid12725 . _:genid12725 . _:genid12725 . _:genid12725 . _:genid12726 . _:genid12726 . _:genid12726 . _:genid12726 . "A planned process that captures an image of an object."^^ . "image creation"^^ . . . . _:genid12727 . _:genid12729 _:genid12728 . _:genid12728 . _:genid12728 . _:genid12728 . _:genid12731 _:genid12730 . _:genid12729 _:genid12731 . _:genid12730 . _:genid12730 . _:genid12730 . _:genid12731 . _:genid12727 _:genid12729 . _:genid12727 . _:genid12732 . _:genid12732 . _:genid12732 . _:genid12732 . "An extract that is the output of an extraction process in which nucleic acid molecules are isolated from a specimen."^^ . "nucleic acid extract"^^ . . . _:genid12733 . _:genid12733 . _:genid12733 . _:genid12733 . "A binding assay where the specified output is a binding constant"^^ . "binding constant determination assay" . . _:genid12734 . _:genid12734 . _:genid12734 . _:genid12734 . . "a device which has a function to emit light."^^ . "light emission device"^^ . . _:genid12735 . _:genid12735 . _:genid12735 . _:genid12735 . . "A perturbation device is a device which is designed to perform a perturb function"^^ . "perturbation device"^^ . . _:genid12736 . _:genid12736 . _:genid12737 . _:genid12738 . _:genid12739 . _:genid12738 _:genid12739 . _:genid12740 . _:genid12739 _:genid12740 . _:genid12740 . _:genid12737 _:genid12738 . _:genid12736 _:genid12737 . _:genid12736 . . "An environmental control device is a device which has the function to control some aspect of the environment such as temperature, or humidity."^^ . "environmental control device"^^ . . . _:genid12741 . _:genid12741 . _:genid12741 . _:genid12741 . _:genid12742 . _:genid12742 . _:genid12742 . _:genid12742 . "The output of an extraction process in which DNA molecules are purified in order to exclude DNA from organellas."^^ . "DNA extract"^^ . . . _:genid12743 . _:genid12743 . _:genid12743 . _:genid12743 . "A device that moves charged particles through a medium by using an electric field induced by electrodes."^^ . "electrophoresis system"^^ . . . "A liquid chromatography instrument that consists of a reservoir of mobile phase, a pump, an injector, a separation column, and a detector. The pump (rather than gravity) provides the higher pressure required to propel the mobile phase and analyte through the densely packed column."^^ . "high performance liquid chromatography instrument"^^ . . . "A microscope that is used to increase micrograph contrast and/or reconstruct three-dimensional images by using a spatial pinhole to eliminate out-of-focus light in specimens that are thicker than the focal plane."^^ . "confocal microscope"^^ . . . _:genid12744 . _:genid12744 . _:genid12744 . _:genid12744 . "A device used in electrophysiology that allows the study of single or multiple ion channels in cells."^^ . "patch clamp device"^^ . . . _:genid12745 . _:genid12745 . _:genid12745 . _:genid12745 . "An device that is used to determine the order of nucleotides in nucleic acid sequences."^^ . "nucleic acid sequencer"^^ . . . "A device that moves charged particles through a medium by using an electric field induced by electrodes."^^ . "gel electrophoresis system"^^ . . . _:genid12746 . _:genid12746 . _:genid12746 . _:genid12746 . "A device that is used to measure the ion currents across the membrane of excitable cells, such as neurons, while holding the membrane voltage at a set level."^^ . "voltage clamp device"^^ . . . _:genid12747 . _:genid12747 . _:genid12747 . _:genid12747 . "A tool for measuring adsorption of material onto planar metal (typically gold and silver) surfaces or onto the surface of metal nanoparticles."^^ . "surface plasmon resonance instrument"^^ . . . _:genid12748 . _:genid12748 . _:genid12748 . _:genid12748 . "An device that is used to determine the order of amino acids in protein sequences."^^ . "protein sequencer"^^ . . . _:genid12749 . _:genid12749 . _:genid12749 . _:genid12749 . "A device that is used to generate X-rays."^^ . "X-ray source"^^ . . . "A chromatography device that dissolves a mixture in liquid mobile phase to separate the analyte to be measured from other molecules in the mixture and allows it to be isolated"^^ . "liquid chromatography instrument"^^ . . . _:genid12750 . _:genid12752 _:genid12751 . _:genid12751 . _:genid12751 . _:genid12753 . _:genid12754 . _:genid12756 _:genid12755 . _:genid12754 _:genid12756 . _:genid12755 . _:genid12755 . _:genid12755 . _:genid12756 . _:genid12753 _:genid12754 . _:genid12751 _:genid12753 . _:genid12758 _:genid12757 . _:genid12752 _:genid12758 . _:genid12757 . _:genid12757 . _:genid12757 . _:genid12758 . _:genid12750 _:genid12752 . _:genid12750 . _:genid12759 . _:genid12759 . _:genid12759 . _:genid12759 . "a labeled specimen that is the output of a labeling process and has grain labeled nucleic acid for detection of the nucleic acid in future experiments."^^ . "labeled nucleic acid extract"^^ . . _:genid12760 . _:genid12761 . _:genid12762 . _:genid12761 _:genid12762 . _:genid12763 . _:genid12762 _:genid12763 . _:genid12764 . _:genid12763 _:genid12764 . _:genid12765 . _:genid12764 _:genid12765 . _:genid12766 . _:genid12765 _:genid12766 . _:genid12767 . _:genid12766 _:genid12767 . _:genid12767 . _:genid12760 _:genid12761 . _:genid12760 . . "A binding datum about the disposition of two or more material entities to form complexes which comes in the form of a scalar and unit that are utilized in equations that model the binding process"@en . "binding constant"@en . . _:genid12768 . _:genid12769 . _:genid12771 _:genid12770 . _:genid12769 _:genid12771 . _:genid12770 . _:genid12770 . _:genid12772 . _:genid12772 . _:genid12772 . _:genid12770 _:genid12772 . _:genid12771 . _:genid12768 _:genid12769 . _:genid12768 . . "A 3D structure determination assay in which a complex of 2 or more material enties is characterized which provides information on their binding configuration."^^ . "3D structure determination of bound complex assay" . . . _:genid12773 . _:genid12773 . _:genid12773 . _:genid12773 . _:genid12774 . _:genid12774 . _:genid12775 . _:genid12775 . _:genid12775 . _:genid12774 _:genid12775 . _:genid12774 . "An assay with the objective to characterize the disposition of two or more material entities to form a complex."^^ . "binding assay" . . . _:genid12776 . _:genid12778 _:genid12777 . _:genid12777 . _:genid12777 . _:genid12777 . _:genid12780 _:genid12779 . _:genid12778 _:genid12780 . _:genid12779 . _:genid12779 . _:genid12779 . _:genid12780 . _:genid12776 _:genid12778 . _:genid12776 . _:genid12781 . _:genid12781 . _:genid12781 . _:genid12781 . "a processual entity that results in the increase of cell numbers"@en . "cell culture expansion"@en . . . "a genetic transformation that renders a gene non-functional, e.g. due to a point mutation, or the removal of all, or part of, the gene using recombinant methods."@en . "gene knock out"@en . . . "a genetic transformation that involves the insertion of a protein coding cDNA sequence at a particular locus in an organism's chromosome. Typically, this is done in mice since the technology for this process is more refined, and because mouse embryonic stem cells are easily manipulated. The difference between knock-in technology and transgenic technology is that a knock-in involves a gene inserted into a specific locus, and is a \"targeted\" insertion."@en . "gene knock in"@en . . _:genid12782 . _:genid12783 . _:genid12785 _:genid12784 . _:genid12783 _:genid12785 . _:genid12784 . _:genid12786 . _:genid12788 _:genid12787 . _:genid12786 _:genid12788 . _:genid12787 . _:genid12787 . _:genid12787 . _:genid12788 . _:genid12784 _:genid12786 . _:genid12785 . _:genid12782 _:genid12783 . _:genid12782 . . "a material entity, organism or cell, that is the output of a genetic transformation process. "@en . "genetically modified material"@en . . . _:genid12789 . _:genid12789 . _:genid12789 . _:genid12789 . _:genid12790 . _:genid12790 . _:genid12791 . _:genid12793 _:genid12792 . _:genid12792 . _:genid12794 . _:genid12795 . _:genid12794 _:genid12795 . _:genid12795 . _:genid12792 _:genid12794 . _:genid12797 _:genid12796 . _:genid12793 _:genid12797 . _:genid12796 . _:genid12796 . _:genid12796 . _:genid12797 . _:genid12791 _:genid12793 . _:genid12790 _:genid12791 . _:genid12790 . "a genetic transformation which relies on the use of physical, electrical and chemical phenomena to introduce DNA or RNA into a cell"@en . "transfection"@en . . . "a material transformation objective aims to create genetically modified organism or cell"@en . "genetic transformation objective"@en . . . "a genetic transformation that the modification of the genetic material (either coding or non-coding) of an organism is caused by mutagenic compounds or irradiation."@en . "induced mutation"@en . . . "A measurement datum that describes the structural orientation of a material entity in 3D space. "^^ . "3D structural organization datum"^^ . . . _:genid12798 . _:genid12798 . _:genid12798 . _:genid12798 . "The time it takes for 50% of a class of stochastic processes to occur. "^^ . "half life datum (t 1/2)"^^ . . . "A data item of paired values, one indicating the dose of a material, the other quantitating a measured effect at that dose. The dosing intervals are chosen so that effect values be interpolated by a plotting a curve. "^^ . "dose response curve"^^ . . _:genid12799 . _:genid12800 . _:genid12802 _:genid12801 . _:genid12800 _:genid12802 . _:genid12801 . _:genid12804 _:genid12803 . _:genid12803 . _:genid12803 . _:genid12805 . _:genid12806 . _:genid12808 _:genid12807 . _:genid12806 _:genid12808 . _:genid12807 . _:genid12807 . _:genid12807 . _:genid12808 . _:genid12805 _:genid12806 . _:genid12803 _:genid12805 . _:genid12810 _:genid12809 . _:genid12804 _:genid12810 . _:genid12809 . _:genid12809 . _:genid12809 . _:genid12810 . _:genid12801 _:genid12804 . _:genid12812 _:genid12811 . _:genid12802 _:genid12812 . _:genid12811 . _:genid12814 _:genid12813 . _:genid12813 . _:genid12813 . _:genid12815 . _:genid12816 . _:genid12818 _:genid12817 . _:genid12816 _:genid12818 . _:genid12817 . _:genid12817 . _:genid12817 . _:genid12818 . _:genid12815 _:genid12816 . _:genid12813 _:genid12815 . _:genid12820 _:genid12819 . _:genid12814 _:genid12820 . _:genid12819 . _:genid12819 . _:genid12821 . _:genid12822 . _:genid12824 _:genid12823 . _:genid12822 _:genid12824 . _:genid12823 . _:genid12823 . _:genid12823 . _:genid12824 . _:genid12821 _:genid12822 . _:genid12819 _:genid12821 . _:genid12820 . _:genid12811 _:genid12814 . _:genid12826 _:genid12825 . _:genid12812 _:genid12826 . _:genid12825 . _:genid12825 . _:genid12825 . _:genid12828 _:genid12827 . _:genid12826 _:genid12828 . _:genid12827 . _:genid12827 . _:genid12827 . _:genid12830 _:genid12829 . _:genid12828 _:genid12830 . _:genid12829 . _:genid12829 . _:genid12829 . _:genid12832 _:genid12831 . _:genid12830 _:genid12832 . _:genid12831 . _:genid12831 . _:genid12833 . _:genid12833 . _:genid12833 . _:genid12831 _:genid12833 . _:genid12832 . _:genid12799 _:genid12800 . _:genid12799 . . "An assay that determines the sequence of an RNA molecule."^^ . "RNA sequencing assay" . . . _:genid12834 . _:genid12834 . _:genid12834 . _:genid12834 . _:genid12835 . _:genid12835 . _:genid12835 . _:genid12835 . "half maximal effective concentration (EC50) is a scalar measurement datum corresponding to the concentration of a compound which induces a response halfway between the baseline and maximum after some specified exposure time. \n"^^ . "half maximal effective concentration (EC50)"^^ . . _:genid12836 . _:genid12837 . _:genid12839 _:genid12838 . _:genid12837 _:genid12839 . _:genid12838 . _:genid12838 . _:genid12838 . _:genid12839 . _:genid12836 _:genid12837 . _:genid12836 . . "A data item that states if two or more material entities have the disposition to form a complex, and if so, how strong that disposition is. "^^ . "binding datum"^^ . . . _:genid12840 . _:genid12840 . _:genid12840 . _:genid12840 . _:genid12841 . _:genid12841 . _:genid12841 . _:genid12841 . "Half maximal inhibitory concentration (IC50) is a scalar measurement datum that measures the effectiveness of a compound to competitively inhibit a given process, and corresponds to the concentration of the compound at which it reaches half of its maximum inhibitory effect."^^ . "half maximal inhibitory concentration (IC50)"^^ . . . "A study design that is conducted entirely in a living organism, e.g. a compound treatment in a mouse model."@en . "in vivo design"@en . . . "A study design that classifies an individual or group of individuals on the basis of alleles, haplotypes, SNPs using high througput sequencing techniques."@en . "genotyping by high throughput sequencing design"@en . . . "A study design where all or part of an organism is removed and studied in vitro, e.g. part of a mouse is removed and cultured in vitro. A cell culture with an established cell line is an in vitro experiment."@en . "ex vivo design"@en . . . _:genid12842 . _:genid12842 . _:genid12842 . _:genid12842 . "a genetic characteristics information which is a part of genotype information that identifies the population of organisms"@en . "genetic population background information"@en . . . "A molecular feature identification objective that aims to detect epigenetic modifications, such as DNA methylation, histone modifications."@en . "epigenetic modification identification objective"@en . . . _:genid12843 . _:genid12843 . _:genid12843 . _:genid12843 . "A study design in which sequencing technology (e.g. Solexa/454) is used to generate RNA sequence, analyse the transcibed regions of the genome, and/or to quantitate transcript abundance"@en . "transcription profiling by high throughput sequencing design"@en . . . _:genid12844 . _:genid12846 _:genid12845 . _:genid12845 . _:genid12845 . _:genid12847 . _:genid12848 . _:genid12850 _:genid12849 . _:genid12848 _:genid12850 . _:genid12849 . _:genid12849 . _:genid12849 . _:genid12850 . _:genid12847 _:genid12848 . _:genid12845 _:genid12847 . _:genid12852 _:genid12851 . _:genid12846 _:genid12852 . _:genid12851 . _:genid12851 . _:genid12851 . _:genid12852 . _:genid12844 _:genid12846 . _:genid12844 . "A genotyping assay that uses a high througput sequencer"^^ . "genotyping by high throughput sequencing assay" . . _:genid12853 . _:genid12854 . _:genid12856 _:genid12855 . _:genid12854 _:genid12856 . _:genid12855 . _:genid12858 _:genid12857 . _:genid12857 . _:genid12857 . _:genid12859 . _:genid12860 . _:genid12862 _:genid12861 . _:genid12860 _:genid12862 . _:genid12861 . _:genid12861 . _:genid12861 . _:genid12862 . _:genid12859 _:genid12860 . _:genid12857 _:genid12859 . _:genid12864 _:genid12863 . _:genid12858 _:genid12864 . _:genid12863 . _:genid12863 . _:genid12863 . _:genid12864 . _:genid12855 _:genid12858 . _:genid12866 _:genid12865 . _:genid12856 _:genid12866 . _:genid12865 . _:genid12865 . _:genid12865 . _:genid12866 . _:genid12853 _:genid12854 . _:genid12853 . . "An assay in which chromatin is immunoprecipitated and subsequently analyzed using a DNA microarray to identify which parts of DNA are part of the isolated chromatin"^^ . "ChIP-chip assay" . . . _:genid12867 . _:genid12867 . _:genid12867 . _:genid12867 . _:genid12868 . _:genid12868 . _:genid12868 . _:genid12868 . "A study design which aims to identify protein and DNA interactions using a combination of chromatin immunoprecipitation and high throughput sequencing. Massively parallel sequence analyses are used in conjunction with whole-genome sequence databases to analyze the interaction pattern of any protein with DNA, or the pattern of any epigenetic chromatin modifications."@en . "ChIP-seq design"@en . . . _:genid12869 . _:genid12871 _:genid12870 . _:genid12870 . _:genid12870 . _:genid12872 . _:genid12873 . _:genid12875 _:genid12874 . _:genid12873 _:genid12875 . _:genid12874 . _:genid12874 . _:genid12874 . _:genid12875 . _:genid12872 _:genid12873 . _:genid12870 _:genid12872 . _:genid12877 _:genid12876 . _:genid12871 _:genid12877 . _:genid12876 . _:genid12876 . _:genid12876 . _:genid12877 . _:genid12869 _:genid12871 . _:genid12869 . "A DNA methylation profiling assay in which the methylation state of DNA is determined and can be compared between samples using sequencing based technology"^^ . "DNA methylation profiling by high throughput sequencing assay" . . . . _:genid12878 . _:genid12880 _:genid12879 . _:genid12879 . _:genid12879 . _:genid12881 . _:genid12882 . _:genid12884 _:genid12883 . _:genid12882 _:genid12884 . _:genid12883 . _:genid12883 . _:genid12883 . _:genid12884 . _:genid12881 _:genid12882 . _:genid12879 _:genid12881 . _:genid12886 _:genid12885 . _:genid12880 _:genid12886 . _:genid12885 . _:genid12885 . _:genid12885 . _:genid12886 . _:genid12878 _:genid12880 . _:genid12878 . _:genid12887 . _:genid12889 _:genid12888 . _:genid12888 . _:genid12888 . _:genid12890 . _:genid12891 . _:genid12893 _:genid12892 . _:genid12891 _:genid12893 . _:genid12892 . _:genid12892 . _:genid12892 . _:genid12893 . _:genid12890 _:genid12891 . _:genid12888 _:genid12890 . _:genid12895 _:genid12894 . _:genid12889 _:genid12895 . _:genid12894 . _:genid12894 . _:genid12894 . _:genid12895 . _:genid12887 _:genid12889 . _:genid12887 . _:genid12896 . _:genid12896 . _:genid12897 . _:genid12898 . _:genid12900 _:genid12899 . _:genid12898 _:genid12900 . _:genid12899 . _:genid12899 . _:genid12899 . _:genid12900 . _:genid12897 _:genid12898 . _:genid12896 _:genid12897 . _:genid12896 . _:genid12901 . _:genid12901 . _:genid12901 . _:genid12901 . _:genid12902 . _:genid12902 . _:genid12903 . _:genid12903 . _:genid12903 . _:genid12902 _:genid12903 . _:genid12902 . _:genid12904 . _:genid12904 . _:genid12904 . _:genid12904 . "An transcription profiling assay that determines an RNA sequence by analyzing the transcibed regions of the genome and or to quantitate transcript abundance."^^ . "RNA-seq assay" . . . _:genid12905 . _:genid12905 . _:genid12905 . _:genid12905 . "A study design in which the methylation state of DNA is determined and is compared between samples using array technology."@en . "DNA methylation profiling by array design"@en . . . "A study design that is done in a test tube or a culture dish, e.g. A bacterial invasion assay in an established cell culture."@en . "in vitro design"@en . . . _:genid12906 . _:genid12906 . _:genid12906 . _:genid12906 . "A study design that identifies forms and abundance of transcripts in the genome using microarray technology."@en . "transcription profiling by array design"@en . . . _:genid12907 . _:genid12909 _:genid12908 . _:genid12908 . _:genid12908 . _:genid12908 . _:genid12911 _:genid12910 . _:genid12909 _:genid12911 . _:genid12910 . _:genid12910 . _:genid12910 . _:genid12911 . _:genid12907 _:genid12909 . _:genid12907 . "a genetic characteristics information that is about the genetic material of an organism and minimally includes information about the genetic background and can in addition contain information about specific alleles, genetic modifications, etc."@en . "genotype information"@en . . . _:genid12912 . _:genid12912 . _:genid12912 . _:genid12912 . "A study design which aims to examine the transcriptome of a biological sample by reverse transcription PCR (RT-PCR)."@en . "transcription profiling by RT-PCR design"@en . . . _:genid12913 . _:genid12915 _:genid12914 . _:genid12914 . _:genid12914 . _:genid12916 . _:genid12917 . _:genid12919 _:genid12918 . _:genid12917 _:genid12919 . _:genid12918 . _:genid12918 . _:genid12918 . _:genid12919 . _:genid12916 _:genid12917 . _:genid12914 _:genid12916 . _:genid12921 _:genid12920 . _:genid12915 _:genid12921 . _:genid12920 . _:genid12920 . _:genid12920 . _:genid12921 . _:genid12913 _:genid12915 . _:genid12913 . _:genid12922 . _:genid12924 _:genid12923 . _:genid12923 . _:genid12923 . _:genid12925 . _:genid12926 . _:genid12928 _:genid12927 . _:genid12926 _:genid12928 . _:genid12927 . _:genid12927 . _:genid12927 . _:genid12928 . _:genid12925 _:genid12926 . _:genid12923 _:genid12925 . _:genid12930 _:genid12929 . _:genid12924 _:genid12930 . _:genid12929 . _:genid12929 . _:genid12929 . _:genid12930 . _:genid12922 _:genid12924 . _:genid12922 . _:genid12931 . _:genid12931 . _:genid12932 . _:genid12933 . _:genid12935 _:genid12934 . _:genid12933 _:genid12935 . _:genid12934 . _:genid12934 . _:genid12934 . _:genid12935 . _:genid12932 _:genid12933 . _:genid12931 _:genid12932 . _:genid12931 . _:genid12936 . _:genid12936 . _:genid12936 . _:genid12936 . "An assay that detects proteins in a sample (quantified or otherwise analyzed), e.g. antibody profiling using an array based technology."^^ . "proteomic profiling by array assay" . . . "A molecular feature identification objective that aims to characterize the abundance of transcripts"@en . "transcription profiling identification objective"@en . . . _:genid12937 . _:genid12937 . _:genid12937 . _:genid12937 . _:genid12938 . _:genid12938 . _:genid12939 . _:genid12940 . _:genid12942 _:genid12941 . _:genid12940 _:genid12942 . _:genid12941 . _:genid12941 . _:genid12941 . _:genid12942 . _:genid12939 _:genid12940 . _:genid12938 _:genid12939 . _:genid12938 . "A study design in which a modification of the transcriptome, proteome (not genome) is made, for example RNAi, antibody targeting."@en . "post-transcriptional modification design"@en . . . _:genid12943 . _:genid12945 _:genid12944 . _:genid12944 . _:genid12944 . _:genid12946 . _:genid12947 . _:genid12949 _:genid12948 . _:genid12947 _:genid12949 . _:genid12948 . _:genid12948 . _:genid12948 . _:genid12949 . _:genid12946 _:genid12947 . _:genid12944 _:genid12946 . _:genid12951 _:genid12950 . _:genid12945 _:genid12951 . _:genid12950 . _:genid12950 . _:genid12950 . _:genid12951 . _:genid12943 _:genid12945 . _:genid12943 . _:genid12952 . _:genid12952 . _:genid12952 . _:genid12952 . "A transcription profiling assay that uses reverse transcription PCR (RT-PCR)."^^ . "transcription profiling by RT-PCR assay" . . . "a genetic characteristics information that is about known changes or the lack thereof from the genetic background, including allele information, duplication, insertion, deletion, etc."@en . "genetic alteration information"@en . . . _:genid12953 . _:genid12953 . _:genid12954 . _:genid12955 . _:genid12957 _:genid12956 . _:genid12955 _:genid12957 . _:genid12956 . _:genid12956 . _:genid12956 . _:genid12957 . _:genid12954 _:genid12955 . _:genid12953 _:genid12954 . _:genid12953 . "A study design that aims to study the processes that are carried out at the cellular level, but are not necessarily restricted to a single cell. For example, cell communication occurs among more than one cell, but occurs at the cellular level."@en . "cellular process design"@en . . . _:genid12958 . _:genid12958 . _:genid12959 . _:genid12960 . _:genid12962 _:genid12961 . _:genid12960 _:genid12962 . _:genid12961 . _:genid12961 . _:genid12961 . _:genid12962 . _:genid12959 _:genid12960 . _:genid12958 _:genid12959 . _:genid12958 . _:genid12963 . _:genid12963 . _:genid12964 . _:genid12965 . _:genid12967 _:genid12966 . _:genid12965 _:genid12967 . _:genid12966 . _:genid12966 . _:genid12966 . _:genid12967 . _:genid12964 _:genid12965 . _:genid12963 _:genid12964 . _:genid12963 . "A study design in which the response of an organism(s) to the stress or stimulus is studied, e.g. osmotic stress, heat shock, radiation exposure, behavioral treatment etc."@en . "stimulus or stress design"@en . . . "A sequence feature identification objective that aims to characterize the interactions between protein and DNA which includes identification of transcription factor binding sites."@en . "protein and DNA interaction identification objective"@en . . . _:genid12968 . _:genid12968 . _:genid12968 . _:genid12968 . _:genid12969 . _:genid12969 . _:genid12970 . _:genid12971 . _:genid12973 _:genid12972 . _:genid12971 _:genid12973 . _:genid12972 . _:genid12972 . _:genid12972 . _:genid12973 . _:genid12970 _:genid12971 . _:genid12969 _:genid12970 . _:genid12969 . "A study design which aims to identify protein binding sites in genomic DNA by a combination of chromatin immunoprecipitation and DNA microarray (chip) assays."@en . "ChIP-chip design"@en . . . _:genid12974 . _:genid12974 . _:genid12975 . _:genid12976 . _:genid12978 _:genid12977 . _:genid12976 _:genid12978 . _:genid12977 . _:genid12977 . _:genid12979 . _:genid12979 . _:genid12980 . _:genid12981 . _:genid12983 _:genid12982 . _:genid12981 _:genid12983 . _:genid12982 . _:genid12982 . _:genid12982 . _:genid12983 . _:genid12980 _:genid12981 . _:genid12979 _:genid12980 . _:genid12977 _:genid12979 . _:genid12978 . _:genid12975 _:genid12976 . _:genid12974 _:genid12975 . _:genid12974 . "a data item that is about genetic material including polymorphisms, disease alleles, and haplotypes."@en . "genetic characteristics information"@en . . _:genid12984 . _:genid12984 . _:genid12984 . _:genid12984 . . "A study design that investigates protein binding sites on nucleic acids."@en . "protein binding site identification design"@en . . . "A study design that identifies forms and abundance of transcripts in the genome."^^ . "transcription profiling design"@en . . . _:genid12985 . _:genid12985 . _:genid12985 . _:genid12985 . "A study design in which proteins in a sample are detected, quantified or otherwise analysed, through an array-based technology."@en . "proteomic profiling by array design"@en . . . _:genid12986 . _:genid12986 . _:genid12986 . _:genid12986 . "A study design that classifies an individual or group of individuals on the basis of alleles, haplotypes, SNPs."@en . "genotyping design"@en . . . _:genid12987 . _:genid12987 . _:genid12987 . _:genid12987 . _:genid12988 . _:genid12988 . _:genid12989 . _:genid12990 . _:genid12992 _:genid12991 . _:genid12990 _:genid12992 . _:genid12991 . _:genid12991 . _:genid12993 . _:genid12994 . _:genid12995 . _:genid12994 _:genid12995 . _:genid12995 . _:genid12993 _:genid12994 . _:genid12991 _:genid12993 . _:genid12992 . _:genid12989 _:genid12990 . _:genid12988 _:genid12989 . _:genid12988 . "A study design in which an organism(s) is studied that has had genetic material removed, rearranged, mutagenized or added, such as in a knock out."@en . "genetic modification design"@en . . . _:genid12996 . _:genid12998 _:genid12997 . _:genid12997 . _:genid12997 . _:genid12999 . _:genid13000 . _:genid13002 _:genid13001 . _:genid13000 _:genid13002 . _:genid13001 . _:genid13001 . _:genid13001 . _:genid13002 . _:genid12999 _:genid13000 . _:genid12997 _:genid12999 . _:genid13004 _:genid13003 . _:genid12998 _:genid13004 . _:genid13003 . _:genid13003 . _:genid13003 . _:genid13004 . _:genid12996 _:genid12998 . _:genid12996 . "A transcription profiling assay that uses array technology."^^ . "transcription profiling by array assay" . . _:genid13005 . _:genid13006 . _:genid13008 _:genid13007 . _:genid13006 _:genid13008 . _:genid13007 . _:genid13007 . _:genid13007 . _:genid13010 _:genid13009 . _:genid13008 _:genid13010 . _:genid13009 . _:genid13009 . _:genid13009 . _:genid13012 _:genid13011 . _:genid13010 _:genid13012 . _:genid13011 . _:genid13011 . _:genid13011 . _:genid13012 . _:genid13005 _:genid13006 . _:genid13005 . . "A binding assay in which a collection of phages expressing a library of different peptides or protein fragnments is used to infect cells, followed by screening for cells that bind a protein of interest, and identifiying the sequence of infecting phages to determine a suitable binding partner."^^ . "phage display binding assay" . . _:genid13013 . _:genid13015 _:genid13014 . _:genid13014 . _:genid13014 . _:genid13014 . _:genid13017 _:genid13016 . _:genid13015 _:genid13017 . _:genid13016 . _:genid13016 . _:genid13018 . _:genid13019 . _:genid13020 . _:genid13019 _:genid13020 . _:genid13020 . _:genid13018 _:genid13019 . _:genid13016 _:genid13018 . _:genid13017 . _:genid13013 _:genid13015 . _:genid13013 . . "A specimen that derives from an anatomical part or substance arising from an organism. Examples of tissue specimen include tissue, organ, physiological system, blood, or body location (arm)."^^ . "specimen from organism"@en . . . _:genid13021 . _:genid13021 . _:genid13021 . _:genid13021 . "Phage display library panning is a process in which a diverse collection of phages encoding peptides or proteins are screened and the ones encoding active peptides/proteins are selected in an iterative process similar to natural selection.\n"^^ . "phage display library panning"^^ . . _:genid13022 . _:genid13023 . _:genid13025 _:genid13024 . _:genid13023 _:genid13025 . _:genid13024 . _:genid13024 . _:genid13026 . _:genid13027 . _:genid13029 _:genid13028 . _:genid13027 _:genid13029 . _:genid13028 . _:genid13028 . _:genid13028 . _:genid13029 . _:genid13026 _:genid13027 . _:genid13024 _:genid13026 . _:genid13031 _:genid13030 . _:genid13025 _:genid13031 . _:genid13030 . _:genid13030 . _:genid13032 . _:genid13033 . _:genid13035 _:genid13034 . _:genid13033 _:genid13035 . _:genid13034 . _:genid13034 . _:genid13034 . _:genid13035 . _:genid13032 _:genid13033 . _:genid13030 _:genid13032 . _:genid13031 . _:genid13022 _:genid13023 . _:genid13022 . . "An assay in which a material's fluorescence is determined."^^ . "fluorescence detection assay" . . _:genid13036 . _:genid13036 . _:genid13036 . _:genid13036 . . "A planned process to separate a material entity into different compositions of which one or more have are purified fractions that contain higher concentration of a desired component, while others contain impurities and are not of interest"^^ . "purification"@en . . _:genid13037 . _:genid13037 . _:genid13038 . _:genid13039 . _:genid13041 _:genid13040 . _:genid13039 _:genid13041 . _:genid13040 . _:genid13040 . _:genid13042 . _:genid13043 . _:genid13045 _:genid13044 . _:genid13043 _:genid13045 . _:genid13044 . _:genid13044 . _:genid13046 . _:genid13047 . _:genid13048 . _:genid13047 _:genid13048 . _:genid13048 . _:genid13046 _:genid13047 . _:genid13044 _:genid13046 . _:genid13045 . _:genid13042 _:genid13043 . _:genid13040 _:genid13042 . _:genid13041 . _:genid13038 _:genid13039 . _:genid13037 _:genid13038 . _:genid13037 . . "A specimen that has been established to be taken from a live (pre-mortem) or dead (post-mortem) organism."^^ . "specimen with pre- or post-mortem status"@en . . . _:genid13049 . _:genid13049 . _:genid13049 . _:genid13049 . "A binding constant defined as the ratio of kon over koff (on-rate of binding divided by off-rate)"^^ . "equilibrium dissociation constant (KD)"^^ . . . "A binding constant defined as the ratio of koff over kon (off-rate of binding divided by on-rate)"^^ . "equilibrium association constant (KA)"^^ . . . "A scalar measurement datum that represents the number of events occuring over a time interval"^^ . "rate measurement datum"^^ . . . . "A measurement of an IC50 value under specific assay conditions approximates KD, namely the binding reaction is at an equilibrium, there is a single population of sites on the receptor that competitor and ligand are binding to, and the concentration of the receptor must be much less than the KD for the competitor and the ligand. In this case, according to Cheng and Prussoff, KD = IC50 / (1 + Lstot / KDs), in which Lstot is the total concentration of the labeled competitor and KDs is the KD value of that competitor. "^^ . "equilibrium dissociation constant (KD) approximated by IC50"^^ . . . _:genid13050 . _:genid13050 . _:genid13050 . _:genid13050 . "A sequence data item that is about the primary structure of DNA"^^ . "DNA sequence data"^^ . . . . "A measurement of an EC50 value under specific assay conditions approximates KD, namely the binding reaction is at an equilibrium, and the concentration of the receptor must be much less than the KD for the ligand. "^^ . "equilibrium dissociation constant (KD) approximated by EC50"^^ . . . . "A half life datum of the time it takes for 50% of bound complexes in an ensemble to disassociate in absence of re-association. "^^ . "half life of binding datum"^^ . . . "The process of material entities forming complexes. "^^ . "binding"^^ . . . "A binding assay that measures the formation or disassociation of a complex of 2 material entities directly without use of a competitve ligand."^^ . "direct binding assay" . . . _:genid13051 . _:genid13051 . _:genid13052 . _:genid13053 . _:genid13055 _:genid13054 . _:genid13053 _:genid13055 . _:genid13054 . _:genid13054 . _:genid13054 . _:genid13055 . _:genid13052 _:genid13053 . _:genid13051 _:genid13052 . _:genid13051 . "A binding assay that detects the inhibition of binding between 2 material entities known to form a complex by the addition of a third material entity of interest. Inhibition of binding between the 2 materials reflects binding by the third material."^^ . "competitive inhibition of binding assay" . . . . "A rate measurement datum of how quickly bound complexes disassociate"^^ . "binding off rate measurement datum (koff)"^^ . . . . "A rate measurement datum of how quickly bound complexes form"^^ . "binding on rate measurement datum (kon)"^^ . . _:genid13056 . _:genid13057 . _:genid13059 _:genid13058 . _:genid13057 _:genid13059 . _:genid13058 . _:genid13061 _:genid13060 . _:genid13060 . _:genid13060 . _:genid13062 . _:genid13063 . _:genid13065 _:genid13064 . _:genid13063 _:genid13065 . _:genid13064 . _:genid13064 . _:genid13064 . _:genid13065 . _:genid13062 _:genid13063 . _:genid13060 _:genid13062 . _:genid13067 _:genid13066 . _:genid13061 _:genid13067 . _:genid13066 . _:genid13066 . _:genid13066 . _:genid13067 . _:genid13058 _:genid13061 . _:genid13069 _:genid13068 . _:genid13059 _:genid13069 . _:genid13068 . _:genid13071 _:genid13070 . _:genid13070 . _:genid13070 . _:genid13072 . _:genid13073 . _:genid13075 _:genid13074 . _:genid13073 _:genid13075 . _:genid13074 . _:genid13074 . _:genid13074 . _:genid13075 . _:genid13072 _:genid13073 . _:genid13070 _:genid13072 . _:genid13077 _:genid13076 . _:genid13071 _:genid13077 . _:genid13076 . _:genid13076 . _:genid13076 . _:genid13077 . _:genid13068 _:genid13071 . _:genid13069 . _:genid13056 _:genid13057 . _:genid13056 . . "An analyte assay that uses a biomaterial's preferential affinity for either the mobile phase or the stationary phase to separate it from other materials and thereby detect its presence in an input material."^^ . "analytical chromatography" . . _:genid13078 . _:genid13079 . _:genid13081 _:genid13080 . _:genid13079 _:genid13081 . _:genid13080 . _:genid13083 _:genid13082 . _:genid13082 . _:genid13082 . _:genid13084 . _:genid13085 . _:genid13087 _:genid13086 . _:genid13085 _:genid13087 . _:genid13086 . _:genid13086 . _:genid13086 . _:genid13087 . _:genid13084 _:genid13085 . _:genid13082 _:genid13084 . _:genid13089 _:genid13088 . _:genid13083 _:genid13089 . _:genid13088 . _:genid13088 . _:genid13088 . _:genid13089 . _:genid13080 _:genid13083 . _:genid13081 . _:genid13078 _:genid13079 . _:genid13078 . . "An imaging assay in which an electrons are used to probe the density, shape and composition of an input material which are detected in an electron microscope and utilized to produce an image of the material."^^ . "electron microscopy imaging assay" . . . _:genid13090 . _:genid13092 _:genid13091 . _:genid13091 . _:genid13091 . _:genid13093 . _:genid13094 . _:genid13096 _:genid13095 . _:genid13094 _:genid13096 . _:genid13095 . _:genid13095 . _:genid13095 . _:genid13096 . _:genid13093 _:genid13094 . _:genid13091 _:genid13093 . _:genid13098 _:genid13097 . _:genid13092 _:genid13098 . _:genid13097 . _:genid13097 . _:genid13097 . _:genid13098 . _:genid13090 _:genid13092 . _:genid13090 . "A assay detecting a molecular label assay in which the label is attached to an antibody so that substances are marked based on the antibody's binding specificity."^^ . "immuno staining assay" . . _:genid13099 . _:genid13100 . _:genid13102 _:genid13101 . _:genid13100 _:genid13102 . _:genid13101 . _:genid13101 . _:genid13101 . _:genid13102 . _:genid13099 _:genid13100 . _:genid13099 . . "A material entity that is generated by a purification process in which an input material is separated to obtain a fraction with a higher concentration of a desired component"^^ . "purified material"^^ . . _:genid13103 . _:genid13104 . _:genid13106 _:genid13105 . _:genid13104 _:genid13106 . _:genid13105 . _:genid13108 _:genid13107 . _:genid13107 . _:genid13107 . _:genid13109 . _:genid13110 . _:genid13112 _:genid13111 . _:genid13110 _:genid13112 . _:genid13111 . _:genid13111 . _:genid13111 . _:genid13112 . _:genid13109 _:genid13110 . _:genid13107 _:genid13109 . _:genid13114 _:genid13113 . _:genid13108 _:genid13114 . _:genid13113 . _:genid13113 . _:genid13113 . _:genid13114 . _:genid13105 _:genid13108 . _:genid13106 . _:genid13103 _:genid13104 . _:genid13103 . . "A binding assay in which the heat generated or absorbed during a binding event is measured, which allows determination of binding constants, reaction stoichiometry, enthalpy and entropy."^^ . "calorimetric binding assay" . . . _:genid13115 . _:genid13117 _:genid13116 . _:genid13116 . _:genid13116 . _:genid13118 . _:genid13119 . _:genid13121 _:genid13120 . _:genid13119 _:genid13121 . _:genid13120 . _:genid13120 . _:genid13120 . _:genid13121 . _:genid13118 _:genid13119 . _:genid13116 _:genid13118 . _:genid13123 _:genid13122 . _:genid13117 _:genid13123 . _:genid13122 . _:genid13122 . _:genid13124 . _:genid13125 . _:genid13127 _:genid13126 . _:genid13125 _:genid13127 . _:genid13126 . _:genid13126 . _:genid13126 . _:genid13127 . _:genid13124 _:genid13125 . _:genid13122 _:genid13124 . _:genid13123 . _:genid13115 _:genid13117 . _:genid13115 . "A binding assay in which affinity is measured by detecting a change in fluorescence (usually quenching) that occurs upon binding of the antibody to the ligand. The fluorescent signal that is affected by binding is either from an exogenous fluorophore attached to the ligand, or is the intrisic fluorescence of aromatic (tryptophan) residues on the binding site of the antibody (no conjugated fluorophore necessary) or, less commonly, on the ligand binding region (epitope)."^^ . "antibody binding detection by fluorescence quenching" . . . _:genid13128 . _:genid13128 . _:genid13128 . _:genid13128 . _:genid13129 . _:genid13129 . _:genid13130 . _:genid13130 . _:genid13130 . _:genid13129 _:genid13130 . _:genid13129 . _:genid13131 . _:genid13131 . _:genid13131 . _:genid13131 . "A binding assay that screens membrane soluble proteins by fusion of two integral membrane proteins (bait and prey) to two different ubiquitin moieties. One moiety is also fused to a transcription factor (TF) that can be cleaved off by ubiquitin specific proteases. Upon bait and prey interaction, Nub and Cub-moieties assemble, reconstituting the split-ubiquitin. The reconstituted split-ubiquitin molecule is recognized by ubiquitin specific proteases, which cleave off the reporter protein, allowing it to induce the transcription of reporter genes."^^ . "split-ubiquitin assay" . . . _:genid13132 . _:genid13132 . _:genid13132 . _:genid13132 . _:genid13133 . _:genid13133 . _:genid13134 . _:genid13134 . _:genid13134 . _:genid13133 _:genid13134 . _:genid13133 . "An assay that measures protein-protein interactions by separating target proteins on an SDS-PAGE gel, transfering them to a solid substrate, hybridizing with a protein probe and visualizing bound proteins using a probe-directed antibody. This is a adaptation on the western blot assay."^^ . "far-Western blot assay" . . . _:genid13135 . _:genid13135 . _:genid13135 . _:genid13135 . _:genid13136 . _:genid13136 . _:genid13137 . _:genid13137 . _:genid13137 . _:genid13136 _:genid13137 . _:genid13136 . "An assay that determines the presence and estimates abundance of transcript species by first creating an homo or heteroduplex by adding a specific, complementary sequence to the sequence of interest and then exposing the mixture of ribonuclease, which will degrade only single stranded molecules. A detection step will reveal if the sample contained a sequence of interest."^^ . "RNA protection assay" . . . _:genid13138 . _:genid13138 . _:genid13138 . _:genid13138 . _:genid13139 . _:genid13139 . _:genid13140 . _:genid13140 . _:genid13140 . _:genid13139 _:genid13140 . _:genid13139 . "An assay that measures information about Protein-DNA or Protein-RNA interactions using gel electrophoresis and relying on the fact the molecular interactions will cause the heterodimer to be retarded on the gel when compared to controls corresponding to protein extract alone and protein extract + neutral nucleic acid."^^ . "electrophoretic mobility shift assay" . . . _:genid13141 . _:genid13141 . _:genid13141 . _:genid13141 . _:genid13142 . _:genid13142 . _:genid13142 . _:genid13142 . _:genid13143 . _:genid13143 . _:genid13144 . _:genid13144 . _:genid13145 . _:genid13146 . _:genid13147 . _:genid13146 _:genid13147 . _:genid13147 . _:genid13145 _:genid13146 . _:genid13144 _:genid13145 . _:genid13143 _:genid13144 . _:genid13143 . "An assay which transiently disrupts gene transcripts by expressing antisense RNA constructs or delivering RNA interfering molecules in cells."^^ . "gene knock-down assay" . . . _:genid13148 . _:genid13148 . _:genid13148 . _:genid13148 . _:genid13149 . _:genid13149 . _:genid13150 . _:genid13150 . _:genid13150 . _:genid13149 _:genid13150 . _:genid13149 . _:genid13151 . _:genid13151 . _:genid13151 . _:genid13151 . "A transcription profiling assay that is performed using a very low amount (nanogram scale) of mRNA samples using Cap analysis gene expression (CAGE)."^^ . "nano-cap analysis of gene expression assay" . . . . _:genid13152 . _:genid13154 _:genid13153 . _:genid13153 . _:genid13153 . _:genid13155 . _:genid13156 . _:genid13158 _:genid13157 . _:genid13156 _:genid13158 . _:genid13157 . _:genid13157 . _:genid13157 . _:genid13158 . _:genid13155 _:genid13156 . _:genid13153 _:genid13155 . _:genid13160 _:genid13159 . _:genid13154 _:genid13160 . _:genid13159 . _:genid13159 . _:genid13159 . _:genid13160 . _:genid13152 _:genid13154 . _:genid13152 . _:genid13161 . _:genid13161 . _:genid13161 . _:genid13161 . _:genid13162 . _:genid13162 . _:genid13162 . _:genid13162 . _:genid13163 . _:genid13163 . _:genid13163 . _:genid13163 . _:genid13164 . _:genid13164 . _:genid13165 . _:genid13165 . _:genid13165 . _:genid13164 _:genid13165 . _:genid13164 . _:genid13166 . _:genid13166 . _:genid13166 . _:genid13166 . "A transcription profiling assay which measures RNA transcript abundances in biological samples by extracting 5' ends of capped transcripts, RTPCR and sequence those. Copy numbers of CAGE tags provide a way of quantification and provide a measure of expression of the transcriptome"^^ . "cap analysis of gene expression assay" . . . _:genid13167 . _:genid13167 . _:genid13167 . _:genid13167 . _:genid13168 . _:genid13168 . _:genid13169 . _:genid13169 . _:genid13169 . _:genid13168 _:genid13169 . _:genid13168 . _:genid13170 . _:genid13170 . _:genid13170 . _:genid13170 . "An assay that detects protein protein interactions and protein DNA interactions by testing for physical interactions (such as binding) between two proteins or a single protein and a DNA molecule, respectively. The premise behind the test is the activation of downstream reporter gene(s) by the binding of a transcription factor onto an upstream activating sequence (UAS). For two-hybrid screening, the transcription factor is split into two separate fragments, called the binding domain (BD) and activating domain (AD). The BD is the domain responsible for binding to the UAS and the AD is the domain responsible for the activation of transcription. The Y2H is thus a protein-fragment complementation assay."^^ . "yeast 2-hybrid assay" . . . _:genid13171 . _:genid13171 . _:genid13171 . _:genid13171 . _:genid13172 . _:genid13172 . _:genid13173 . _:genid13173 . _:genid13173 . _:genid13172 _:genid13173 . _:genid13172 . "An assay that determines protein DNA interactions using a single fusion protein in which the activating domain is linked directly to the binding domain."^^ . "yeast one-hybrid assay" . . . _:genid13174 . _:genid13174 . _:genid13174 . _:genid13174 . "An assay that identifies the sequence-specific target site of a DNA-binding domain. In this system, a given transcription factor (TF) is expressed as a fusion to a subunit of RNA polymerase. In parallel, a library of randomized oligonucleotides representing potential TF target sequences, is cloned into a separate vector containing the selectable genes HIS3 and URA3. If the DNA-binding domain (bait) binds a potential DNA target site (prey) in vivo, it will recruit RNA polymerase to the promoter and activate transcription of the reporter genes in that clone. The two reporter genes, HIS3 and URA3, allow for positive and negative selections, respectively. At the end of the process, positive clones are sequenced and examined with motif-finding tools in order to resolve the favoured DNA target sequence"^^ . "bacterial one-hybrid assay" . . . _:genid13175 . _:genid13177 _:genid13176 . _:genid13176 . _:genid13176 . _:genid13178 . _:genid13179 . _:genid13181 _:genid13180 . _:genid13179 _:genid13181 . _:genid13180 . _:genid13180 . _:genid13182 . _:genid13182 . _:genid13182 . _:genid13180 _:genid13182 . _:genid13181 . _:genid13178 _:genid13179 . _:genid13176 _:genid13178 . _:genid13184 _:genid13183 . _:genid13177 _:genid13184 . _:genid13183 . _:genid13183 . _:genid13185 . _:genid13187 _:genid13186 . _:genid13186 . _:genid13186 . _:genid13186 . _:genid13189 _:genid13188 . _:genid13187 _:genid13189 . _:genid13188 . _:genid13188 . _:genid13188 . _:genid13189 . _:genid13185 _:genid13187 . _:genid13183 _:genid13185 . _:genid13184 . _:genid13175 _:genid13177 . _:genid13175 . _:genid13190 . _:genid13190 . _:genid13190 . _:genid13190 . _:genid13191 . _:genid13191 . _:genid13192 . _:genid13192 . _:genid13192 . _:genid13191 _:genid13192 . _:genid13191 . "An in-situ hybridization assay that uses fluorescence to detect chromosomal integrity"^^ . "chromosome organization assay by fluorescence in-situ hybridization" . . . _:genid13193 . _:genid13193 . _:genid13194 . _:genid13194 . _:genid13194 . _:genid13193 _:genid13194 . _:genid13193 . "An assay that uses initial modification of DNA by sodium bisulfite, converting all unmethylated, but not methylated, cytosines to uracil, and subsequent amplification with primers specific for methylated versus unmethylated DNA."^^ . "methylation-specific polymerase chain reaction assay" . . . _:genid13195 . _:genid13195 . _:genid13195 . _:genid13195 . _:genid13196 . _:genid13196 . _:genid13197 . _:genid13197 . _:genid13197 . _:genid13196 _:genid13197 . _:genid13196 . "An assay that estimates genome-wide DNA methylation and measures methylation of DNA sequences. AIMS is based on the differential enzymatic digestion of genomic DNA with methylation-sensitive and methylation-insensitive isoschizomers followed by restrained PCR amplification of methylated sequences."^^ . "amplification of intermethylated sites assay" . . . _:genid13198 . _:genid13198 . _:genid13198 . _:genid13198 . _:genid13199 . _:genid13199 . _:genid13199 . _:genid13199 . _:genid13200 . _:genid13200 . _:genid13201 . _:genid13201 . _:genid13201 . _:genid13200 _:genid13201 . _:genid13200 . _:genid13202 . _:genid13202 . _:genid13202 . _:genid13202 . "An assay that localizes a specific DNA or RNA sequence within a portion or section of tissue using artificially induced nucleic hybridization."^^ . "in-situ hybridization assay" . . . _:genid13203 . _:genid13203 . _:genid13203 . _:genid13203 . _:genid13204 . _:genid13204 . _:genid13205 . _:genid13205 . _:genid13205 . _:genid13204 _:genid13205 . _:genid13204 . _:genid13206 . _:genid13206 . _:genid13206 . _:genid13206 . "An assay which uses compound cytochalasin (CHEBI: 23528) to block actin polymerization-dependent cell motility (GO:0070358) and actin filament polymerization (GO:0030041)."^^ . "cytochalasin-induced inhibition of actin polymerization assay" . . . "is an objective specification which aims to discover cellular structure properties"@en . "cellular structure feature identification objective"@en . . _:genid13207 . _:genid13208 . _:genid13210 _:genid13209 . _:genid13208 _:genid13210 . _:genid13209 . _:genid13212 _:genid13211 . _:genid13211 . _:genid13211 . _:genid13213 . _:genid13214 . _:genid13216 _:genid13215 . _:genid13214 _:genid13216 . _:genid13215 . _:genid13215 . _:genid13215 . _:genid13216 . _:genid13213 _:genid13214 . _:genid13211 _:genid13213 . _:genid13218 _:genid13217 . _:genid13212 _:genid13218 . _:genid13217 . _:genid13217 . _:genid13217 . _:genid13218 . _:genid13209 _:genid13212 . _:genid13220 _:genid13219 . _:genid13210 _:genid13220 . _:genid13219 . _:genid13219 . _:genid13219 . _:genid13220 . _:genid13207 _:genid13208 . _:genid13207 . . "An analyte assay in which an input material is mixed with antibodies and bound antigen:antibody complexes are separated out using immunoprecipitation. Either the antibody has known specificy, and the antigen mixture is tested for the presence of a specific antigen, or the antigen solution is well defined and the antibody solution is tested for the presence of antigen specific antibodies."^^ . "immunoprecipitation assay" . . . . _:genid13221 . _:genid13221 . _:genid13222 . _:genid13223 . _:genid13225 _:genid13224 . _:genid13223 _:genid13225 . _:genid13224 . _:genid13224 . _:genid13226 . _:genid13227 . _:genid13229 _:genid13228 . _:genid13227 _:genid13229 . _:genid13228 . _:genid13228 . _:genid13228 . _:genid13229 . _:genid13226 _:genid13227 . _:genid13224 _:genid13226 . _:genid13225 . _:genid13222 _:genid13223 . _:genid13221 _:genid13222 . _:genid13221 . _:genid13230 . _:genid13230 . _:genid13230 . _:genid13230 . _:genid13231 . _:genid13231 . _:genid13232 . _:genid13233 . _:genid13235 _:genid13234 . _:genid13233 _:genid13235 . _:genid13234 . _:genid13234 . _:genid13234 . _:genid13235 . _:genid13232 _:genid13233 . _:genid13231 _:genid13232 . _:genid13231 . "a process of an immunoglobulin complex binding to a material entity at the immunoglobulin complementarity determining region (CDR). "^^ . "immunoglobulin binding to epitope"^^ . . _:genid13236 . _:genid13237 . _:genid13239 _:genid13238 . _:genid13237 _:genid13239 . _:genid13238 . _:genid13238 . _:genid13238 . _:genid13239 . _:genid13236 _:genid13237 . _:genid13236 . . "A library preparation that results in the creation of a library of the 5' and 3' ends of DNA or cDNA fragments using adaptors and endonucleases. The preparation may or may not include cloning process. " . "paired-end library preparation"@en . . . . _:genid13240 . _:genid13240 . _:genid13240 . _:genid13240 . _:genid13241 . _:genid13241 . _:genid13241 . _:genid13241 . _:genid13242 . _:genid13242 . _:genid13242 . _:genid13242 . _:genid13243 . _:genid13243 . _:genid13243 . _:genid13243 . _:genid13244 . _:genid13244 . _:genid13245 . _:genid13245 . _:genid13245 . _:genid13244 _:genid13245 . _:genid13244 . "An assay that identifies unmethylated CpGs using methylation sensitive restriction enzymes to fragment DNA."^^ . "methylation-sensitive restriction enzyme sequencing assay" . . . _:genid13246 . _:genid13246 . _:genid13246 . _:genid13246 . "A device made to be used in an analyte assay for immobilization of substances that bind the analyte at regular spatial positions on a surface." . "assay array"@en . . _:genid13247 . _:genid13248 . _:genid13250 _:genid13249 . _:genid13248 _:genid13250 . _:genid13249 . _:genid13249 . _:genid13249 . _:genid13250 . _:genid13247 _:genid13248 . _:genid13247 . . _:genid13251 . _:genid13251 . _:genid13251 . _:genid13251 . "A biological or chemical entity that bears a reagent role in virtue of it being intended for application in a scientific technique to participate in (or have molecular parts that participate in) a chemical reaction that facilitates the generation of data about some distinct entity, or the generation of some distinct material specified output." . "reagent"@en . . . "A processed material that serves as a liquid vehicle for freezing cells for long term quiescent stroage, which contains chemicls needed to sustain cell viability across freeze-thaw cycles. "^^ . "cell freezing medium"@en . . . _:genid13252 . _:genid13252 . _:genid13252 . _:genid13252 . "A polymerase chain reaction that amplifies multiple targets with a single primer pair mediated by hybridization of a primer with its target sequence using ligation." . "multiplex ligation-mediated amplification"@en . . . "A molecular feature identification objective that aims to determine spatial organization of chromatin." . "chromosome conformation identification objective"@en . . . _:genid13253 . _:genid13255 _:genid13254 . _:genid13254 . _:genid13254 . _:genid13256 . _:genid13257 . _:genid13259 _:genid13258 . _:genid13257 _:genid13259 . _:genid13258 . _:genid13258 . _:genid13258 . _:genid13259 . _:genid13256 _:genid13257 . _:genid13254 _:genid13256 . _:genid13261 _:genid13260 . _:genid13255 _:genid13261 . _:genid13260 . _:genid13260 . _:genid13260 . _:genid13261 . _:genid13253 _:genid13255 . _:genid13253 . _:genid13262 . _:genid13264 _:genid13263 . _:genid13263 . _:genid13263 . _:genid13265 . _:genid13266 . _:genid13268 _:genid13267 . _:genid13266 _:genid13268 . _:genid13267 . _:genid13267 . _:genid13267 . _:genid13268 . _:genid13265 _:genid13266 . _:genid13263 _:genid13265 . _:genid13270 _:genid13269 . _:genid13264 _:genid13270 . _:genid13269 . _:genid13269 . _:genid13271 . _:genid13272 . _:genid13274 _:genid13273 . _:genid13272 _:genid13274 . _:genid13273 . _:genid13273 . _:genid13273 . _:genid13274 . _:genid13271 _:genid13272 . _:genid13269 _:genid13271 . _:genid13270 . _:genid13262 _:genid13264 . _:genid13262 . _:genid13275 . _:genid13275 . _:genid13275 . _:genid13275 . _:genid13276 . _:genid13276 . _:genid13276 . _:genid13276 . _:genid13277 . _:genid13277 . _:genid13277 . _:genid13277 . _:genid13278 . _:genid13278 . _:genid13278 . _:genid13278 . _:genid13279 . _:genid13279 . _:genid13279 . _:genid13279 . _:genid13280 . _:genid13280 . _:genid13280 . _:genid13280 . _:genid13281 . _:genid13281 . _:genid13281 . _:genid13281 . "An assay that measures the organization of chromosomes at the genome-wide scale."^^ . "Carbon-copy chromosome conformation capture assay" . . . _:genid13282 . _:genid13284 _:genid13283 . _:genid13283 . _:genid13283 . _:genid13285 . _:genid13286 . _:genid13288 _:genid13287 . _:genid13286 _:genid13288 . _:genid13287 . _:genid13287 . _:genid13287 . _:genid13288 . _:genid13285 _:genid13286 . _:genid13283 _:genid13285 . _:genid13290 _:genid13289 . _:genid13284 _:genid13290 . _:genid13289 . _:genid13289 . _:genid13289 . _:genid13290 . _:genid13282 _:genid13284 . _:genid13282 . _:genid13291 . _:genid13291 . _:genid13291 . _:genid13291 . _:genid13292 . _:genid13292 . _:genid13292 . _:genid13292 . _:genid13293 . _:genid13293 . _:genid13293 . _:genid13293 . "A ChIP-seq assay which uses immunoprecipitation to isolate protein bound DNA followed by an exonuclease step to degrade DNA that is not protein bound to provide greater resolution of the DNA binding site"^^ . "chromatin immunoprecipitation with exonuclease sequencing assay" . . . _:genid13294 . _:genid13294 . _:genid13294 "1"^^ . _:genid13294 . _:genid13295 . _:genid13295 . _:genid13295 "1"^^ . _:genid13295 . "A value specification that consists of two parts: a numeral and a unit label" . "scalar value specification" . . . "An information content entity that specifies a value within a classification scheme or on a quantitative scale." . "value specification" . . _:genid13296 . _:genid13297 . _:genid13299 _:genid13298 . _:genid13297 _:genid13299 . _:genid13298 . _:genid13298 . _:genid13298 . _:genid13301 _:genid13300 . _:genid13299 _:genid13301 . _:genid13300 . _:genid13300 . _:genid13300 . _:genid13301 . _:genid13296 _:genid13297 . _:genid13296 . . "a material entity that is the specified output of an addition of molecular label process that aims to label some molecular target to allow for its detection in a detection of molecular label assay" . "molecular-labeled material"^^ . . _:genid13302 . _:genid13303 . _:genid13305 _:genid13304 . _:genid13303 _:genid13305 . _:genid13304 . _:genid13307 _:genid13306 . _:genid13306 . _:genid13306 . _:genid13308 . _:genid13309 . _:genid13311 _:genid13310 . _:genid13309 _:genid13311 . _:genid13310 . _:genid13310 . _:genid13312 . _:genid13312 . _:genid13312 . _:genid13310 _:genid13312 . _:genid13311 . _:genid13308 _:genid13309 . _:genid13306 _:genid13308 . _:genid13314 _:genid13313 . _:genid13307 _:genid13314 . _:genid13313 . _:genid13313 . _:genid13315 . _:genid13317 _:genid13316 . _:genid13316 . _:genid13316 . _:genid13316 . _:genid13319 _:genid13318 . _:genid13317 _:genid13319 . _:genid13318 . _:genid13318 . _:genid13318 . _:genid13319 . _:genid13315 _:genid13317 . _:genid13313 _:genid13315 . _:genid13314 . _:genid13304 _:genid13307 . _:genid13321 _:genid13320 . _:genid13305 _:genid13321 . _:genid13320 . _:genid13320 . _:genid13320 . _:genid13323 _:genid13322 . _:genid13321 _:genid13323 . _:genid13322 . _:genid13322 . _:genid13324 . _:genid13325 . _:genid13326 . _:genid13325 _:genid13326 . _:genid13326 . _:genid13324 _:genid13325 . _:genid13322 _:genid13324 . _:genid13323 . _:genid13302 _:genid13303 . _:genid13302 . . "An assay in which portions of chromatin, the ordered and organized complex of DNA and its interaction partners that make up a chormosome, is extracted and purified by immunoprecipitation with antibodies or tags, and subsequently analyzed"^^ . "ChIP assay" . . . "A positive reference substance role that inheres in a material entity that is known to bind to a target entity, and that is realized in a competitive binding assay that has as specified input the target entity, an evaluant and the positive reference substance, where the binding of the evaluant to the target is measured based on the evaluant's ability to compete with the positive reference substance for binding to the target." . "competitive binding reference ligand role" . . . _:genid13327 . _:genid13327 . _:genid13327 . _:genid13327 . _:genid13328 . _:genid13328 . _:genid13329 . _:genid13330 . _:genid13331 . _:genid13330 _:genid13331 . _:genid13331 . _:genid13329 _:genid13330 . _:genid13328 _:genid13329 . _:genid13328 . "An assay that produces data about protein-DNA interaction or DNA epigenetic modification using immunoprecipitation"^^ . "assay using chromatin immunoprecipitation" . . _:genid13332 . _:genid13333 . _:genid13335 _:genid13334 . _:genid13333 _:genid13335 . _:genid13334 . _:genid13337 _:genid13336 . _:genid13336 . _:genid13336 . _:genid13338 . _:genid13339 . _:genid13341 _:genid13340 . _:genid13339 _:genid13341 . _:genid13340 . _:genid13340 . _:genid13340 . _:genid13341 . _:genid13338 _:genid13339 . _:genid13336 _:genid13338 . _:genid13343 _:genid13342 . _:genid13337 _:genid13343 . _:genid13342 . _:genid13342 . _:genid13344 . _:genid13345 . _:genid13347 _:genid13346 . _:genid13345 _:genid13347 . _:genid13346 . _:genid13346 . _:genid13346 . _:genid13347 . _:genid13344 _:genid13345 . _:genid13342 _:genid13344 . _:genid13343 . _:genid13334 _:genid13337 . _:genid13335 . _:genid13332 _:genid13333 . _:genid13332 . . "An assay that measures properties of cells."^^ . "cytometry assay" . . . _:genid13348 . _:genid13348 . _:genid13348 . _:genid13348 . "A binding assay in which the proximity of two entities is monitored by measuring a fluorescent signal of one of the entities that gets reduced if the two entities are cliose to each other."^^ . "fluorescence quenching binding assay" . . _:genid13349 . _:genid13350 . _:genid13352 _:genid13351 . _:genid13350 _:genid13352 . _:genid13351 . _:genid13354 _:genid13353 . _:genid13353 . _:genid13353 . _:genid13355 . _:genid13356 . _:genid13358 _:genid13357 . _:genid13356 _:genid13358 . _:genid13357 . _:genid13357 . _:genid13357 . _:genid13358 . _:genid13355 _:genid13356 . _:genid13353 _:genid13355 . _:genid13360 _:genid13359 . _:genid13354 _:genid13360 . _:genid13359 . _:genid13359 . _:genid13359 . _:genid13360 . _:genid13351 _:genid13354 . _:genid13352 . _:genid13349 _:genid13350 . _:genid13349 . . "An analyte assay where binding of the analyte to immobilized matrix is measured."^^ . "microarray assay" . . _:genid13361 . _:genid13362 . _:genid13364 _:genid13363 . _:genid13362 _:genid13364 . _:genid13363 . _:genid13366 _:genid13365 . _:genid13365 . _:genid13365 . _:genid13367 . _:genid13368 . _:genid13370 _:genid13369 . _:genid13368 _:genid13370 . _:genid13369 . _:genid13369 . _:genid13369 . _:genid13370 . _:genid13367 _:genid13368 . _:genid13365 _:genid13367 . _:genid13372 _:genid13371 . _:genid13366 _:genid13372 . _:genid13371 . _:genid13371 . _:genid13373 . _:genid13374 . _:genid13376 _:genid13375 . _:genid13374 _:genid13376 . _:genid13375 . _:genid13375 . _:genid13375 . _:genid13376 . _:genid13373 _:genid13374 . _:genid13371 _:genid13373 . _:genid13372 . _:genid13363 _:genid13366 . _:genid13378 _:genid13377 . _:genid13364 _:genid13378 . _:genid13377 . _:genid13380 _:genid13379 . _:genid13379 . _:genid13379 . _:genid13381 . _:genid13382 . _:genid13384 _:genid13383 . _:genid13382 _:genid13384 . _:genid13383 . _:genid13383 . _:genid13383 . _:genid13384 . _:genid13381 _:genid13382 . _:genid13379 _:genid13381 . _:genid13386 _:genid13385 . _:genid13380 _:genid13386 . _:genid13385 . _:genid13385 . _:genid13385 . _:genid13386 . _:genid13377 _:genid13380 . _:genid13378 . _:genid13361 _:genid13362 . _:genid13361 . . "An immunostaining assay to detect and potentially localize antigens within the cells of a tissue section."^^ . "immunohistochemistry" . . _:genid13387 . _:genid13388 . _:genid13390 _:genid13389 . _:genid13388 _:genid13390 . _:genid13389 . _:genid13389 . _:genid13389 . _:genid13390 . _:genid13387 _:genid13388 . _:genid13387 . . "An assay that identifies epigenetic modifications including histone modifications, open chromatin, and DNA methylation."^^ . "epigenetic modification assay" . . . "A mass spectrometry assay that measures the absolute mass of the cleaved peptides derived from an unknown protein of interest. These masses are then compared to values for known protein sequences to identify the unknown protein."^^ . "peptide mass fingerprinting assay" . . _:genid13391 . _:genid13392 . _:genid13394 _:genid13393 . _:genid13392 _:genid13394 . _:genid13393 . _:genid13393 . _:genid13393 . _:genid13394 . _:genid13391 _:genid13392 . _:genid13391 . . "A material entity that has two or more specimens as its parts."@en . "collection of specimens"@en . . . "An assay that detects expression of a reporter gene that was inserted under the control of a regulatory sequence of interest."^^ . "reporter gene assay" . . _:genid13395 . _:genid13395 . _:genid13395 . _:genid13395 . . . "A container with an environmental control function."@en . "physical store"@en . . . "A reverse transcribed polymerase chain reaction that is used to amplify a mRNA sequence between a defined internal site and the 5' or 3' end of the mRNA."@en . "rapid amplification of cDNA ends"@en . . _:genid13396 . _:genid13397 . _:genid13399 _:genid13398 . _:genid13397 _:genid13399 . _:genid13398 . _:genid13401 _:genid13400 . _:genid13400 . _:genid13400 . _:genid13402 . _:genid13403 . _:genid13405 _:genid13404 . _:genid13403 _:genid13405 . _:genid13404 . _:genid13404 . _:genid13404 . _:genid13405 . _:genid13402 _:genid13403 . _:genid13400 _:genid13402 . _:genid13407 _:genid13406 . _:genid13401 _:genid13407 . _:genid13406 . _:genid13406 . _:genid13406 . _:genid13407 . _:genid13398 _:genid13401 . _:genid13399 . _:genid13396 _:genid13397 . _:genid13396 . . "An analytical chromatography assay that utilizes a high performance liquid chromatography instrument for separation of compounts in a solution."^^ . "high performance liquid chromotography assay" . . _:genid13408 . _:genid13409 . _:genid13411 _:genid13410 . _:genid13409 _:genid13411 . _:genid13410 . _:genid13413 _:genid13412 . _:genid13412 . _:genid13412 . _:genid13414 . _:genid13415 . _:genid13417 _:genid13416 . _:genid13415 _:genid13417 . _:genid13416 . _:genid13416 . _:genid13416 . _:genid13417 . _:genid13414 _:genid13415 . _:genid13412 _:genid13414 . _:genid13419 _:genid13418 . _:genid13413 _:genid13419 . _:genid13418 . _:genid13418 . _:genid13418 . _:genid13419 . _:genid13410 _:genid13413 . _:genid13411 . _:genid13408 _:genid13409 . _:genid13408 . . "An imaging assay that utilizes a microscope to magnify features of the visualized material of interest that are not visible to naked eye."^^ . "microscopy assay" . . . "An assay that determines the specific location of a protein. Subcellular localization is distinguished from tissue-based localization based on the type of microscopy applied."^^ . "protein localization assay" . . . _:genid13420 . _:genid13422 _:genid13421 . _:genid13421 . _:genid13421 . _:genid13423 . _:genid13424 . _:genid13426 _:genid13425 . _:genid13424 _:genid13426 . _:genid13425 . _:genid13425 . _:genid13425 . _:genid13426 . _:genid13423 _:genid13424 . _:genid13421 _:genid13423 . _:genid13428 _:genid13427 . _:genid13422 _:genid13428 . _:genid13427 . _:genid13427 . _:genid13427 . _:genid13428 . _:genid13420 _:genid13422 . _:genid13420 . "A protein localization assay that determines the specific subcellular location of a protein. The location is visualized through electron microscopy."^^ . "subcellular protein localization assay" . . . _:genid13429 . _:genid13429 . _:genid13429 . _:genid13429 . "A ChIP assay that uses quantitative PCR to determine levels of specific DNA in immunoprecipitated samples."^^ . "ChIP-qPCR assay" . . . "An analyte assay that detects molecules in a mixture dotted on a membrane using DNA probes or antibodies."^^ . "dot blot assay" . . . _:genid13430 . _:genid13432 _:genid13431 . _:genid13431 . _:genid13431 . _:genid13433 . _:genid13434 . _:genid13436 _:genid13435 . _:genid13434 _:genid13436 . _:genid13435 . _:genid13435 . _:genid13435 . _:genid13436 . _:genid13433 _:genid13434 . _:genid13431 _:genid13433 . _:genid13438 _:genid13437 . _:genid13432 _:genid13438 . _:genid13437 . _:genid13437 . _:genid13437 . _:genid13438 . _:genid13430 _:genid13432 . _:genid13430 . "An analyte assay that detects ATP concentration through light intensity when luciferase catalyzes the oxidation of luciferin in the presence of ATP, magnesium ions, and molecular oxygen."^^ . "ATP bioluminescence assay" . . . "An assay that measures the electrical properties of biological cells or tissues. Typically, this assay will generate measurements of voltage changes or electric current (or other associated variables such as impedence or capacitance)."^^ . "electrophysiology assay" . . . _:genid13439 . _:genid13441 _:genid13440 . _:genid13440 . _:genid13440 . _:genid13442 . _:genid13443 . _:genid13445 _:genid13444 . _:genid13443 _:genid13445 . _:genid13444 . _:genid13444 . _:genid13444 . _:genid13445 . _:genid13442 _:genid13443 . _:genid13440 _:genid13442 . _:genid13447 _:genid13446 . _:genid13441 _:genid13447 . _:genid13446 . _:genid13446 . _:genid13446 . _:genid13447 . _:genid13439 _:genid13441 . _:genid13439 . "An intracellular electrophysiology assay where a glass micropipette is sealed to the surface of the cell membrane as a recording electrode to study ion channel activity. The key distinction of this technique is the electrical resistance of the seal between the cell membrane and the pipette is of the order 10-100 gigaohms, permitting high-resolution current measurements over the cell membrane in several different standard configurations."^^ . "patch clamp assay" . . . "A patch-clamp assay where the electrode is left in place on the cell, as in cell-attached recordings, but the membrane patch has been perforated, providing access from the interior of the pipette to the intracellular space of the cell. Measurements made with this technique involve recording currents through multiple channels simultaneously, over the membrane of the entire cell."^^ . "whole-cell patch clamp assay" . . . "A patch-clamp assay where the electrode is left in place on the cell, and the membrane patch has been left intact been perforated. This maintains the separation of the interior of the pipette to the intracellular space of the cell. Measurements made with this technique involve recording currents through multiple channels simultaneously, over the membrane of the entire cell."^^ . "cell-attached patch clamp assay" . . . "A patch-clamp assay where a patch of the membrane is attached to the patch pipette, detached from the rest of the cell, and the cytosolic surface of the membrane is exposed to the external media, or bath. This provides the experimenter has access to the intracellular surface of the membrane via the bath and can manipulate the environment at the intracellular surface of single ion channels. For example, channels that are activated by intracellular ligands can then be studied through a range of ligand concentrations."^^ . "inside-out patch clamp assay" . . . "A patch-clamp assay where a patch of the membrane is attached to the patch pipette. In this configuration, the external surface of the cell membrane is exposed as the outside of the membrane patch relative to the patch electrode. An outside-out patch starts with a gigaohm seal in a whole-cell recording configuration. The electrode is slowly withdrawn from the cell, until a fragment of membrane bulges away from the cell, which detaches and reforms as a convex membrane on the end of the electrode, with the original external surface of the membrane facing outward from the electrode. This provides the experimenter with access to the extracellular surface of the membrane via the bath and can manipulate the environment at the extracellular surface of single ion channels."^^ . "outside-out patch clamp assay" . . . "An extracellular electrophysiology assay where electrodes are mounted outside the brain (either on the surface of the scalp on onto the brain surface itself during surgery) to measure the electrical field over the external surface."^^ . "electroencephalography" . . . . _:genid13448 . _:genid13450 _:genid13449 . _:genid13449 . _:genid13449 . _:genid13451 . _:genid13452 . _:genid13454 _:genid13453 . _:genid13452 _:genid13454 . _:genid13453 . _:genid13453 . _:genid13453 . _:genid13454 . _:genid13451 _:genid13452 . _:genid13449 _:genid13451 . _:genid13456 _:genid13455 . _:genid13450 _:genid13456 . _:genid13455 . _:genid13455 . _:genid13455 . _:genid13456 . _:genid13448 _:genid13450 . _:genid13448 . _:genid13457 . _:genid13459 _:genid13458 . _:genid13458 . _:genid13458 . _:genid13460 . _:genid13461 . _:genid13463 _:genid13462 . _:genid13461 _:genid13463 . _:genid13462 . _:genid13462 . _:genid13464 . _:genid13465 . _:genid13467 _:genid13466 . _:genid13465 _:genid13467 . _:genid13466 . _:genid13466 . _:genid13466 . _:genid13467 . _:genid13464 _:genid13465 . _:genid13462 _:genid13464 . _:genid13463 . _:genid13460 _:genid13461 . _:genid13458 _:genid13460 . _:genid13469 _:genid13468 . _:genid13459 _:genid13469 . _:genid13468 . _:genid13468 . _:genid13470 . _:genid13472 _:genid13471 . _:genid13471 . _:genid13473 . _:genid13475 _:genid13474 . _:genid13473 _:genid13475 . _:genid13474 . _:genid13474 . _:genid13474 . _:genid13475 . _:genid13471 _:genid13473 . _:genid13477 _:genid13476 . _:genid13472 _:genid13477 . _:genid13476 . _:genid13476 . _:genid13476 . _:genid13477 . _:genid13470 _:genid13472 . _:genid13468 _:genid13470 . _:genid13469 . _:genid13457 _:genid13459 . _:genid13457 . _:genid13478 . _:genid13478 . _:genid13479 . _:genid13479 . _:genid13479 . _:genid13478 _:genid13479 . _:genid13478 . "An extracellular electrophysiology assay where a single microelectrode is placed in close proximity to a single neuron to measure voltage and current changes over time. This is the technicque used by Hubel and Wiesel to measure firing properties of primary visual cortex neurons in the 1950s in their original Nobel-prize winning study. A classic, old technique."^^ . "single-unit recording" . . . _:genid13480 . _:genid13482 _:genid13481 . _:genid13481 . _:genid13481 . _:genid13483 . _:genid13484 . _:genid13486 _:genid13485 . _:genid13484 _:genid13486 . _:genid13485 . _:genid13485 . _:genid13485 . _:genid13486 . _:genid13483 _:genid13484 . _:genid13481 _:genid13483 . _:genid13488 _:genid13487 . _:genid13482 _:genid13488 . _:genid13487 . _:genid13487 . _:genid13487 . _:genid13488 . _:genid13480 _:genid13482 . _:genid13480 . _:genid13489 . _:genid13491 _:genid13490 . _:genid13490 . _:genid13490 . _:genid13492 . _:genid13493 . _:genid13495 _:genid13494 . _:genid13493 _:genid13495 . _:genid13494 . _:genid13494 . _:genid13496 . _:genid13497 . _:genid13499 _:genid13498 . _:genid13497 _:genid13499 . _:genid13498 . _:genid13498 . _:genid13498 . _:genid13499 . _:genid13496 _:genid13497 . _:genid13494 _:genid13496 . _:genid13495 . _:genid13492 _:genid13493 . _:genid13490 _:genid13492 . _:genid13501 _:genid13500 . _:genid13491 _:genid13501 . _:genid13500 . _:genid13500 . _:genid13502 . _:genid13504 _:genid13503 . _:genid13503 . _:genid13505 . _:genid13507 _:genid13506 . _:genid13505 _:genid13507 . _:genid13506 . _:genid13506 . _:genid13506 . _:genid13507 . _:genid13503 _:genid13505 . _:genid13509 _:genid13508 . _:genid13504 _:genid13509 . _:genid13508 . _:genid13508 . _:genid13508 . _:genid13509 . _:genid13502 _:genid13504 . _:genid13500 _:genid13502 . _:genid13501 . _:genid13489 _:genid13491 . _:genid13489 . _:genid13510 . _:genid13510 . _:genid13511 . _:genid13511 . _:genid13511 . _:genid13510 _:genid13511 . _:genid13510 . "An extracellular electrophysiology assay where a microelectrode is placed in the extracellular space of brain tissue to measure action potential and compared to an electrode either outside or inside that tissue."^^ . "local field potential recording" . . . _:genid13512 . _:genid13512 . _:genid13512 . _:genid13512 . "An assay that identifies RNA binding proteins by cross-linking RNA and proteins with UV light, then purifying the bound complexes by oligo(dT) capture. Finally, the complexes are analyzed by mass spectrometry."^^ . "RNA interactome capture" . . . _:genid13513 . _:genid13513 . _:genid13513 . _:genid13513 . _:genid13514 . _:genid13514 . _:genid13514 . _:genid13514 . "An assay that detects the proximity of chromosomal DNA through the use of a ligation reaction in isolated nuclei."^^ . "nuclear ligation assay" . . . _:genid13515 . _:genid13515 . _:genid13515 . _:genid13515 . "A nuclear ligation assay that detects chromosomal interactions between any two genomic loci. Chromatin segments are cross-linked, cut by restriction enzymes, ligated, and finally analyzed by PCR."^^ . "chromosome conformation capture assay" . . . "A chromosome conformation capture assay that detects genome-wide chromosomal interactions. High-throughput techniques are used to sequence the ligated fragments after cross-linking and cutting with restriction enzymes."^^ . "Hi-C assay" . . . _:genid13516 . _:genid13516 . _:genid13516 . _:genid13516 . "A role borne by a material entity and realized in an assay which achieves the objective to measure the magnitude/concentration/amount of the measurand in the entity bearing evaluant role." . "measurand role"@en . . . "An artificially induced nucleic acid hybridization that is performed to compare gene expression in different cell or tissue types based on normalization and suppression, which creates a subtracted cDNA or genomic DNA library."^^ . "suppression subtractive hybridization" . . . "An artificially induced nucleic acid hybridization that is performed to identify differentially expressed genes through hybridization of cDNA probes."^^ . "differential screening hybridization" . . _:genid13517 . _:genid13519 _:genid13518 . _:genid13518 . _:genid13520 . _:genid13522 _:genid13521 . _:genid13520 _:genid13522 . _:genid13521 . _:genid13521 . _:genid13521 . _:genid13524 _:genid13523 . _:genid13522 _:genid13524 . _:genid13523 . _:genid13523 . _:genid13523 . _:genid13524 . _:genid13518 _:genid13520 . _:genid13519 . _:genid13517 _:genid13519 . _:genid13517 . . "A specimen that is derived from brain."^^ . "brain specimen" . . . _:genid13525 . _:genid13525 . _:genid13525 . _:genid13525 . "A study design that investigates the features of interaction between molecules."^^ . "molecular interaction identification design" . . . "An induced mutation in which a specific base change is programmed into the sequence of a synthetic primer." . "site-directed mutagenesis" . . . "An induced mutation that produces a random mutation, either by introducing the organism to mutagens, or through a process such as error-prone PCR." . "random mutagenesis" . . . . _:genid13526 . _:genid13526 . _:genid13527 . _:genid13527 . _:genid13528 . _:genid13529 . _:genid13530 . _:genid13529 _:genid13530 . _:genid13530 . _:genid13528 _:genid13529 . _:genid13527 _:genid13528 . _:genid13526 _:genid13527 . _:genid13526 . _:genid13531 . _:genid13531 . _:genid13532 . _:genid13532 . _:genid13532 . _:genid13531 _:genid13532 . _:genid13531 . "An assay in which a cellular process is replicated from the bottom-up using isolated components in order to observe how the components work together."^^ . "reconstitution assay" . . . _:genid13533 . _:genid13533 . _:genid13534 . _:genid13534 . _:genid13534 . _:genid13533 _:genid13534 . _:genid13533 . "A reconstitution assay in which RNA synthesis is investigated using RNA polymerase II transcription systems replicated in vitro from their base components."^^ . "in vitro transcription reconstitution assay" . . . "A genetic transformation which reduces the expression of a specific gene or genes in an organism." . "gene knockdown" . . _:genid13535 . _:genid13537 _:genid13536 . _:genid13536 . _:genid13536 . _:genid13538 . _:genid13539 . _:genid13541 _:genid13540 . _:genid13539 _:genid13541 . _:genid13540 . _:genid13540 . _:genid13540 . _:genid13541 . _:genid13538 _:genid13539 . _:genid13536 _:genid13538 . _:genid13543 _:genid13542 . _:genid13537 _:genid13543 . _:genid13542 . _:genid13542 . _:genid13542 . _:genid13543 . _:genid13535 _:genid13537 . _:genid13535 . . "A material entity which results from viral transformation process using EBV as transformation agent when applied to B-cell entity"@en . "Epstein Barr virus transformed B cell"@en . . _:genid13544 . _:genid13545 . _:genid13546 . _:genid13545 _:genid13546 . _:genid13547 . _:genid13546 _:genid13547 . _:genid13548 . _:genid13547 _:genid13548 . _:genid13548 . _:genid13544 _:genid13545 . _:genid13544 . . "A material entity that is an individual living system, such as animal, plant, bacteria or virus, that is capable of replicating or reproducing, growth and maintenance in the right environment. An organism may be unicellular or made up, like humans, of many billions of cells divided into specialized tissues and organs."@en . "organism"@en . . _:genid13549 . _:genid13550 . _:genid13552 _:genid13551 . _:genid13550 _:genid13552 . _:genid13551 . _:genid13551 . _:genid13551 . _:genid13552 . _:genid13549 _:genid13550 . _:genid13549 . . "A material entity that has the specimen role."@en . "specimen"@en . . . _:genid13553 . _:genid13553 . _:genid13553 . _:genid13553 . _:genid13554 . _:genid13554 . _:genid13554 . _:genid13554 . _:genid13555 . _:genid13555 . _:genid13555 . _:genid13555 . "A processed material comprised of a collection of cultured cells that has been continuously maintained together in culture and shares a common propagation history."^^ . "cultured cell population"^^ . . . _:genid13556 . _:genid13556 . _:genid13557 . _:genid13558 . _:genid13559 . _:genid13558 _:genid13559 . _:genid13559 . _:genid13557 _:genid13558 . _:genid13556 _:genid13557 . _:genid13556 . _:genid13560 . _:genid13560 . _:genid13560 . _:genid13560 . "A processed material which derives from an organ and results from a process of dissection or histological sample preparation a portion(formerly an organ section is portion of an organ removed from the context of the organ)"@en . "organ section"@en . . _:genid13561 . _:genid13561 . _:genid13561 . _:genid13561 . . _:genid13562 . _:genid13562 . _:genid13563 . _:genid13563 . _:genid13564 . _:genid13565 . _:genid13567 _:genid13566 . _:genid13565 _:genid13567 . _:genid13566 . _:genid13566 . _:genid13566 . _:genid13567 . _:genid13564 _:genid13565 . _:genid13563 _:genid13564 . _:genid13562 _:genid13563 . _:genid13562 . _:genid13568 . _:genid13568 . _:genid13568 . _:genid13568 . "A planned process that produces output data from input data."@en . "data transformation"@en . . . "A differential expression analysis objective is a data transformation objective whose input consists of expression levels of entities (such as transcripts or proteins), or of sets of such expression levels, under two or more conditions and whose output reflects which of these are likely to have different expression across such conditions."@en . "differential expression analysis objective"@en . . _:genid13569 . _:genid13569 . _:genid13569 . _:genid13569 . . "A data transformation which has the objective of spectrum analysis."^^ . "mass spectrometry analysis"@en . . . "An objective specification to transformation input data into output data"@en . "data transformation objective"@en . . . "is a data transformation objective where the aim is to analyse some aspect of spectral data by some data transformation process. "^^ . "spectrum analysis objective"^^ . . _:genid13570 . _:genid13571 . _:genid13573 _:genid13572 . _:genid13571 _:genid13573 . _:genid13572 . _:genid13572 . _:genid13574 . _:genid13575 . _:genid13577 _:genid13576 . _:genid13575 _:genid13577 . _:genid13576 . _:genid13576 . _:genid13576 . _:genid13577 . _:genid13574 _:genid13575 . _:genid13572 _:genid13574 . _:genid13573 . _:genid13570 _:genid13571 . _:genid13570 . . "A pool of specimens is a mixture of a population of samples which have been gathered from one or more sample populations, obtained by the physical process of mixing individual specimens, e.g. mixing the DNA collected from the individual fish."@en . "pool of specimens"@en . . _:genid13578 . _:genid13580 _:genid13579 . _:genid13579 . _:genid13579 . _:genid13581 . _:genid13582 . _:genid13584 _:genid13583 . _:genid13582 _:genid13584 . _:genid13583 . _:genid13583 . _:genid13583 . _:genid13584 . _:genid13581 _:genid13582 . _:genid13579 _:genid13581 . _:genid13586 _:genid13585 . _:genid13580 _:genid13586 . _:genid13585 . _:genid13585 . _:genid13587 . _:genid13588 . _:genid13590 _:genid13589 . _:genid13588 _:genid13590 . _:genid13589 . _:genid13589 . _:genid13589 . _:genid13590 . _:genid13587 _:genid13588 . _:genid13585 _:genid13587 . _:genid13586 . _:genid13578 _:genid13580 . _:genid13578 . . "A material entity that is made up of at least 2 scattered molecular aggregates, one playing the role of solvent and the other one playing the role of solute."@en . "chemical solution"@en . . . _:genid13591 . _:genid13591 . _:genid13591 . _:genid13591 . _:genid13592 . _:genid13592 . _:genid13592 . _:genid13592 . "solvent role is a role which inheres in a molecular entity capable of ensuring the dissolution of another chemical entity and realized by the process of solvation"@en . "solvent role"@en . . . _:genid13593 . _:genid13593 . _:genid13593 . _:genid13593 . _:genid13594 . _:genid13594 . _:genid13594 . _:genid13594 . "solute role is a role played by a chemical entity which is dissolved by another chemical entity (the solvent) when creating a solution"@en . "solute role"@en . . . _:genid13595 . _:genid13597 _:genid13596 . _:genid13596 . _:genid13596 . _:genid13598 . _:genid13599 . _:genid13601 _:genid13600 . _:genid13599 _:genid13601 . _:genid13600 . _:genid13600 . _:genid13600 . _:genid13601 . _:genid13598 _:genid13599 . _:genid13596 _:genid13598 . _:genid13603 _:genid13602 . _:genid13597 _:genid13603 . _:genid13602 . _:genid13602 . _:genid13604 . _:genid13605 . _:genid13607 _:genid13606 . _:genid13605 _:genid13607 . _:genid13606 . _:genid13606 . _:genid13606 . _:genid13607 . _:genid13604 _:genid13605 . _:genid13602 _:genid13604 . _:genid13603 . _:genid13595 _:genid13597 . _:genid13595 . _:genid13608 . _:genid13610 _:genid13609 . _:genid13609 . _:genid13609 . _:genid13611 . _:genid13612 . _:genid13614 _:genid13613 . _:genid13612 _:genid13614 . _:genid13613 . _:genid13613 . _:genid13615 . _:genid13616 . _:genid13618 _:genid13617 . _:genid13616 _:genid13618 . _:genid13617 . _:genid13617 . _:genid13617 . _:genid13620 _:genid13619 . _:genid13618 _:genid13620 . _:genid13619 . _:genid13619 . _:genid13619 . _:genid13620 . _:genid13615 _:genid13616 . _:genid13613 _:genid13615 . _:genid13614 . _:genid13611 _:genid13612 . _:genid13609 _:genid13611 . _:genid13622 _:genid13621 . _:genid13610 _:genid13622 . _:genid13621 . _:genid13621 . _:genid13623 . _:genid13624 . _:genid13626 _:genid13625 . _:genid13624 _:genid13626 . _:genid13625 . _:genid13625 . _:genid13625 . _:genid13628 _:genid13627 . _:genid13626 _:genid13628 . _:genid13627 . _:genid13627 . _:genid13627 . _:genid13628 . _:genid13623 _:genid13624 . _:genid13621 _:genid13623 . _:genid13622 . _:genid13608 _:genid13610 . _:genid13608 . _:genid13629 . _:genid13629 . _:genid13629 . _:genid13629 . _:genid13630 . _:genid13630 . _:genid13630 . _:genid13630 . _:genid13631 . _:genid13631 . _:genid13632 . _:genid13632 . _:genid13632 . _:genid13631 _:genid13632 . _:genid13631 . "An assay that measures DNA damage (DNA breakage) in eucaryotic cells exposed to a challenge by determining the size and shape of DNA migration by detecting fluorescently labeled DNA from a cell placed in an electric field using gel electrophoresis"^^ . "comet assay" . . _:genid13633 . _:genid13634 . _:genid13636 _:genid13635 . _:genid13634 _:genid13636 . _:genid13635 . _:genid13635 . _:genid13635 . _:genid13636 . _:genid13633 _:genid13634 . _:genid13633 . . . "an organism that is the output of a genetic transformation process"@en . "genetically modified organism"@en . . _:genid13637 . _:genid13638 . _:genid13639 . _:genid13638 _:genid13639 . _:genid13641 _:genid13640 . _:genid13639 _:genid13641 . _:genid13640 . _:genid13640 . _:genid13642 . _:genid13642 . _:genid13642 . _:genid13640 _:genid13642 . _:genid13641 . _:genid13637 _:genid13638 . _:genid13637 . . "A material entity that has been going through a process of being put into solution"^^ . "dissolved material entity"@en . . . _:genid13643 . _:genid13643 . _:genid13643 . _:genid13643 . "A material separation in which a desired component of an input material is separated from the remainder"^^ . "extraction"@en . . . _:genid13644 . _:genid13644 . _:genid13644 . _:genid13644 . "Staining is a process which results in the addition a class-specific (DNA, proteins, lipids, carbohydrates) dye to a substrate to qualify or quantify the presence of a specific compound."@en . "staining"@en . . . _:genid13645 . _:genid13645 . _:genid13645 . _:genid13645 . _:genid13646 . _:genid13646 . _:genid13646 . _:genid13646 . _:genid13647 . _:genid13647 . _:genid13647 . _:genid13647 . "polymerization is process by which molecular entity of small mass are aggregated in motifs over the course of a chemical reaction catalyzed by enzymes or other molecular entities acting as catalyst. polymerization results in molecular entity of high molecular weight"@en . "polymerization"@en . . . _:genid13648 . _:genid13648 . _:genid13649 . _:genid13650 . _:genid13652 _:genid13651 . _:genid13650 _:genid13652 . _:genid13651 . _:genid13651 . _:genid13651 . _:genid13652 . _:genid13649 _:genid13650 . _:genid13648 _:genid13649 . _:genid13648 . _:genid13653 . _:genid13653 . _:genid13653 . _:genid13653 . "An enzymatic ligation is a planned process in which molecules are joined by covalent bonds through the action of an material entity with a ligase activity"@en . "enzymatic ligation"@en . . . _:genid13654 . _:genid13654 . _:genid13655 . _:genid13656 . _:genid13658 _:genid13657 . _:genid13656 _:genid13658 . _:genid13657 . _:genid13657 . _:genid13657 . _:genid13658 . _:genid13655 _:genid13656 . _:genid13654 _:genid13655 . _:genid13654 . "a planned process by which totally or partially complementary, single-stranded nucleic acids are combined into a single molecule called heteroduplex or homoduplex to an extent depending on the amount of complementarity."@en . "nucleic acid hybridization"@en . . . _:genid13659 . _:genid13659 . _:genid13660 . _:genid13661 . _:genid13663 _:genid13662 . _:genid13661 _:genid13663 . _:genid13662 . _:genid13662 . _:genid13662 . _:genid13663 . _:genid13660 _:genid13661 . _:genid13659 _:genid13660 . _:genid13659 . _:genid13664 . _:genid13664 . _:genid13664 . _:genid13664 . _:genid13665 . _:genid13665 . _:genid13665 . _:genid13665 . _:genid13666 . _:genid13666 . _:genid13666 . _:genid13666 . "the process of extracting one material from another by washing with a solvent to remove adsorbed material from an adsorbent (as in washing of loaded ion-exchange resins to remove captured ions)"@en . "elution"@en . . . _:genid13667 . _:genid13667 . _:genid13667 . _:genid13667 . "Aparatus in the fluidic subsystem where the sheath and sample meet. Can be one of several types; jet-in-air, quartz cuvette, or a hybrid of the two. The sample flows through the center of a fluid column of sheath fluid in the flow cell."@en . "flow cell"@en . . . _:genid13668 . _:genid13670 _:genid13669 . _:genid13669 . _:genid13669 . _:genid13669 . _:genid13672 _:genid13671 . _:genid13670 _:genid13672 . _:genid13671 . _:genid13671 . _:genid13671 . _:genid13674 _:genid13673 . _:genid13672 _:genid13674 . _:genid13673 . _:genid13673 . _:genid13673 . _:genid13676 _:genid13675 . _:genid13674 _:genid13676 . _:genid13675 . _:genid13675 . _:genid13675 . _:genid13676 . _:genid13668 _:genid13670 . _:genid13668 . _:genid13677 . _:genid13677 . _:genid13677 . _:genid13677 . _:genid13678 . _:genid13678 . _:genid13678 . _:genid13678 . "A flow_cytometer is an instrument for counting, examining and sorting microscopic particles in suspension. It allows simultaneous multiparametric analysis of the physical and/or chemical characteristics of single cells flowing through an optical and/or electronic detection apparatus. A flow cytometer is an instrument that can be used to quantitatively measure the properties of individual cells in a flowing medium."@en . "flow cytometer"@en . . . _:genid13679 . _:genid13679 . _:genid13679 . _:genid13679 . "A light source is an optical subsystem that provides light for use in a distant area using a delivery system (e.g., fiber optics). Light sources may include one of a variety of lamps (e.g., xenon, halogen, mercury). Most light sources are operated from line power, but some may be powered from batteries. They are mostly used in endoscopic, microscopic, and other examination and/or in surgical procedures. The light source is part of the optical subsystem. In a flow cytometer the light source directs high intensity light at particles at the interrogation point. The light source in a flow cytometer is usually a laser."@en . "light source"@en . . . _:genid13680 . _:genid13680 . _:genid13680 . _:genid13680 . "An obscuration bar is a an optical subsystem which is a strip of metal or other material that serves to block out direct light from the illuminating beam. The obscuration bar prevents the bright light scattered in the forward directions from burning out the collection device."@en . "obscuration bar"@en . . . _:genid13681 . _:genid13681 . _:genid13681 . _:genid13681 . "An optical filter is an optical subsystem that selectively transmits light having certain properties (often, a particular range of wavelengths, that is, range of colours of light), while blocking the remainder. They are commonly used in photography, in many optical instruments, and to colour stage lighting Optical filters can be arranged to segregate and collect light by wave length."@en . "optical filter"@en . . . _:genid13682 . _:genid13682 . _:genid13682 . _:genid13682 . "A photodetector is a device used to detect and measure the intensity of radiant energy through photoelectric action. In a cytometer, photodetectors measure either the number of photons of laser light scattered on impact with a cell (for example), or the flourescence emitted by excitation of a fluorescent dye."@en . "photodetector"@en . . . _:genid13683 . _:genid13683 . _:genid13683 . _:genid13683 . "A DNA sequencer is an instrument that determines the order of deoxynucleotides in deoxyribonucleic acid sequences."@en . "DNA sequencer"@en . . . _:genid13684 . _:genid13684 . _:genid13684 . _:genid13684 . _:genid13685 . _:genid13685 . _:genid13685 . _:genid13685 . "A device which is used to maintain constant contact of a liquid on an array. This can be either a glass vial or slide."@en . "hybridization chamber"@en . . _:genid13686 . _:genid13687 . _:genid13689 _:genid13688 . _:genid13687 _:genid13689 . _:genid13688 . _:genid13688 . _:genid13688 . _:genid13691 _:genid13690 . _:genid13689 _:genid13691 . _:genid13690 . _:genid13690 . _:genid13690 . _:genid13691 . _:genid13686 _:genid13687 . _:genid13686 . . "A device which is used to maintain the temperature of one or more hybridization_chamber(s) at a defined, constant temperature."@en . "hybridization station"@en . . . _:genid13692 . _:genid13692 . _:genid13692 . _:genid13692 . "A device that converts a variable electrical current to mechanical vibration of a metallic probe. The device is used for the lysis of cells, the mixing of compounds or solutions, to framgent molecules of DNA, or to create emulsions."@en . "sonicator"@en . . . _:genid13693 . _:genid13693 . _:genid13693 . _:genid13693 . "A spectrophotometer is an instrument that measures the intensity of light as a function of the color, or more specifically, the wavelength of light, transmitted by a substance."@en . "spectrophotometer"@en . . . _:genid13694 . _:genid13694 . _:genid13694 . _:genid13694 . _:genid13695 . _:genid13695 . _:genid13695 . _:genid13695 . "An instrument that is capable of repeatedly altering and maintaining specific temperatures for defined periods of time."@en . "thermal cycler"@en . . . _:genid13696 . _:genid13698 _:genid13697 . _:genid13697 . _:genid13697 . _:genid13697 . _:genid13700 _:genid13699 . _:genid13698 _:genid13700 . _:genid13699 . _:genid13699 . _:genid13699 . _:genid13702 _:genid13701 . _:genid13700 _:genid13702 . _:genid13701 . _:genid13701 . _:genid13701 . _:genid13702 . _:genid13696 _:genid13698 . _:genid13696 . _:genid13703 . _:genid13703 . _:genid13703 . _:genid13703 . "A cytometer is an instrument for counting and measuring cells."@en . "cytometer"@en . . . _:genid13704 . _:genid13704 . _:genid13704 . _:genid13704 . _:genid13705 . _:genid13705 . _:genid13705 . _:genid13705 . "a device which holds a gel and running buffers to allow electrophoresis to be performed. A gel tank has the function to contain and to control the contained environment and transfer energy from an energy supply through the running buffers to the gel matrix and the material with charged molecules in an electric field across a porous matrix or medium with the objective to separate the charged molecules."@en . "gel tank"@en . . . _:genid13706 . _:genid13706 . _:genid13706 . _:genid13706 . "A power supply is an device or part of a device that permits the required application of a defined electrical charge to an instrument. The power supply may permit the defined application of a given amount of current for a defined length of time."@en . "power supply"@en . . . "A processed material that is made to be used in an analyte assay. It consists of a physical immobilisation matrix in which substances that bind the analyte are placed in regular spatial position."@en . "microarray"@en . . . "A DNA-microarray is a microarray that is used as a physical 2D immobilisation matrix for DNA sequences. DNA microarray-bound DNA fragments are used as targets for a hybridising probed sample."@en . "DNA microarray"@en . . . "A protein-microarray is a microarray, ususlly a piece of glass, on which different molecules of protein have been affixed at separate locations in an ordered manner. These are used to identify protein-protein or protein-small molecule interactions."@en . "protein microarray"@en . . . _:genid13707 . _:genid13707 . _:genid13707 . _:genid13707 . "A droplet sorter is part_of a flow cytometer sorter that converts the carrier fluid stream into individual droplets, and these droplets are directed into separate locations for recovery (enriching the original\nsample for particles of interest based on qualities determined by gating) or disposal."@en . "droplet sorter"@en . . . _:genid13708 . _:genid13708 . _:genid13708 . _:genid13708 . _:genid13709 . _:genid13709 . _:genid13709 . _:genid13709 . "A microtome is a mechanical instrument used to cut biological specimens into very thin segments for further treatment (e.g. ISH) and ultimately microscopic or histologic examination. Most microtomes provide cooling facilities (cryo-microtome) and use a steel blade to cut a slice of defined thickness. Some are automatic, and some are driven by hand."@en . "microtome"@en . . . _:genid13710 . _:genid13710 . _:genid13710 . _:genid13710 . _:genid13711 . _:genid13711 . _:genid13711 . _:genid13711 . "A microscope is an instrument which magnifies the view on objects (too small to be viewed by the naked eye) under increased resolution. A microscope can be an optical instrument but also and electronic instrument. There are various kind of optical microscopes, e.g confocal microscope, epifluoresence microscope)"@en . "microscope"@en . . . _:genid13712 . _:genid13712 . _:genid13712 . _:genid13712 . "A plan specification comprised of protocols (which may specify how and what kinds of data will be gathered) that are executed as part of an investigation and is realized during a study design execution."^^ . "study design"@en . . . "Plan for the precise procedure to be followed in a clinical trial, including planned and actual timing of events, choice of control group, method of allocating treatments, blinding methods; assigns a subject to pass through one or more epochs in the course of a trial. Specific design elements, e.g., crossover, parallel; dose-escalation [Modified from Pocock, Clinical Trials: A Practical Approach]"@en . "clinical study design"@en . . . "A reference experiment design type is where all samples are compared to a common reference."@en . "reference design"@en . . _:genid13713 . _:genid13715 _:genid13714 . _:genid13714 . _:genid13714 . _:genid13714 . _:genid13717 _:genid13716 . _:genid13715 _:genid13717 . _:genid13716 . _:genid13716 . _:genid13718 . _:genid13719 . _:genid13721 _:genid13720 . _:genid13719 _:genid13721 . _:genid13720 . _:genid13720 . _:genid13720 . _:genid13721 . _:genid13718 _:genid13719 . _:genid13716 _:genid13718 . _:genid13717 . _:genid13713 _:genid13715 . _:genid13713 . . _:genid13722 . _:genid13722 . _:genid13722 . _:genid13722 . _:genid13723 . _:genid13723 . _:genid13723 . _:genid13723 . _:genid13724 . _:genid13724 . _:genid13724 . _:genid13724 . "is process in which a material substance is added to a cell culture"@en . "adding substance to cell culture"@en . . . _:genid13725 . _:genid13725 . _:genid13725 . _:genid13725 . _:genid13726 . _:genid13726 . _:genid13726 . _:genid13726 . "a process with the objective to obtain a material entity that was part of an organism for potential future use in an investigation"@en . "collecting specimen from organism"@en . . _:genid13727 . _:genid13729 _:genid13728 . _:genid13728 . _:genid13728 . _:genid13728 . _:genid13731 _:genid13730 . _:genid13729 _:genid13731 . _:genid13730 . _:genid13730 . _:genid13732 . _:genid13733 . _:genid13735 _:genid13734 . _:genid13733 _:genid13735 . _:genid13734 . _:genid13734 . _:genid13736 . _:genid13737 . _:genid13738 . _:genid13737 _:genid13738 . _:genid13738 . _:genid13736 _:genid13737 . _:genid13734 _:genid13736 . _:genid13735 . _:genid13732 _:genid13733 . _:genid13730 _:genid13732 . _:genid13731 . _:genid13727 _:genid13729 . _:genid13727 . . _:genid13739 . _:genid13739 . _:genid13739 . _:genid13739 . _:genid13740 . _:genid13740 . _:genid13740 . _:genid13740 . _:genid13741 . _:genid13741 . _:genid13741 . _:genid13741 . _:genid13742 . _:genid13742 . _:genid13742 "1"^^ . _:genid13742 . "A process by which a substance is intentionally given to an organism resulting in exposure of the organism to that substance."^^ . "administering substance in vivo"@en . . _:genid13743 . _:genid13743 . _:genid13743 . _:genid13743 . . _:genid13744 . _:genid13744 . _:genid13744 . _:genid13744 . "a material processing in which components of an input material become segregated in space"@en . "material component separation"@en . . . _:genid13745 . _:genid13745 . _:genid13745 . _:genid13745 . _:genid13746 . _:genid13746 . _:genid13746 . _:genid13746 . _:genid13747 . _:genid13747 . _:genid13748 . _:genid13748 . _:genid13748 . _:genid13747 _:genid13748 . _:genid13747 . "An assay that detects the presence or a quality of a molecular label which is a proxy for the detection of the molecular target to which the label is attached"^^ . "assay detecting a molecular label" . . . _:genid13749 . _:genid13749 . _:genid13749 . _:genid13749 . _:genid13750 . _:genid13750 . _:genid13750 . _:genid13750 . _:genid13751 . _:genid13751 . _:genid13752 . _:genid13752 . _:genid13753 . _:genid13754 . _:genid13755 . _:genid13754 _:genid13755 . _:genid13755 . _:genid13753 _:genid13754 . _:genid13752 _:genid13753 . _:genid13751 _:genid13752 . _:genid13751 . "An assay that uses visual examination of cells or tissue (or images of them) to make an assessment regarding a quality of the cells or tissue. This assay can include steps of staining, imaging, and judgement."^^ . "histological assay" . . . _:genid13756 . _:genid13756 . _:genid13756 . _:genid13756 . _:genid13757 . _:genid13757 . _:genid13758 . _:genid13759 . _:genid13760 . _:genid13759 _:genid13760 . _:genid13760 . _:genid13758 _:genid13759 . _:genid13757 _:genid13758 . _:genid13757 . _:genid13761 . _:genid13761 . _:genid13761 . _:genid13761 . _:genid13762 . _:genid13762 . _:genid13762 . _:genid13762 . "a protocol application in which cells are kept alive in a defined environment outside of an organism. part of cell_culturing"@en . "maintaining cell culture"@en . . . _:genid13763 . _:genid13765 _:genid13764 . _:genid13764 . _:genid13764 . _:genid13766 . _:genid13767 . _:genid13769 _:genid13768 . _:genid13767 _:genid13769 . _:genid13768 . _:genid13768 . _:genid13768 . _:genid13769 . _:genid13766 _:genid13767 . _:genid13764 _:genid13766 . _:genid13771 _:genid13770 . _:genid13765 _:genid13771 . _:genid13770 . _:genid13770 . _:genid13772 . _:genid13773 . _:genid13775 _:genid13774 . _:genid13773 _:genid13775 . _:genid13774 . _:genid13774 . _:genid13774 . _:genid13775 . _:genid13772 _:genid13773 . _:genid13770 _:genid13772 . _:genid13771 . _:genid13763 _:genid13765 . _:genid13763 . _:genid13776 . _:genid13776 . _:genid13776 . _:genid13776 . "An assay that detects a specified substance"^^ . "substance detection assay" . . . _:genid13777 . _:genid13777 . _:genid13777 . _:genid13777 . _:genid13778 . _:genid13778 . _:genid13778 . _:genid13778 . _:genid13779 . _:genid13779 . _:genid13779 . _:genid13779 . _:genid13780 . _:genid13780 . _:genid13780 . _:genid13780 . "a protocol with the objective to transcribe single-stranded RNA into complementary DNA (cDNA)"@en . "artificially induced reverse transcription"@en . . . _:genid13781 . _:genid13781 . _:genid13781 . _:genid13781 . _:genid13782 . _:genid13782 . _:genid13782 . _:genid13782 . _:genid13783 . _:genid13783 . _:genid13783 . _:genid13783 . "A protocol application to permeabilize cell membranes, allowing molecules to more easily pass through the membrane than was possible prior to the protocol application"@en . "cell permeabilization"@en . . . _:genid13784 . _:genid13784 . _:genid13784 . _:genid13784 . _:genid13785 . _:genid13785 . _:genid13785 . _:genid13785 . _:genid13786 . _:genid13786 . _:genid13786 . _:genid13786 . _:genid13787 . _:genid13787 . _:genid13787 . _:genid13787 . "a process through which a new type of cell culture or cell line is created, either through the isolation and culture of one or more cells from a fresh source, or the deliberate experimental modification of an existing cell culture (e.g passaging a primary culture to become a secondary culture or line, or the immortalization or stable genetic modification of an existing culture or line)." . "establishing cell culture" . . . _:genid13788 . _:genid13788 . _:genid13788 . _:genid13788 . _:genid13789 . _:genid13789 . _:genid13789 . _:genid13789 . _:genid13790 . _:genid13790 . _:genid13790 . _:genid13790 . _:genid13791 . _:genid13791 . _:genid13791 . _:genid13791 . "a material processing technique intended to add a molecular label to some input material entity, to allow detection of the molecular target of this label in a detection of molecular label assay"@en . "addition of molecular label"@en . . . _:genid13792 . _:genid13792 . _:genid13792 . _:genid13792 . _:genid13793 . _:genid13793 . _:genid13793 . _:genid13793 . "the introduction. alteration or integration of genetic material into a cell or organism"@en . "genetic transformation"@en . . _:genid13794 . _:genid13795 . _:genid13797 _:genid13796 . _:genid13795 _:genid13797 . _:genid13796 . _:genid13796 . _:genid13796 . _:genid13797 . _:genid13794 _:genid13795 . _:genid13794 . . "An assay that determines the 3-dimensional configuration of an input material."^^ . "3D structure determination assay" . . . _:genid13798 . _:genid13798 . _:genid13798 . _:genid13798 . _:genid13799 . _:genid13799 . _:genid13799 . _:genid13799 . _:genid13800 . _:genid13800 . _:genid13800 . _:genid13800 . _:genid13801 . _:genid13801 . _:genid13801 . _:genid13801 . "the use of a biomaterial's preferential affinity for either the mobile phase or the stationary phase to separate it from other materials of differing affinity"@en . "preparative chromatography"@en . . _:genid13802 . _:genid13803 . _:genid13805 _:genid13804 . _:genid13803 _:genid13805 . _:genid13804 . _:genid13807 _:genid13806 . _:genid13806 . _:genid13806 . _:genid13808 . _:genid13809 . _:genid13811 _:genid13810 . _:genid13809 _:genid13811 . _:genid13810 . _:genid13810 . _:genid13812 . _:genid13813 . _:genid13814 . _:genid13813 _:genid13814 . _:genid13815 . _:genid13814 _:genid13815 . _:genid13815 . _:genid13812 _:genid13813 . _:genid13810 _:genid13812 . _:genid13811 . _:genid13808 _:genid13809 . _:genid13806 _:genid13808 . _:genid13817 _:genid13816 . _:genid13807 _:genid13817 . _:genid13816 . _:genid13816 . _:genid13818 . _:genid13819 . _:genid13820 . _:genid13819 _:genid13820 . _:genid13821 . _:genid13820 _:genid13821 . _:genid13821 . _:genid13818 _:genid13819 . _:genid13816 _:genid13818 . _:genid13817 . _:genid13804 _:genid13807 . _:genid13823 _:genid13822 . _:genid13805 _:genid13823 . _:genid13822 . _:genid13825 _:genid13824 . _:genid13824 . _:genid13824 . _:genid13826 . _:genid13827 . _:genid13829 _:genid13828 . _:genid13827 _:genid13829 . _:genid13828 . _:genid13828 . _:genid13830 . _:genid13831 . _:genid13833 _:genid13832 . _:genid13831 _:genid13833 . _:genid13832 . _:genid13832 . _:genid13832 . _:genid13833 . _:genid13830 _:genid13831 . _:genid13828 _:genid13830 . _:genid13829 . _:genid13826 _:genid13827 . _:genid13824 _:genid13826 . _:genid13835 _:genid13834 . _:genid13825 _:genid13835 . _:genid13834 . _:genid13834 . _:genid13836 . _:genid13838 _:genid13837 . _:genid13837 . _:genid13839 . _:genid13841 _:genid13840 . _:genid13839 _:genid13841 . _:genid13840 . _:genid13840 . _:genid13840 . _:genid13841 . _:genid13837 _:genid13839 . _:genid13843 _:genid13842 . _:genid13838 _:genid13843 . _:genid13842 . _:genid13842 . _:genid13842 . _:genid13843 . _:genid13836 _:genid13838 . _:genid13834 _:genid13836 . _:genid13835 . _:genid13822 _:genid13825 . _:genid13845 _:genid13844 . _:genid13823 _:genid13845 . _:genid13844 . _:genid13844 . _:genid13844 . _:genid13847 _:genid13846 . _:genid13845 _:genid13847 . _:genid13846 . _:genid13846 . _:genid13848 . _:genid13848 . _:genid13848 . _:genid13846 _:genid13848 . _:genid13847 . _:genid13802 _:genid13803 . _:genid13802 . . "An assay the uses chemical or biochemical means to infer the sequence of a biomaterial"^^ . "sequencing assay" . . . "a protocol application to digest the fraction of input material that is susceptible to that enzyme"@en . "specific enzymatic cleavage"@en . . . _:genid13849 . _:genid13849 . _:genid13849 . _:genid13849 . "a protocol application that uses different concentrations of materials in a defined order to create a gradient to facilitate the separation of an input material into its components with specific qualities"@en . "gradient separation"@en . . . _:genid13850 . _:genid13850 . _:genid13851 . _:genid13852 . _:genid13853 . _:genid13852 _:genid13853 . _:genid13853 . _:genid13851 _:genid13852 . _:genid13850 _:genid13851 . _:genid13850 . _:genid13854 . _:genid13854 . _:genid13854 . _:genid13854 . _:genid13855 . _:genid13855 . _:genid13855 . _:genid13855 . _:genid13856 . _:genid13856 . _:genid13856 . _:genid13856 . "a protocol application that uses an electrical potential to move material through a defined matrix in order to separate it by its resistance to movement and its charge"@en . "electrophoresis"@en . . . _:genid13857 . _:genid13857 . _:genid13857 . _:genid13857 . "the use of environmental conditions to select for the organism or cells that have a certain trait"@en . "selection by survival"@en . . . _:genid13858 . _:genid13858 . _:genid13858 . _:genid13858 . "the use of enzymes to cut DNA molecules, the study of DNA through cleavage, mapping, and analysis of the fragments"@en . "DNA cleavage, restriction analysis"@en . . . _:genid13859 . _:genid13859 . _:genid13860 . _:genid13861 . _:genid13863 _:genid13862 . _:genid13861 _:genid13863 . _:genid13862 . _:genid13862 . _:genid13862 . _:genid13863 . _:genid13860 _:genid13861 . _:genid13859 _:genid13860 . _:genid13859 . _:genid13864 . _:genid13864 . _:genid13865 . _:genid13866 . _:genid13868 _:genid13867 . _:genid13866 _:genid13868 . _:genid13867 . _:genid13867 . _:genid13867 . _:genid13868 . _:genid13865 _:genid13866 . _:genid13864 _:genid13865 . _:genid13864 . _:genid13869 . _:genid13869 . _:genid13869 . _:genid13869 . "the use of enzymes to increase the number of molecules of a biomaterial"@en . "enzymatic amplification"@en . . . _:genid13870 . _:genid13870 . _:genid13870 . _:genid13870 . _:genid13871 . _:genid13871 . _:genid13871 . _:genid13871 . _:genid13872 . _:genid13872 . _:genid13873 . _:genid13874 . _:genid13876 _:genid13875 . _:genid13874 _:genid13876 . _:genid13875 . _:genid13875 . _:genid13875 . _:genid13876 . _:genid13873 _:genid13874 . _:genid13872 _:genid13873 . _:genid13872 . _:genid13877 . _:genid13877 . _:genid13877 . _:genid13877 . _:genid13878 . _:genid13878 . _:genid13878 . _:genid13878 . "a planned process with the objective to insert genetic material into a cloning vector for future replication of the inserted material"@en . "recombinant vector cloning"@en . . . _:genid13879 . _:genid13879 . _:genid13879 . _:genid13879 . "A RNA extraction is a nucleic acid extraction where the desired output material is RNA"@en . "RNA extraction"@en . . . _:genid13880 . _:genid13880 . _:genid13881 . _:genid13882 . _:genid13883 . _:genid13882 _:genid13883 . _:genid13884 . _:genid13883 _:genid13884 . _:genid13884 . _:genid13881 _:genid13882 . _:genid13880 _:genid13881 . _:genid13880 . _:genid13885 . _:genid13885 . _:genid13885 . _:genid13885 . "a material separation to recover the nucleic acid fraction of an input material"@en . "nucleic acid extraction"@en . . . _:genid13886 . _:genid13886 . _:genid13886 . _:genid13886 . _:genid13887 . _:genid13887 . _:genid13887 . _:genid13887 . "a phage display library is a collection of materials in which a mixture of genes or gene fragments is expressed and can be individually selected and amplified."@en . "phage display library"@en . . . _:genid13888 . _:genid13888 . _:genid13888 . _:genid13888 . "a transgenic organism is material entity which derives from an organism which has been modified to express a gene not normally part of it"@en . "transgenic organism"@en . . _:genid13889 . _:genid13889 . _:genid13889 . _:genid13889 . . "a material entity bearing the epitope role"@en . "epitope"@en . . _:genid13890 . _:genid13890 . _:genid13891 . _:genid13892 . _:genid13894 _:genid13893 . _:genid13892 _:genid13894 . _:genid13893 . _:genid13893 . _:genid13895 . _:genid13896 . _:genid13898 _:genid13897 . _:genid13896 _:genid13898 . _:genid13897 . _:genid13897 . _:genid13897 . _:genid13898 . _:genid13895 _:genid13896 . _:genid13893 _:genid13895 . _:genid13894 . _:genid13891 _:genid13892 . _:genid13890 _:genid13891 . _:genid13890 . . "is the process in which an adaptive immune receptor binds to a material entity (realizing its disposition). The binding affinity is significant enough to trigger an immune response. Specifically, transient non-specific binding of adaptive immune receptors occurring during immune surveillance is not considered significant binding."@en . "epitope binding by adaptive immune receptor"@en . . . _:genid13899 . _:genid13899 . _:genid13899 . _:genid13899 . _:genid13900 . _:genid13900 . _:genid13900 . _:genid13900 . "the detrimental process in which an infectious agent colonizes or replicates in a host environment"@en . "infection process"@en . . _:genid13901 . _:genid13902 . _:genid13903 . _:genid13902 _:genid13903 . _:genid13904 . _:genid13903 _:genid13904 . _:genid13904 . _:genid13901 _:genid13902 . _:genid13901 . . "is a receptor produced by cells of the adaptive immune system with the purpose of binding epitopes."@en . "adaptive immune receptor"@en . . . _:genid13905 . _:genid13905 . _:genid13906 . _:genid13907 . _:genid13909 _:genid13908 . _:genid13907 _:genid13909 . _:genid13908 . _:genid13908 . _:genid13908 . _:genid13909 . _:genid13906 _:genid13907 . _:genid13905 _:genid13906 . _:genid13905 . "is the administration of an infectious agent to a cell culture with the objective to have the agent colonize and replicate in culture"@en . "experimental infection of cell culture"@en . . _:genid13910 . _:genid13910 . _:genid13910 . _:genid13910 . . "is a material entity that has the antigen role"@en . "antigen"@en . . . _:genid13911 . _:genid13911 . _:genid13911 . _:genid13911 . "Is the disposition borne by a material entity that is realized in a process of being bound by a adaptive immune receptor."@en . "disposition to be bound by an adaptive immune receptor"@en . . . _:genid13912 . _:genid13912 . _:genid13912 . _:genid13912 . "Is a role borne by an agent, and realized when in contact with or inside another organism in which it is capable of replicating and causing disease"@en . "disposition to infect an organism"@en . . _:genid13913 . _:genid13913 . _:genid13913 . _:genid13913 . . "a material that is added to another one in a material combination process"^^ . "material to be added"^^ . . _:genid13914 . _:genid13914 . _:genid13914 . _:genid13914 . . "A material entity into which another is being added in a material combinatino process"^^ . "target of material addition"^^ . . . _:genid13915 . _:genid13915 . _:genid13915 . _:genid13915 . "Any molecule recognized by the adaptive immune receptors? Recognized means bound with a certain affinity? From GO ag binding:Interacting selectively with an antigen, any substance which is capable of inducing a specific immune response and of reacting with the products of that response, the specific antibody or specifically sensitized T-lymphocytes, or both. Binding may counteract the biological activity of the antigen. see OBI_1110120 below"@en . "assay antigen role"@en . . . "abnormal, harmful processes caused by or associated with a disease"@en . "pathologic process"@en . . . _:genid13916 . _:genid13918 _:genid13917 . _:genid13917 . _:genid13917 . _:genid13919 . _:genid13920 . _:genid13922 _:genid13921 . _:genid13920 _:genid13922 . _:genid13921 . _:genid13921 . _:genid13921 . _:genid13922 . _:genid13919 _:genid13920 . _:genid13917 _:genid13919 . _:genid13924 _:genid13923 . _:genid13918 _:genid13924 . _:genid13923 . _:genid13923 . _:genid13923 . _:genid13924 . _:genid13916 _:genid13918 . _:genid13916 . _:genid13925 . _:genid13925 . _:genid13925 . _:genid13925 . "An in vitro cell killing assay in which radioactive chromium is absorbed by cells and released into supernatant when the cells die. The amount of radioactivity measured in the supernatant is a proxy for the number of cells that have died."^^ . "chromium release assay" . . . "A luminous flux quality inhering in a bearer by virtue of the bearer's emitting longer wavelength light following the absorption of shorter wavelength radiation; fluorescence is common with aromatic compounds with several rings joined together."^^ . "fluorescence"^^ . . . "A physical quality that inheres in a bearer by virtue of the proportion of the bearer's amount of matter."^^ . "mass"^^ . . . "An organismal quality inhering in a bearer or a population by virtue of the bearer's disposition to survive and develop normally or the number of surviving individuals in a given population."^^ . "viability"^^ . . . "A quality of a physical entity that exists through action of continuants at the physical level of organisation in relation to other entities."^^ . "physical quality"^^ . . . "A quality which inheres in a continuant."^^ . "physical object quality"^^ . . . "A physical quality that inheres in an bearer by virtue of how that bearer interacts with electromagnetic radiation."^^ . "electromagnetic (EM) radiation quality"^^ . . . "A scalar optical quality which obtains by the magnitude of the light emitted by the bearer."^^ . "luminous flux"^^ . . . "An EM radiation quality in which the EM radiation is within the fiat range of the spectrum visible deemed to be light."^^ . "optical quality"^^ . . . "A viability quality inhering in a bearer by virtue of the bearer's condition before death."^^ . "alive"^^ . . . "A viability quality inhering in a bearer by virtue of the cessation of the bearer's life."^^ . "dead"^^ . . . "A quality that inheres in an bearer by virtue of how that bearer interacts with radiation."^^ . "radiation quality"^^ . . . "A radiation quality inhering in a radioactive substance by virtue of its transformation (disintegration) rate."^^ . "activity (of a radionuclide)"^^ . . . "A radiation quality inhering in bearer by virtue of the bearer's exhibiting or being caused by radioactivity."^^ . "radioactive"^^ . . . "A quality that inheres in an entire organism or part of an organism."^^ . "organismal quality"^^ . . . "An amino acid chain that is produced de novo by ribosome-mediated translation of a genetically-encoded mRNA."^^ . "protein"^^ . . . . _:genid13926 . _:genid13926 . _:genid13927 . _:genid13927 . _:genid13927 . _:genid13926 _:genid13927 . _:genid13926 . "A protein that is a translation product of the Escherichia coli K-12 ligA gene or a 1:1 ortholog thereof."^^ . "DNA ligase"^^ . . . "A protein that is a translation product of the Aspergillus oryzae nucS gene or a 1:1 ortholog thereof."^^ . "nuclease S1"^^ . . . "a reagent role inhering in a molecular entity intended to associate with some molecular target to serve as a proxy for the presence, abundance, or location of this target in a detection of molecular label assay." . "molecular label role"@en . . _:genid13928 . _:genid13929 . _:genid13931 _:genid13930 . _:genid13929 _:genid13931 . _:genid13930 . _:genid13930 . _:genid13930 . _:genid13931 . _:genid13928 _:genid13929 . _:genid13928 . . "a molecular reagent intended to associate with some molecular target to serve as a proxy for the presence, abundance, or location of this target in a detection of molecular label assay" . "molecular label" . . . "A sequence_feature with an extent greater than zero. A nucleotide region is composed of bases and a polypeptide region is composed of amino acids."^^ . "region"^^ . . . "A fluid that is composed of blood plasma and erythrocytes."^^ . "blood"^^ . . . "Material anatomical entity in a gaseous, liquid, semisolid or solid state; produced by anatomical structures or derived from inhaled and ingested substances that have been modified by anatomical structures as they pass through the body."^^ . "organism substance"^^ . . . "Anatomical entity that has mass."^^ . "material anatomical entity"^^ . . . "Anatomical group that has its parts adjacent to one another."^^ . "anatomical cluster"^^ . . . "Multicellular anatomical structure that consists of many cells of one or a few types, arranged in an extracellular matrix such that their long-range organisation is at least partly a repetition of their short-range organisation."^^ . "tissue"^^ . . . "The brain is the center of the nervous system in all vertebrate, and most invertebrate, animals. Some primitive animals such as jellyfish and starfish have a decentralized nervous system without a brain, while sponges lack any nervous system at all. In vertebrates, the brain is located in the head, protected by the skull and close to the primary sensory apparatus of vision, hearing, balance, taste, and smell[WP]."^^ . "brain"^^ . . . "Excretion that is the output of a kidney"^^ . "urine"^^ . . . "A unit which is a standard measure of the amount of matter/energy of a physical object."^^ . "mass unit"^^ . . . "A unit which is a standard measure of the dimension in which events occur in sequence."^^ . "time unit"^^ . . . "A unit which represents a standard measurement of how much of a given substance there is mixed with another substance."^^ . "concentration unit"^^ . . . . _:genid13932 . _:genid13933 . _:genid13934 . _:genid13933 _:genid13934 . _:genid13935 . _:genid13934 _:genid13935 . _:genid13935 . _:genid13932 _:genid13933 .